KASP molecular marker of stripe rust resistance gene YrAK58.3 in wheat adult-plant stage, primer group and application of KASP molecular marker and primer group

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to a KASP molecular marker of a stripe rust resistance gene YrAK58.3 in a wheat adult-plant stage, a primer group and application of the KASP molecular marker and the primer group. The KASP molecular marker is Ta4631, the nucleotide sequence of the KASP molecular marker is shown as SEQ ID NO.1, and mutation from A to C exists at the 119th site from the 5'end; the nucleotide sequence of the stripe rust resistance gene YrAK58.3 in the wheat adult-plant stage is as shown in SEQ ID NO. 2. The KASP molecular marker provided by the invention has the characteristic of codominance, and the specific primer of the KASP molecular marker can be used for accurately and efficiently identifying whether the stripe rust resistant wheat variety contains the stripe rust resistant gene YrAK58.3 or not. The KASP molecular marker provided by the invention can be used in molecular marker-assisted breeding, and the breeding selection efficiency is greatly improved.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and specifically relates to a gene for wheat adult plant resistance to stripe rust YrAK58.3 KASP molecular markers, primer sets and their applications. Background Art

[0002] Due to the continuous mutation of stripe rust, new toxic and prevalent species have been produced, resulting in an extreme lack of effective anti-stripe rust resources in my country, especially broad-spectrum and long-lasting disease-resistant gene resources. Therefore, the exploration and identification of disease-resistant gene resources is always the most fundamental solution.

[0003] With the progress of modern biotechnology and the application of molecular marker technology, we have discovered and named a large number of stripe rust resistance genes. So far, there are 87 stripe rust resistance genes (Yr1-Yr87) that have been officially named, and there are many temporary stripe rust resistance genes or QTL genetic loci. Since different breeding units in different regions use the same type of resistance source or a single stripe rust resistance gene in large quantities at the same time, the large-scale promotion of new varieties has caused strong selection pressure on stripe rust, which is conducive to the generation and prevalence of new toxic subspecies of stripe rust and becomes a dominant subspecies, overcoming the resistance of stripe rust resistance genes, and ultimately causing the variety to lose disease resistance. Therefore, it is urgent to explore and utilize new disease resistance gene resources from common wheat materials to further broaden the genetic basis of disease-resistant breeding materials.

[0004] Common wheat variety Aikang 58 is a well-used comprehensive resistance variety in production practice. Previous studies have found that it carries stripe rust resistance genes Yr5b, YrAK58.1 (Yr6), YrAK58.2 (Yr52), and YrAK58.3 (YrZH84). Among them, Yr5b located on chromosome 2BL has good resistance to physiological race CYR32, and Yr6 and YrAK58.2 located on chromosome 7BL have good resistance to physiological race CYR34. In order to further develop and utilize the above-mentioned stripe rust resistance genes, it is necessary to develop molecular markers for stripe rust resistance genes to assist in the research of disease-resistant breeding materials.

[0005] At present, many molecular markers developed for stripe rust resistance genes are mainly developed and applied for wheat stripe rust resistance in the seedling stage. However, there are differences between wheat resistance in the adult stage and resistance in the seedling stage. Resistance in the seedling stage is often specific resistance to pathogenic bacteria, which can be easily overcome by complex flora in the field, and then "lost" resistance; and resistance in the adult stage often has non-specific resistance to pathogenic bacteria, thus having the characteristics of broad spectrum and persistence. However, resistance in the adult stage is mostly quantitative trait resistance, and because its resistance effect is not as good as that of a single major effect gene, it is difficult to select it through conventional technology in the early stage, and most breeding units do not have the ability to accurately identify disease resistance. Therefore, it is necessary to use molecular markers for stripe rust resistance genes to solve problems that conventional technology cannot solve. However, there are relatively few specific molecular markers for wheat stripe rust resistance genes in the adult stage, which makes it difficult to specifically screen out wheat varieties with stable stripe rust resistance in the adult stage during the breeding process. Therefore, it is urgent to develop corresponding tightly linked or co-segregated molecular markers. Summary of the invention

[0006] In order to solve the problem that there are relatively few specific markers for wheat stripe rust resistance genes in the adult stage in the prior art, which makes it difficult to specifically screen out wheat varieties with stable stripe rust resistance in the adult stage during the breeding process, the present invention provides a KASP molecular marker for wheat stripe rust resistance genes in the adult stage, a primer set and their application. To achieve the above purpose, the present invention adopts the following technical solution.

