Molecular marker obviously associated with wheat grain filling rate QTL QGFR.yzu-1BL and application

Abstract

The invention discloses a molecular marker obviously associated with wheat grain filling rate QTL QGFR.yzu-1BL and application of the molecular marker. A Yangmai 16 / Zhongmai 895 DH population and a 660K SNP high-density genetic map of the Yangmai 16 / Zhongmai 895 DH population are utilized, and a grain filling rate major QTL QGFR.yzu-1BL is positioned on a 1B chromosome long arm. The SNP (single nucleotide polymorphism) marker AX-95630347 is a marker in an interval in which the QGFR. Yzu-1BL is located. According to the invention, AX-95630347 is converted into the KASP marker AX-95630347-KASP, and a set of natural population material is utilized to verify the effectiveness and reliability of the KASP marker for auxiliary identification of the wheat grain filling rate. When the special primer group for the KASP marker is used for detecting the genotype of the SNP marker AX-95630347, the personal error is low, the analysis flux is high, and the special primer group is suitable for detecting a large number of samples. The KASP marker AX-110915909-KASP provided by the invention can be used for transformation of excellent alleles of the wheat grain filling rate QTL locus QGFR.yzu-1BL, and has important practical significance in accelerating genetic improvement by utilizing the excellent alleles of the QTL locus and improving the breeding efficiency.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular genetic breeding, and in particular to a QTL related to wheat grain filling rate. QGFR.yzu-1BL Significantly associated molecular markers and their applications. Background Art

[0002] my country is the world's largest wheat producer and consumer. Continuously increasing wheat production and striving for stable production is of great significance to ensuring food security in my country and the world. Thousand-grain weight is one of the three elements of wheat yield, and the Thousand-grain weight is determined by the grain filling process. Grain filling rate (GFR) is a key factor that affects the grain filling process of wheat and determines the final yield.

[0003] In wheat production, varieties with slow grain filling may encounter dry hot winds or high temperature forced ripening in the late growth period, resulting in insufficient grain filling and reduced yield. Large-grain materials may not be fully filled due to low GFR, affecting yield and grain commodity value. With global warming and frequent extreme weather, wheat may encounter adverse meteorological conditions more frequently during the grain filling period, affecting the grain filling process and leading to reduced yield. Improving GFR is an important way to optimize the wheat filling process, thereby increasing yield and ultimately achieving high and stable yields. As an important yield trait, GFR is a complex quantitative trait controlled by multiple genes. Discovering the major effect QTL regulating wheat GFR and developing reliable molecular markers are of great significance to the genetic improvement of wheat GFR and yield traits.

[0004] Previous researchers have located multiple QTL loci that control grain filling rate-related traits. Yu et al. (2022) and Sun Xiaoxiao (2018) used a RIL population and a natural population to conduct linkage analysis and association analysis on wheat GFR and grain weight and other grain traits, and located multiple stable GFR-related QTLs. In both studies, chromosome 4B was found to contain two GFR mean QTL, chromosome 2B contains 1 GFR max QTL. Lin et al. (2020) used three RIL populations combined with a 90K SNP chip to discover two stable grain filling rate QTLs that had significant effects on multiple yield traits. Hu Wenjing et al. (2020) used a four-parent RIL population combined with a 15K SNP chip to locate QTLs for GFR-related gene loci in materials such as Yangmai 16, and located five new QTLs related to grain filling rate, which were located on 3AL, 4DL (2), 6AL and 7AL.

[0005] Single nucleotide polymorphism (SNP) is the most common form of genetic variation between plant individuals and is an ideal molecular marker for genetic research on complex traits in plants. There are currently a variety of SNP genotyping methods, such as sequencing, solid-phase chip method, KASP tagging method, etc. Among them, the solid-phase chip method is to integrate a large number of SNP flanking sequences as probe sequences into a solid-phase probe array, which can simultaneously determine the genotypes of a large number of SNP markers in one test, but its determination cost is relatively high. Currently, the commonly used solid-phase SNP chips in wheat include 90K, 660K, 55K and other chips. Among them, the 660K SNP chip contains about 660,000 SNP marker information. With the development of biotechnology, competitive allele-specific PCR (Kompetitive AlleleSpecific PCR, KASP) technology is one of the methods for detecting SNP typing with high throughput, low cost and low error rate. It can realize high-throughput detection of a single SNP marker in a single test and plays an important role in the application of crop molecular marker-assisted breeding.