[0007] The first object of the present invention is to provide a wheat adult stage stripe rust resistance gene YrAK58.3 The KASP molecular marker is Ta4631, and its nucleotide sequence is shown in SEQ ID NO. 1, wherein the 119th base from the 5' end is a SNP site, and the base at this site undergoes a SNP mutation from A to C.

[0008] 5'-GGGAGAGAACGATGGCTCTCATGTACGGTAACCTACAAAACATCAGTGGCTACAATAGTAATGAAGAAGAAAATAGGCTGACTCATCCAGAACTGGAGGAGGATGCTAGGTACTCTAG[A / C]ATTATTAGTTTTTCCTTGGATTCAACTCCGATAGTTCGACACTTATTTGCTGGATTTACACTCTTCCAGATACCAGAAGGCTTCCATGCAACAACTTGGACAAGCTATGCTCGATCACATCAAGTCCAACAGGC-3', wherein A in [A / C] is the mutation site and C is the site after mutation.

[0009] The KASP molecular marker provided by the present invention can accurately predict the wheat stripe rust resistance gene in the adult stage YrAK58.3 , for the subsequent wheat adult stage stripe rust resistance gene YrAK58.3 The cloning of the wheat adult stage stripe rust resistance gene provided by the present invention is of great significance. YrAK58.3 The KASP molecular marker is a specific marker for the stripe rust resistance gene in the adult stage of wheat, which solves the problem in the current wheat breeding process that it is difficult to specifically screen out wheat varieties with stable stripe rust resistance in the adult stage.

[0010] Preferably, the KASP molecular marker is used to detect the wheat stripe rust resistance gene in the adult stage. YrAK58.3.

[0011] Wheat adult stage stripe rust resistance gene YrAK58.3 Candidate genes TraesCS7B03G1245900 The nucleotide sequence is shown in SEQ ID NO.2.

[0012] The second object of the present invention is to provide a primer set for amplifying the KASP molecular marker, comprising a forward primer 1, a forward primer 2 and a reverse primer 3.

[0013] The nucleotide sequence of the forward primer 1 is shown in SEQ ID NO.3.

[0014] The nucleotide sequence of the forward primer 2 is shown in SEQ ID NO.4.

[0015] The nucleotide sequence of the reverse primer 3 is shown in SEQ ID NO.5.

[0016] Preferably, fluorescent label sequences are added to the 5' ends of the forward primer 1 and the forward primer 2, respectively.

[0017] Preferably, the nucleotide sequence of the forward primer 1 after adding the fluorescent label sequence is as shown in SEQ ID NO.6; the nucleotide sequence of the forward primer 2 after adding the fluorescent label sequence is as shown in SEQ ID NO.7.

[0018] The third object of the present invention is to provide a method for detecting the wheat stripe rust resistance gene in the adult stage. YrAK58.3 A PCR reagent or a kit containing the PCR reagent, wherein the PCR reagent includes a primer set for amplifying the KASP molecular marker.

[0019] Preferably, the PCR reagent is a set of reagents consisting of PCR reagent 1 and PCR reagent 2, or the PCR reagent is PCR reagent 3.

[0020] The PCR reagent 1 includes the forward primer 1 or the forward primer 1 with a sequence of a fluorescent label added thereto.

[0021] The PCR reagent 2 includes the forward primer 2 or the forward primer 2 with a fluorescent label sequence added thereto.

[0022] The PCR reagent 3 includes the reverse primer 3.

[0023] The nucleotide sequence of the forward primer 1 is shown as SEQ ID NO. 3, and the nucleotide sequence of the forward primer 1 after adding the sequence of the fluorescent label is shown as SEQ ID NO. 6.

[0024] The nucleotide sequence of the forward primer 2 is shown as SEQ ID NO.4, and the nucleotide sequence of the forward primer 2 after adding the fluorescent label sequence is shown as SEQ ID NO.7.

[0025] The nucleotide sequence of the reverse primer 3 is shown in SEQ ID NO.5.

[0026] The fourth object of the present invention is to provide applications of the KASP molecular marker, the primer set or the PCR reagent or the kit, wherein the applications include at least one of the following applications: Detection of genes resistant to stripe rust in adult wheat YrAK58.3.

[0027] Assisted wheat breeding.