[0006] During the grain filling process of wheat, the accumulation of dry matter shows a three-stage growth of "slow-fast-slow", and its overall trend shows an "S"-shaped curve change, which can be fitted by the Logistic equation. According to the characteristics of the "slow-fast-slow" three-stage filling curve, the entire filling process can be divided into three periods: gradual increase period, rapid increase period and slow increase period. Among them, the rapid increase period is the period when the accumulation rate of grain dry matter is the fastest and the dry weight of grains increases almost linearly. The speed of the rapid increase period filling rate (GFR2) is the main reason for the difference in grain weight between varieties. The grain filling rate can reach its maximum value in the rapid increase period, that is, the maximum grain filling rate (GFR max ), which was highly positively correlated with GFR2.

[0007] Yangmai 16 and Zhongmai 895 were once the main varieties of winter wheat in the middle and lower reaches of the Yangtze River and the southern part of the Huanghuai winter wheat region, respectively. Both varieties have the characteristics of fast filling rate and high yield. Discovering the excellent genes for regulating GFR carried by these two materials and developing related molecular markers is of great significance for molecular breeding of wheat yield. Summary of the invention

[0008] In order to promote the molecular breeding process of improving wheat yield, the doubled haploid (DH) population of Yangmai 16 / Zhongmai 895 was used as the material, and the genotype data of wheat 660K SNP chip were used to construct a high-density genetic QTL positioning for wheat GFR-related traits. A stable major effect QTL regulating wheat GFR was located on the long arm of chromosome 1B, which was named QGFR.yzu-1BL The enhancement allele comes from Yangmai 16, the genetic confidence interval of the QTL is 128.5-129.5cM, and the markers on both sides areAX-110534755 and AX-111590092 , the corresponding physical positions of the two marker alleles in the Chinese Spring reference genome V1.0 version are bases 653939615 and 665050665 on the positive strand of chromosome 1B. According to the Chinese Spring reference genome V1.0 version, SNP markers AX-95630347 is distributed in QGFR.yzu-1BL A marker within the interval, the allelic variation of this SNP corresponds to the 658738539th base on the positive strand of chromosome 1B.

[0009] Based on the above research, the present invention will QGFR.yzu-1BL SNP chip markers within the interval AX-95630347 Transformed into KASP markers that enable high-throughput, low-cost, and low-error genotyping AX-95630347-KASP The effectiveness and reliability of KASP marker-assisted identification of high and low wheat grain filling rate were verified using a natural population of wheat materials from the Huanghuai wheat region, providing a basis for the use of grain filling rate QTL loci in breeding. QGFR.yzu-1BL Provides reliable molecular tools.

[0010] The first aspect of the present invention provides a QTL related to wheat grain filling rate QGFR.yzu-1BL The molecular markers with significant association are named AX-95630347 , which has a flanking sequence as shown in SEQ ID NO.1, and the polymorphism of the 36th base of the flanking sequence is A or C. The complementary sequence of the flanking sequence is shown in SEQ ID NO.2. According to the Chinese Spring wheat reference genome V1.0 version, SEQ ID NO.2 corresponds to the 658738504 to 658738574 base sequence on the positive strand of chromosome 1B, and the polymorphism of the 658738539 base is T or G, and the base in the Chinese Spring genome sequence is T.

[0011] The second aspect of the present invention provides a KASP primer set for identifying the above-mentioned molecular marker genotype, which comprises primer A, primer B and primer C, wherein: The primer A is as follows (a1) or (a2): (a1) From the 5' end to the 3' end, there is a fluorescent tag sequence A and a single-stranded DNA as shown in positions 22-46 of SEQ ID NO.3; (a2) A fluorescent tag sequence A and a DNA having the same function as SEQ ID NO. 3, wherein one or more nucleotides at positions 22-46 are replaced and / or deleted and / or added, from the 5' end to the 3' end; Primer B is as follows (b1) or (b2): (b1) From the 5' end to the 3' end, there are fluorescent tag sequence B and single-stranded DNA as shown in positions 22-46 of SEQ ID NO.4; (b2) A fluorescent tag sequence B and a DNA having the same function as SEQ ID NO. 4, wherein one or more nucleotides at positions 22-46 are replaced and / or deleted and / or added, from the 5' end to the 3' end; Primer C is as follows (c1) or (c2): (c1) a single-stranded DNA as shown in SEQ ID NO.5; (c2) A DNA having the same function as SEQ ID NO.5 after one or more nucleotides are substituted and / or deleted and / or added.

[0012] Furthermore, the fluorescent label sequence A is a fluorescent label sequence FAM, and the fluorescent label sequence B is a fluorescent label sequence HEX.

[0013] above: SEQ ID NO.1: 5'-GATCGTCGTGGTGCACACCGCCGGTAACAAAGGGTATCTGATGCAGACCATCAAGGACACCTCACCGTGGG-3'; SEQ ID NO.2: 5'-CCCACGGTGAGGTGTCCTTGATGGTCTGCATCAGATACCCTTTGTTACCGGCGGTGTGCACCACGACGATC-3; SEQ ID NO.3: 5'- GAAGGTGACCAAGTTCATGCT GTGTCCTTGATGGTCTGCATCAGAT-3'; SEQ ID NO.4: 5'- GAAGGTCGGAGTCAACGGATT GTGTCCTTGATGGTCTGCATCAGAG-3'; SEQ ID NO.5: 5'-GAGTGAGAACTCATTCGCTGCACTG-3'.

[0014] The third aspect of the present invention provides the use of the above primer set in any of the following: 1) Detect or assist in detecting SNP markers in the wheat to be tested AX-95630347 genotype; 2) Preparation and detection of wheat SNP markers AX-95630347The product of the genotype; 3) Preparation and detection of wheat grain filling rate QTL QGFR.yzu-1BL The product of the genotype; 4) preparing products for screening or breeding wheat plants, lines, strains or varieties with high grain filling rates; 5) Assist in the screening or breeding of wheat plants, plant lines, strains or varieties with high grain filling rate characteristics.

[0015] Preferably, in applications 2) to 4), the product is a PCR reagent or a kit.

[0016] Furthermore, the product also contains fluorescent probe A, fluorescent probe B, quenching probe A and quenching probe B, the fluorescent reporter group A is FAM, the fluorescent reporter group B is HEX, and the fluorescent quenching group is BHQ. The fluorescent probe A, the fluorescent probe B, the quenching probe A and the quenching probe B are present in KASP 2×Master Mix, wherein the KASP 2×Master Mix is ​​a product of the British LGC company, and the product catalog number is KBS-1016-002 (applicable to 96-well or 384-well PCR plates).

[0017] A fourth aspect of the present invention provides a method for detecting SNP markers in wheat AX-95630347 A method for genotyping comprising the steps of: The wheat genomic DNA to be tested was used as a template, and the above primer set was used for PCR amplification. The amplified product was scanned for fluorescence signals, and the scan data was analyzed using Kluster Caller software. According to the analysis results, the SNP markers were determined as follows: AX-95630347 Genotype: If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and clustered in the position close to the X-axis and far away from the coordinate origin in the typing result fluorescence signal coordinate system, then the SNP marker in the wheat to be tested AX-95630347 The genotype of the wheat to be tested is the homozygous genotype AA; if the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by the Kluster Caller software and clustered in the coordinate system close to the Y axis and far away from the origin of the coordinate system, then the SNP marker in the wheat to be tested AX-95630347 The genotype is the homozygous genotype CC; if the fluorescence signal data of the amplified product of the wheat to be tested is clustered near the middle of the diagonal line in the coordinate system after analysis by the Kluster Caller software, then the SNP marker in the wheat to be tested AX-95630347 The genotype is the heterozygous genotype AC or CA.

[0018] A fifth aspect of the present invention provides a method for assisting in identifying or comparing the filling rate of wheat grains to be tested, comprising the following steps: The genomic DNA of the wheat to be tested was used as a template to identify the AX-95630347 If the genotype of the wheat to be tested is AX-95630347 If the genotype AA is AX-95630347 If the genotype is CC, the tested wheat has a relatively lower grain filling rate.