[0028] Preparation and detection of wheat stripe rust resistance genes in adult stage YrAK58.3 products.

[0029] Preparation of products to assist in wheat breeding.

[0030] Preferably, detection of wheat stripe rust resistance genes in adult stage YrAK58.3 The steps are as follows: Extract the genomic DNA of the wheat to be tested.

[0031] The wheat genomic DNA is used as a template and the primer set is used for PCR amplification.

[0032] The PCR amplification product is subjected to typing detection.

[0033] The primer set is used to determine the genotype of the SNP site of the KASP molecular marker.

[0034] Judgment result: If the genotype is "CC" homozygous or "AC" heterozygous, the wheat to be tested is a candidate wheat with stripe rust resistance; if the genotype is "AA" homozygous, the wheat to be tested is a candidate wheat with stripe rust susceptibility.

[0035] YrAK58.3 It has good resistance in the adult stage. Through fine positioning and further gene annotation analysis of the YrAK58.3 locus, it was found that this interval contains 9 highly reliable disease resistance genes, including TraesCS7B03G1245900 The transmembrane protein, putative (DUF594) gene is highly expressed during the infection of stripe rust, and it is speculated to be an important candidate gene. Based on the difference in the sequence of the gene between its parents Avocet S and Aikang 58, the corresponding KASP gene functional marker Ta4631 was developed, and molecular detection was carried out in natural population materials. It was found that its presence can improve the resistance of wheat to stripe rust, thereby reducing the damage of stripe rust in the adult stage of wheat. At the same time, it also has great potential application value for improving the stripe rust resistance of wheat in the adult stage in the future. Therefore, the development of molecular markers for this stripe rust resistance gene is of great significance for molecular-assisted breeding of multiple disease resistance genes.

[0036] Compared with the prior art, the present invention has the following beneficial effects: 1. The present invention provides a wheat adult stage stripe rust resistance gene YrAK58.3 KASP molecular markers, which can accurately predict wheat stripe rust resistance genes in adult stage YrAK58.3 , for the subsequent wheat adult stage stripe rust resistance gene YrAK58.3 The cloning of the wheat adult stage stripe rust resistance gene provided by the present invention is of great significance. YrAK58.3 The KASP molecular marker is a specific marker for the stripe rust resistance gene in the adult stage of wheat, which solves the problem in the current wheat breeding process that it is difficult to specifically screen out wheat varieties with stable stripe rust resistance in the adult stage.

[0037] 2. The present invention provides a method for amplifying the wheat stripe rust resistance gene in the adult stage YrAK58.3 The KASP molecular marker and its primer set can be quickly and high-throughput applied to molecular-assisted breeding for wheat variety improvement, thereby accelerating the wheat breeding process at the whole genome level. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 The scatter plot of amplification typing of the primer set of molecular marker Ta4631 in Example 2 of the present invention for the disease-resistant parent, the disease-susceptible parent, and 388 wheat varieties; wherein, Figure 1 Figure a in the figure is a scatter plot of amplification typing of the primer set of molecular marker Ta4631 for the disease-resistant parent, the disease-susceptible parent, and 388 wheat varieties; Figure 1Figure b is a box plot of disease severity; among them, FAM is on the X-axis, HEX is on the Y-axis, ++ indicates the same typing as the resistant parent, -- indicates the same typing as the susceptible parent, and +- indicates the heterozygous type.

[0039] Figure 2 It is the genetic linkage map constructed by the 660K chip and the SNP markers in the candidate gene in Example 1 of the present invention and the position map of the SNP markers in the genetic linkage map; wherein, Figure 2 a in is the rough localization map of YrAK58.3; Figure 2 b in the figure is the fine positioning map of YrAK58.3; Figure 2 Figure c is the genetic integration map of chromosome 7BL where YrAK58.3 is located, in which I, II, and III are three different disease resistance hotspot enrichment areas. DETAILED DESCRIPTION

[0040] The present invention is described in detail below in conjunction with the accompanying drawings and specific examples, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0041] The test materials and their preparation used in the embodiments of the present invention are as follows: The wheat material used in the embodiment of the present invention is common wheat, specifically the dwarf resistant 58 material and its derivative varieties bred by the Wheat Breeding Center of Henan Institute of Science and Technology.

[0042] The stripe rust in the present invention may specifically be the stripe rust caused by the currently popular stripe rust fungi races CYR32, CYR33 and CYR34.

[0043] Example 1: Wheat adult stage stripe rust resistance gene YrAK58.3 Acquisition of molecular markers 1. Construction of genetic population and genetic analysis (1) Wheat materials for testing: The parents used in genetic population construction were Aikang 58 and Avocet S.

[0044] Among them, the disease-resistant parent, Aikang 58, was bred by the Wheat Breeding Center of Henan Institute of Science and Technology and is resistant to the current popular stripe rust race CYR34 in the seedling stage. The susceptible parent is the Australian susceptible variety Avocet S (AvS), with Avocet S (AvS) as the female parent and the disease-resistant variety Aikang 58 as the male parent. 1 , F 1 Self-fertilization to obtain F 2 , F 2The single plants are continuously self-pollinated using the "single seed transmission" method to obtain recombinant inbred lines (RILs) for genetic analysis and gene positioning.

[0045] Common wheat Xiaoyan 22 is a cultivated variety and can be obtained from the National Crop Germplasm Resource Bank as a susceptible control.

[0046] (2) Phenotypic evaluation and phenotypic data analysis of the test population: The steps and methods for field resistance identification at the adult stage are as follows: 124 F 7 RILs were sown at two experimental sites, Yangling (34°17'N, 108°04'E, 519m above sea level) and Jiangyou (31°53'N, 104°47'E, 571m above sea level). A completely randomized block design was used with three replicates, and about 40 seeds were planted in each family in each replicate. Each family was sown in a single row, with a row length of 1.2m and a row spacing of 30cm. Every 20 rows, one row of both parents and two rows of Xiaoyan 22 were planted as disease-susceptible indicator varieties, and 5 rows of Mingxian 169 were sown every 50 rows, and 30 seeds of Mingxian 169 were sown every 1.5m between the plots as induction rows. Jiangyou belongs to the winter breeding area of ​​stripe rust, and the climatic conditions at this location are very suitable for the natural occurrence and spread of stripe rust, so there is no need for artificial inoculation. Yangling belongs to the occasional stripe rust area, so artificial inoculation is carried out in mid-March every year when wheat grows to the jointing stage. Irrigation is carried out once a week before inoculation, which can be omitted in case of rain. Artificial inoculation in the field uses the current popular stripe rust species CYR32, CYR33 and CYR34, and is generally carried out after 6 pm, when the air in the field is humid and water droplets often condense on the leaves, which is very conducive to stripe rust infection. The specific artificial inoculation method is as follows:

[0047] First, mix the summer spores of stripe rust with paraffin oil at a volume ratio of 1:300, then use a throat sprayer to spray directly on the inducing Mingxian 169, then use a plastic bag to keep it moist, and open the bag before noon the next day. The incidence of stripe rust is investigated every year according to the actual situation. Generally, the investigation is conducted three times, namely the initial outbreak period, the peak outbreak period and the final outbreak period. However, in some years, only the final outbreak period is investigated, when the stripe rust is the most serious, that is, the entire flag leaf of the diseased control is often covered with stripe rust spores.

[0048] According to the survey experience over the years, the stripe rust disease period is from April 1st to April 15th in Jiangyou and from May 1st to May 20th in Yangling. Therefore, this period was chosen to conduct the disease survey. The disease survey record is the same as the greenhouse adult plant test. For homozygous families, only one value is recorded; for segregated families, two or more values ​​are generally recorded, namely the maximum, minimum and middle values. In this experiment, the maximum disease severities (MDS) was selected as the analysis indicator, and then MDS was used for analysis of variance (ANOVA) and correlation analysis (correlationanalysis). The AOV function in the IciMapping V4.1 software was used for calculation, and the broad-sense heritability was calculated based on the variance results. The formula is as follows:

[0049] h2 b = σ2 g / ( σ2 g + σ2ge / e + σ2 ε / re ),in σ2 g =( MS f – MS fe ) / re, σ2ge =( MS fe – MS e ) / r, σ2 ε = MS e (Allard 1960); In the above formula, h2 b represents heritability, σ2 g represents the genotype variance, σ2ge represents the genotype-environment interaction effect, σ2 ε represents error; e is the number of environments, and r is the number of repetitions in each environment.

[0050] The results of variance analysis showed that there were extremely significant differences in stripe rust resistance among different genotypes, and the correlation coefficients of the four environments were between 0.71 and 0.92, with good correlation, which clarified the validity of the phenotypic data.