[0019] A sixth aspect of the present invention provides a method for assisting in screening or breeding wheat plants, strains, lines or varieties with high grain filling rate characteristics, comprising the following steps: Selection of QTLs for grain filling rate in each breeding generation QGFR.yzu-1BL SNP markers within the interval AX-95630347 The genotype of wheat was AA, and finally AX-95630347 The wheat plant or line or strain or variety with AA genotype. AX-95630347 The genotype of wheat material is AA as the parent and AX- 95630347 The materials with genotypes of AA, AC or CC were hybridized, and the above-mentioned detection of SNP markers in wheat was used in the segregation generation. AX-95630347 The genotyping method was selected AX-95630347 The genotype of the plant or strain or strain or variety is AA or AC until AX-95630347 A single plant, strain, line or variety with the genotype of AA.

[0020] The high grain filling rate mentioned in the present invention means that when the effects of other gene loci on the genome of the compared wheat that affect the grain filling rate are equal, the grain filling rate of the wheat to be tested that is homozygous for the 36th base A on chromosome 1B in the genome corresponding to SEQ ID NO.1 in the sequence table is higher than the grain filling rate of the homozygous for the base C at that position.

[0021] Through the above technical solution, the present invention achieves the following beneficial effects: The present invention uses the Yangmai 16 / Zhongmai 895 DH population and its 660K SNP high-density genetic map to locate a major QTL for grain filling rate on the long arm of chromosome 1B. QGFR.yzu-1BL SNP markers AX-95630347 yes QGFR.yzu- 1BL A mark in the interval. AX-95630347 Converted to KASP marker AX-95630347-KASPThe effectiveness and reliability of the KASP marker in assisting the identification of the filling rate of wheat grains were verified using a set of natural population materials. QTL QGFR.yzu-1BL SNP markers within the interval AX-95630347 The genotype of the sample can be detected, which has low human error and high analysis throughput, and is suitable for the detection of a large number of samples. AX-110915909-KASP QTL loci for wheat grain filling rate QGFR.yzu-1BL The transfer of superior alleles has important practical significance for accelerating the utilization of superior alleles at the QTL locus for genetic improvement and improving breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 SNP marker AX-95630347 Multiple sequence alignment results of flanking sequences and homologous sequences and KASP markers AX-95630347-KASP Schematic diagram of the location of the primer set sequence-specific binding segments, in which the base sequences of sequence 2 (i.e., SEQ ID NO.2), sequence 6 (i.e., SEQ ID NO.6), sequence 7 (i.e., SEQ ID NO.7), and sequence 8 (i.e., SEQ ID NO.8) are consistent with the corresponding sequences in the sequence table; Figure 2 Is the development of KASP mark AX-95630347-KASP The typing results of wheat materials were tested during primer screening; Figure 3 It is marked with KASP AX-95630347-KASP Test results of some wheat varieties in natural populations; Figure 4 It is KASP mark AX-95630347-KASP The results of the grain filling rate phenotypic T test of two genotype materials in 151 wheat varieties in the natural population under different environments were detected. E1 and E2 were the Yangzhou and Hai'an test sites in 2021-2022, respectively, and E3 and E4 were the Yangzhou and Suqian test sites in 2022-2023, respectively; BLUE is the best linear unbiased estimate of the phenotypic values ​​under the four environments. GFR max , GFR mean GFR2 and GFR3 respectively represent the maximum grain filling rate, the average grain filling rate, and the grain filling rate during the rapid growth period; ** and *** respectively represent the P <0.01 and P <0.001 means the difference is significant, ns means the difference is not significant. DETAILED DESCRIPTION

[0023] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0024] The experimental methods in the following examples are all conventional methods unless otherwise specified.

[0025] Unless otherwise specified, the test materials, reagents, etc. used in the following examples can be obtained from commercial sources.

[0026] The primers used were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0027] All wheat varieties used were obtained from the National Wheat Improvement Center.

[0028] In the following quantitative tests, the grain number and grain weight were determined using the Wanshen SC-G automatic seed analysis and thousand-grain weight instrument developed by Hangzhou Wanshen Testing Technology Co., Ltd.

[0029] The quantitative tests in the following examples were all performed three times with biological repetitions, and the results were averaged.

[0030] Example 1 Major QTL for Wheat Grain Filling Rate QGFR.yzu-1BL SNP markers AX-95630347 Acquisition of KASP-labeled primer sets Test materials: Zhongmai 895 and Yangmai 16 are two of the main varieties promoted in the Huanghuai wheat region and the middle and lower reaches of the Yangtze River winter wheat region, respectively, with excellent comprehensive agronomic traits. In this study, Yangmai 16 was used as the female parent and Zhongmai 895 as the male parent to construct a DH population, including 174 families.

[0031] Field trials: DH populations were planted in Yangzhou and Hai'an test bases in Jiangsu in 2021-2022, and in Yangzhou and Suqian test bases in Jiangsu in 2022-2023. The field trials were all designed with randomized blocks, with three replicates, and planted in plots, with 4 rows per plot, 1.5 m long, and a row spacing of 25 cm (Yangzhou and Hai'an test sites) or 20 cm (Suqian test site). Field management was based on local test management methods.

[0032] The flowering period of all materials was recorded in detail in the field. When 50% of the panicles had visible anthers, the specific flowering time was recorded, and more than 40 flowering panicles with the same growth status were marked for each family. Samples were collected on the 10th, 15th, 20th, 25th, 30th, 35th day after flowering and at maturity, and 5 marked panicles were randomly selected in each plot. The removed panicles were sterilized at 105℃ for 30 min as soon as possible, and then dried at 80℃ for 20 h until constant weight. Manual threshing was performed to avoid grain loss. The total grain weight, total number of grains and thousand-grain weight of each sample were determined using the Wanshen SC-G fully automatic seed test analyzer and thousand-grain weight meter (Hangzhou Wanshen Testing Technology Co., Ltd.), and the operation method was carried out in accordance with the instrument operating procedures. The Proc NLIN program in SAS9.2 software was used to fit the logistic filling curve of the thousand-grain dry weight at different time points, and the filling parameters of each family were calculated based on the fitted logistic curve. The logistic equation is Y = k / (1+ae –bX ), where X is the time after flowering, Y is the 1000-grain dry weight corresponding to time point X, e is the base of the natural logarithm function, and a, b, and k are the parameters to be determined. Derivatives and related calculations of the equation can be used to obtain GFR max , GFR mean , GFR2 and other filling parameters. Among them, the maximum grain filling rate GFR max = bk / 4; average grain filling rate GFR mean It is the dry weight of 1000-grain weight at maturity divided by the duration of grain filling. The grain filling rate (GFR2) at the rapid growth stage is obtained by dividing the difference in dry weight of 1000-grain weight between two time points obtained by the first-order derivative by this period of time.

[0033] Genetic map construction: The genetic linkage map of the Yangmai 16 / Zhongmai 895 DH population was based on the map constructed by Xu et al. (2019). The map contained 148,179 SNP markers with a total genetic distance of 3,681.73 cM and an average distance between adjacent markers of 0.25 cM.

[0034] QTL mapping and markers AX-95630347 Discovery: Using QTL IciMapping V4.0 software (Meng et al., 2015), the complete composite interval mapping method (ICIM) was used to locate QTLs for grain filling rate in 174 families of the DH population under different environments. The LOD value was selected as 3.0 as the threshold. The localization results showed that there was a major QTL on the long arm of chromosome 1B that simultaneously regulated the maximum grain filling rate and the grain filling rate during the rapid growth period. QGFR.yzu-1BL The enhancement allele comes from Yangmai 16. The genetic confidence interval of the QTL is 128.5-129.5 cM, and the markers on both sides are AX-110534755 andAX- 111590092 The physical positions of the two marker allelic variations in the Chinese Spring reference genome V1.0 are the 653939615th and 665050665th bases on the positive strand of chromosome 1B. AX- 110534755 and AX-111590092 The KASP markers were converted to KASP markers, but failed. QGFR.yzu-1BL The corresponding physical interval contains AX-95630347 and try to convert them into KASP markers. AX- 95630347 It was successfully transformed into a KASP marker with ideal typing effect and was named AX-95630347-KASP .