[0051] 2. Genetic map construction and stripe rust resistance genes YrAK58.3 Localization and cloning of candidate genes (1) Bulked segregant analysis (BSA) combined with wheat microarray analysis: When the wheat grew to the 3-leaf stage, the 3rd leaf of each parent and plant / family was collected and DNA was extracted using the CTAB method. 2 The stripe rust resistance segregation characteristics of the offspring population and the RIL family of AvS×AK58 were analyzed by cluster segregation analysis. Ten extremely resistant plants / families and ten extremely susceptible plants / families were selected, and equal amounts of DNA were extracted to construct two groups of resistance and susceptible pools. After quality inspection, the constructed resistance and susceptible pools and parents were sent to Beijing Bio Biotechnology Co., Ltd. for genotyping using the wheat 660K SNP chip. The location of the QTL locus was preliminarily determined based on the chromosome where the number of differential SNPs was located and the degree of concentration on the chromosome. Then, polymorphic KASP markers were developed, and the RIL population was genotyped and a genetic map was drawn using the IciMapping software. A new stripe rust resistance gene was located in this population and named YrAK58.3 . YrAK58.3 Wheat adult stage stripe rust resistance gene YrAK58.3 , hereinafter referred to as YrAK58.3 , and its KASP molecular marker is Ta4631. The nucleotide sequence of Ta4631 is shown in SEQ ID NO. 1:

[0052] 5'-GGGAGAGAACGATGGCTCTCATGTACGGTAACCTACAAAACATCAGTGGCTACAATAGTAATGAAGAAGAAAATAGGCTGACTCATCCAGAACTGGAGGAGGATGCTAGGTACTCTAG[A / C]ATTATT AGTTTTCCTTGGATTCAACTCCGATAGTTCGACACTTATTTGCTGGATTTACACTCTTCCAGATACCAGAAGGCTTCCATGCAACAACTTGGACAAGCTATGCTCGATCACATCAAGTCCAACAGGC-3'.

[0053] The primer set designed for Ta4631 is as follows: Forward primer 1: The nucleotide sequence of Ta4631A is shown in SEQ ID NO. 3: 5'-AGGAGGATGCTAGGTACTCTAGA-3'.

[0054] Forward primer 2: The nucleotide sequence of Ta4631B is shown in SEQ ID NO. 4: 5'-AGGAGGATGCTAGGTACTCTAGC-3'.

[0055] Reverse primer 3: The nucleotide sequence of Ta4631C is shown in SEQ ID NO. 5: 5'-CCAGCAAATAAGTGTCGAACTATC-3'.

[0056] Wherein, a fluorescent label sequence and a FAM probe sequence are added to the 5' end of the forward primer 1.

[0057] The nucleotide sequence of the forward primer 1 after adding the sequence of the fluorescent label is shown in SEQ ID NO.6: 5'-gaaggtgaccaagttcatgctAGGAGGATGCTAGGTACTCTAGA-3'.

[0058] A fluorescent tag sequence and a HEX probe sequence were added to the 5' end of the forward primer 2.

[0059] The nucleotide sequence of the forward primer 2 after adding the fluorescent tag sequence is shown in SEQ ID NO.7: 5'-gaaggtcggagtcaacggattAGGAGGATGCTAGGTACTCTAGC-3'.

[0060] (2) YrAK58.3 Fine mapping and candidate gene cloning: The remaining heterozygous population was further used to carry out fine mapping of the locus. YrAK58.3 The remaining heterozygous families AAKHIF4, AAKHIF38, AAKHIF52 and AAKHIF81 were self-fertilized to create F 2 Secondary segregation population. Approximately 200 F 2 Individual plants were used as the basic isolation group. 2 The phenotype and segregation of individual plants were used to screen the population whose target trait was controlled by a single gene (the ratio of disease resistance: susceptible separation was 3:1) for preliminary and fine positioning.

[0061] F required in the fine positioning process 2 The isolated population consists of more than 5000 individual plants, 2 or F 2:3 The derived population composition was determined by using the F 2:3 Based on the identification results in multiple environments, families with extreme phenotypes were selected to construct a disease-resistant / susceptible mixed pool: 30 susceptible families (genotype yrAK58.3 / yrAK58.3 , i.e. recessive homozygous), to construct a susceptible homozygous pool; 30 dominant homozygous disease-resistant families (genotype YrAK58.3 / YrAK58.3 ) to construct a disease-resistant mixed pool. The two mixed pools and the two parents were genotyped by wheat 660K SNP chip and sequenced by RNA-Seq. In addition, the genome of each parent of the isolated population was resequenced at 10×. The specific steps are as follows:

[0062] 1) For SNP chip typing data: After mining the differential SNPs between the resistance and susceptible pools, the chromosome distribution and genetic and physical location information of the differential SNP sites are obtained based on the reference integrated genetic map and physical map. The Perl language program is used to calculate and count the number of differential SNPs contained in each megabase pair (Mb) or each centimole (cM) of genetic distance to understand the enrichment of SNP distribution on the chromosome, so as to determine the possible range of the target gene.

[0063] 2) For RNA-Seq data, the sequencing data was aligned to the Chinese Spring reference genome sequence and SNPCalling was performed and the Index value of the SNP site (the proportion of a certain genotype to the total genotype) was calculated. In most regions of the genome, due to the free combination of genes, the above Index value is about 0.5; in the gene region that controls the target trait, the Index values ​​of the two extreme mixed pools will be significantly different, which can quickly complete the initial positioning and roughly lock the target gene in a certain interval on the chromosome, which is locked in the 690-750 Mb interval of chromosome 7BL.

[0064] 3) Since the genome of one of the parents, Dwarf Kang 58, has been basically assembled, the resequencing data of the other parents can be compared with it, and the Chinese Spring genome will also be referenced during the process to explore more DNA variation information. Finally, the data results of the three methods are integrated to provide a reference for the subsequent development of molecular markers.

[0065] The SNP-based KASP molecular markers were developed based on the positioning intervals of the above methods, and the F 2:3 Separate the population for genotyping. 2:3After separating the phenotypic data and genotypic data of the population under multiple environments, the data were analyzed using two methods: qualitative traits and quantitative traits. For qualitative traits, Joinmap software was used to combine phenotypes and genotypes according to the Kosambi function to calculate the recombination exchange rate and draw a linkage map. For quantitative traits, the inclusive composite interval mapping (ICIM) method was used to select QTL IciMapping V4.1 software for QTL positioning. Finally, the results of the two methods were combined to verify the positioning interval. After determining that the target gene interval is in the range of 700Mb~710Mb of the Chinese Spring reference genome, appropriate flanking markers at both ends were selected, such as AX-109545885 and 7B_ 725766535 , in F 2 Key recombinants are screened in large populations, and the genotypes and phenotypes of these key recombinants are analyzed and confirmed, combined with the newly developed molecular markers in the fine positioning process, to establish marker and phenotype (corresponding YrAK58.3 The linkage relationship between the dominant homozygous and heterozygous materials is determined by whether the offspring phenotypes are separated) and the closer flanking markers are determined. Finally, the target interval is locked in AX-108746141 and AX-111168714 The corresponding interval is 729.732Mb~730.681Mb of chromosome 7B in the Chinese Spring reference genome v.2.1. According to the Chinese Spring gene annotation results, there are 9 highly credible genes, which are TraesCS7B03G1245500.1, TraesCS7B03G1245600.1, TraesCS7B03G1245900.1, TraesCS7B03G1246000.1, TraesCS7B03G1246100.1, TraesCS7B03G1246300.1, TraesCS7B03G1246800.1, TraesCS7B03G1247900.1 and TraesCS7B03G1248100.1 , respectively annotated as Receptor-like protein kinase, receptor kinase 1, transmembrane protein, putative (DUF594), Receptor-like protein kinase, wall-associated receptor kinase-like protein, Non-lysosomal glucosylceramidase, Wall-associated receptor kinase 3, Disease resistance protein RPM1, Receptor-like kinase. According to the transcriptome data, only TraesCS7B03G1245900 The expression of the genes was induced by stripe rust, while the other genes were basically not expressed. TraesCS7B03G1245900It is an important candidate gene. Based on the sequence differences of this gene in disease-resistant and disease-susceptible materials, the molecular marker of this gene was developed and designed using Primer 5.0 software. Ta4631 , and its robustness was verified in subsequent recombinant strains.