[0035] KASP Mark AX-95630347-KASP The primer set is obtained: SEQ ID NO.1 is a SNP marker AX- 95630347 The flanking sequence of SEQ ID NO.1 has a polymorphism of base allele variation of A or C at position 36, i.e., the base at this position in the actual wheat material is A or C. The reverse complementary sequence of SEQ ID NO.1 is SEQ ID NO.2, and its corresponding two polymorphic single nucleotides are T or G, i.e., the base at this position in the actual wheat material is T or G. The extended sequence (SEQ ID NO.6) containing SEQ ID NO.2 was obtained from the wheat multi-omics database website (WheatOmics1.0, http: / / 202.194.139.32 / ), and the extended sequence is the base sequence of positions 658738504 to 658738618 of the positive chain of chromosome 1B of the Chinese Spring reference genome V1.0 version. Using SEQ ID NO.6, BLAST search was performed on the International Wheat Genome Sequencing Consortium (IWGSC; https: / / wheat-urgi.versailles.inra.fr / ), and two homologous sequences with high consistency with SEQ ID NO.6 were obtained, namely SEQ ID NO.7 and SEQ ID NO.8 in the sequence list, which were located on wheat chromosomes 1D and 1A, respectively. Multiple sequence alignment was performed on SEQ ID NO.2 (sequence 2), SEQ ID NO.6 (sequence 6), SEQ ID NO.7 (sequence 7), and SEQ ID NO.8 (sequence 8) ( Figure 1), based on chromosome specificity and the general principles of KASP primer design, a set of KASP primers was designed, consisting of primer A, primer B and primer C. The 3' terminal bases of the two competitive primers (primer A and primer B) (the 3' terminal base T of primer A and the 3' terminal base G of primer B) correspond to the SNP marker AX-95630347 The common primer (primer C) ensures the specificity of chromosome 1B in PCR amplification. AX-95630347 KASP Marker Developed AX-95630347-KASP The primer set is composed of primer A, primer B and primer C. The 5' ends of the two competitive primers are connected with fluorescent label sequences. Primer A can be fluorescent label sequence A and single-stranded DNA as shown in positions 22-46 of SEQ ID NO.3 from 5' to 3', or fluorescent label sequence A and DNA having the same function as SEQ ID NO.3 with one or more nucleotides substituted and / or deleted and / or added from 5' to 3'. The fluorescent label sequence A is preferably the fluorescent label sequence FAM (5'-GAAGGTGACCAAGTTCATGCT-3'). Primer B may be, from the 5' end to the 3' end, a fluorescent label sequence B and a single-stranded DNA as shown in positions 22-46 of SEQ ID NO.4, or may be, from the 5' end to the 3' end, a fluorescent label sequence B and a DNA having the same function as SEQ ID NO.4 with one or more nucleotides substituted and / or deleted and / or added to positions 22-46. The fluorescent label sequence B is preferably a fluorescent label sequence HEX (5'-GAAGGTCGGAGTCAACGGATT-3'); Primer C may be SEQ ID NO.5, or may be a DNA molecule having the same function as SEQ ID NO.5 with one or more nucleotides substituted and / or deleted and / or added to SEQ ID NO.5.

[0036] above: SEQ ID NO.6: 5'-CCCACGGTGAGGTGTCCTTGATGGTCTGCATCAGATACCCTTTGTTACCGGCGGTGTGCACCACGACGATCCCCTTCTTGACCGCATGCAGTGCAGCGAATGAGTTCTCACTCAT-3'; SEQ ID NO.7: 5'-CCCACGGCGAGGTGTCCCTGATGGTCTGCATATGCGGCCCAGCGTTGCCAGCGGTGTGCACCATGACGATCCCCTTCAGGACCGCATGTAGTGTACCGTATGAATTCTCGCTCAT-3'; SEQ ID NO.8: 5'-CCCACGGCGAGGTGTCCCTGATGGTCTGCATATGCGGCCCAGCGTTGCCAGCGGTGTGCACCATGACGATCCCCTTCAGGACCGCATGTAGTGTACCGTATGAGTTCTCGCTCAT-3'.

[0037] Example 2 Labeling with KASP AX-95630347-KASP Establishment of genotype detection method Tagging with KASP AX-95630347-KASP The primer set was used to detect the genotypes of some wheat varieties in natural populations.

[0038] 1. The genomic DNA of natural population wheat materials was extracted by CTAB method, and a template solution with a DNA concentration of about 30 ng / μL was obtained by dilution.

[0039] 2. Using the genomic DNA extracted in step 1 as a template, PCR amplification was performed using the primer set shown in SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5 to obtain an amplified product.