[0066] Among them, the above TraesCS7B03G1245900 Wheat adult stage stripe rust resistance gene YrAK58.3 Candidate genes TraesCS7B03G1245900 , whose nucleotide sequence is shown in SEQ ID NO.2:

[0067] YrAK58.3 The result of coarse positioning is as follows Figure 2 Figure a in .

[0068] YrAK58.3 The results of fine positioning are as follows Figure 2 Figure b in .

[0069] Depend on Figure 2 As shown in Figure b, Ta4631 Marking and YrAK58.3 The phenotypes co-segregated.

[0070] Example 2: Wheat adult stage stripe rust resistance gene YrAK58.3 Feasibility verification of molecular markers The present invention is to modify the wheat adult stage stripe rust resistance gene YrAK58.3 Candidate genes TraesCS7B03G1245900 Functional molecular markers Ta4631 (hereinafter referred to as Ta4631) and its dedicated primer set for feasibility verification, and the following studies were conducted: 1. Molecular detection of stripe rust resistance genes in 388 wheat cultivars Methods: The primer set of Ta4631 was used to detect the stripe rust resistance genes in 388 wheat cultivars.

[0071] 1. Use the primer set of Ta4631 to detect 388 samples of the tested varieties using the method of the embodiment, wherein the DNA concentration is 100 ng / μL of the template solution.

[0072] The primer set for Ta4631 is as follows: Forward primer 1: The nucleotide sequence of Ta4631A is shown in SEQ ID NO. 3: 5'-AGGAGGATGCTAGGTACTCTAGA-3'.

[0073] Forward primer 2: The nucleotide sequence of Ta4631B is shown in SEQ ID NO. 4: 5'-AGGAGGATGCTAGGTACTCTAGC-3'.

[0074] Reverse primer 3: The nucleotide sequence of Ta4631C is shown in SEQ ID NO. 5: 5'-CCAGCAAATAAGTGTCGAACTATC-3'.

[0075] Wherein, a fluorescent label sequence and a FAM probe sequence are added to the 5' end of the forward primer 1.

[0076] The nucleotide sequence of the forward primer 1 after adding the sequence of the fluorescent label is shown in SEQ ID NO.6: 5'- gaaggtgaccaagttcatgct AGGAGGATGCTAGGTACTCTAGA-3'.

[0077] A fluorescent tag sequence and a HEX probe sequence were added to the 5' end of the forward primer 2.

[0078] The nucleotide sequence of the forward primer 2 after adding the fluorescent tag sequence is shown in SEQ ID NO.7: 5'- gaaggtcggagtcaacggatt AGGAGGATGCTAGGTACTCTAGC-3'.

[0079] 2. If the genotype of the target SNP containing the marker is "CC" homozygous or "AC" heterozygous, the wheat to be tested is a candidate wheat with potential stripe rust resistance; if the genotype of the target SNP containing the marker is "AA" homozygous, the wheat to be tested is a candidate wheat with stripe rust susceptibility. The results are as follows: Figure 1 Figure a in .

[0080] Depend on Figure 1 As shown in Figure a, Ta4631 can amplify the "CC" homozygous type in the disease-resistant parent, and all "CC" homozygous types or "AC" heterozygous types are possible target gene materials. Figure 1 As shown in Figure b, the resistance of the "CC" homozygous type, i.e., the material containing the target gene, in the adult stage is better than that of the "AA" homozygous type. This indicates that the molecular marker Ta4631 can be used to detect wheat stripe rust resistance. The specific results of the genotypes and stripe rust phenotypes of 388 wheat cultivars detected by the Ta4631 primer set are shown in Table 1.

[0081] Table 1 Genotypes and stripe rust phenotypes of 388 wheat cultivars detected by the Ta4631 primer set As shown in Table 1, Ta4631 can amplify "CC" homozygous and "AA" homozygous in disease-resistant / susceptible parents respectively. All "CC" homozygous or "AC" heterozygous are materials that may carry the target gene, and their stripe rust resistance phenotype, i.e., severity values, are generally smaller than those of "AA" homozygous materials (without the target gene), indicating that their field resistance is good. This indicates that the molecular marker Ta4631 can be used to detect wheat stripe rust resistance.

[0082] The above experimental results show that Ta4631, as a functional molecular marker of the candidate gene, is effective in a large genetic population (more than 5000 F 21 generation), co-segregated with the stripe rust resistance phenotype, indicating that the marker was tightly linked to the target gene, which was consistent with previous markers such as Xgwm577 and Xbarc32 Compared with (see Figure 2 Its genetic distance is closer to the target gene, which means that it is less likely to undergo recombination, further ensuring the accuracy of the marker for detection. In addition, as a high-throughput KASP molecular marker, Ta4631 has another advantage in that it can detect large samples quickly and efficiently, and is easy to operate, ensuring the timeliness of field selection, which traditional SSR markers cannot achieve.

[0083] It should be noted that when the present invention involves a numerical range, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0084] Although preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they understand the basic inventive concepts, and all such changes and modifications fall within the scope of the present invention.

Claims

1. A wheat adult plant resistance gene YrAK58.3 The KASP molecular marker is characterized by: The KASP molecule marker is Ta4631, and its nucleotide sequence is shown in SEQ ID NO. 1, wherein there is a mutation from A to C at position 119 from the 5' end.

2. The KASP molecular marker according to claim 1, characterized in that The KASP molecular marker is used to detect the wheat stripe rust resistance gene in the adult stage YrAK58.3 ; Wheat adult stage stripe rust resistance gene YrAK58.3 Candidate genes TraesCS7B03G1245900 The nucleotide sequence is shown in SEQ ID NO.

2.

3. A primer set for amplifying the KASP molecular marker according to claim 1, characterized in that: comprising forward primer 1, forward primer 2 and reverse primer 3; The nucleotide sequence of the forward primer 1 is shown in SEQ ID NO. 3; The nucleotide sequence of the forward primer 2 is shown in SEQ ID NO. 4; The nucleotide sequence of the reverse primer 3 is shown in SEQ ID NO.

5.

4. The primer set according to claim 3, characterized in that: Fluorescent label sequences are added to the 5' ends of the forward primer 1 and the forward primer 2, respectively.

5. The primer set according to claim 4, characterized in that: The nucleotide sequence of the forward primer 1 after adding the fluorescent label sequence is shown as SEQ ID NO.6; the nucleotide sequence of the forward primer 2 after adding the fluorescent label sequence is shown as SEQ ID NO.

7.

6. Used to detect the wheat stripe rust resistance gene in the adult stage of claim 1 YrAK58.3 A PCR reagent or a kit containing the PCR reagent, characterized in that: The PCR reagents include a primer set for amplifying the KASP molecular marker.

7. The PCR reagent or a kit containing the PCR reagent according to claim 6, characterized in that: The PCR reagent is a set of reagents consisting of PCR reagent 1 and PCR reagent 2, or the PCR reagent is PCR reagent 3; The PCR reagent 1 includes the forward primer 1 or the forward primer 1 with a sequence of a fluorescent label added; The PCR reagent 2 includes the forward primer 2 or the forward primer 2 with a fluorescent tag sequence added; The PCR reagent 3 includes the reverse primer 3; The nucleotide sequence of the forward primer 1 is shown in SEQ ID NO. 3, and the nucleotide sequence of the forward primer 1 after adding the sequence of the fluorescent label is shown in SEQ ID NO. 6; The nucleotide sequence of the forward primer 2 is shown in SEQ ID NO. 4, and the nucleotide sequence of the forward primer 2 after adding the fluorescent label sequence is shown in SEQ ID NO. 7; The nucleotide sequence of the reverse primer 3 is shown in SEQ ID NO.

5.

8. Use of the KASP molecular marker according to claim 1, the primer set according to claim 3, or the PCR reagent or the kit according to claim 6, characterized in that: The application includes at least one of the following applications: Detection of genes resistant to stripe rust in adult wheat YrAK58.3 ; Assisted wheat breeding; Preparation and detection of wheat stripe rust resistance genes in adult stage YrAK58.3 products; Preparation of products to assist in wheat breeding.

9. The use according to claim 8, characterized in that: Detection of genes resistant to stripe rust in adult wheat YrAK58.3 The steps are as follows: Extracting genomic DNA of wheat to be tested; Using the wheat genomic DNA as a template, and using the primer set to perform PCR amplification; Performing typing detection on the PCR amplification product; Using the primer set to determine the genotype of the SNP site of the KASP molecular marker; Judgment result: If the genotype is "CC" homozygous or "AC" heterozygous, the wheat to be tested is a candidate wheat with stripe rust resistance; if the genotype is "AA" homozygous, the wheat to be tested is a candidate wheat with stripe rust susceptibility.

Images