[0040] Preparation of KASP labeled primer working solution: Take 12 μL (100 μM) of each of the two competitive primers (primer A and primer B) and 30 μL (100 μM) of the common primer (primer C), add sterile ultrapure water to 100 μL, mix thoroughly, and use as the KASP-labeled primer working solution for later use.

[0041] PCR amplification reaction system: contains 2 μL DNA template (about 30 ng / μL), 0.08 μL primer working solution, 2.5 μL KASP 2×Master Mix (LGC, catalog number: KBS-1016-002), and is supplemented to 5 μL with sterile ultrapure water. KASP 2×Master Mix contains fluorescent probe A, fluorescent probe B, quenching probe A and quenching probe B, as well as high-fidelity Taq Enzyme, dNTP, Mg 2+The nucleotide sequence of fluorescent probe A is: 5'-GAAGGTGACCAAGTTCATGCT-3', and its 5' end is connected to a FAM fluorescent group; the nucleotide sequence of fluorescent probe B is: 5'-GAAGGTCGGAGTCAACGGATT-3', and its 5' end is connected to a HEX fluorescent group; the nucleotide sequence of quenching probe A is: 5'-AGCATGAACTTGGTCACCTTC-3', and its 3' end is connected to a quenching group BHQ; the nucleotide sequence of quenching probe B is: 5'-AATCCGTTGACTCCGACCTTC-3', and its 3' end is connected to a quenching group BHQ; The PCR reaction procedure was as follows: the first step, pre-denaturation at 95°C for 15 min; the second step, denaturation at 95°C for 20 s, 65–57°C (1°C decrease in each cycle) for 60 s, for a total of 9 cycles; the third step, denaturation at 95°C for 20 s, annealing and extension at 57°C for 1 min, for 32 cycles; and storage at 10°C.

[0042] 3. Fluorescence signal scanning of PCR amplification products: The PCR amplification products were scanned using a multifunctional microplate reader, with the excitation wavelength of FAM at 485 nm and the emission wavelength at 520 nm; the excitation wavelength of HEX at 535 nm and the emission wavelength at 556 nm; and the excitation wavelength of the system reference fluorescence ROX at 575 nm and the emission wavelength at 610 nm.

[0043] 4. Allele typing: Kluster Caller software was used to analyze the ELISA scanning data (for specific methods, refer to the KlusterCaller software manual, which is available to the public from LGC). Based on the analysis results, the wheat SNP markers to be tested were determined as follows: AX-95630347 Genotype: The fluorescence signal data of the wheat amplification product to be tested were analyzed by Kluster Caller software. The genotypes of the samples clustered near the X-axis and far away from the origin of the coordinate in the typing result fluorescence signal coordinate system are the allele types connected to the FAM fluorescent label sequence; the genotypes of the samples clustered near the Y-axis and far away from the origin of the coordinate are the allele types connected to the HEX fluorescent label sequence.

[0044] The above KASP marker primer set was used to detect the genotypes of some wheat varieties in natural populations. The typing results are as follows Figure 2As shown, specifically: the fluorescence signal data of the wheat amplification product to be tested are aggregated in samples close to the X-axis and far away from the origin of the coordinate system (sample set 1) after analysis by the Kluster Caller software, and the genotype is AA; the fluorescence signal data of the amplification product are aggregated in samples close to the Y-axis and far away from the origin of the coordinate system (sample set 2), and the genotype is CC; the genotype of the sample whose fluorescence signal data points of the amplification product are gathered near the middle of the diagonal line in the coordinate system is the heterozygous genotype AC (sample set 3); if the sample DNA quality is poor, the fluorescence signal of the amplification product is weak, and its fluorescence signal data cannot be automatically interpreted by the Kluster Caller software, which is displayed as a pink sample point in the figure.

[0045] Example 3 Using KASP labeling AX-95630347-KASP Application of auxiliary identification of wheat grain filling rate in breeding 1. Test materials and phenotypic determination The experimental materials included 151 wheat varieties from the Huanghuai wheat region (see Table 1).

[0046] Grain filling rate determination: 151 wheat varieties were planted in the Yangzhou and Hai'an test bases in Jiangsu in 2021-2022, and in the Yangzhou and Suqian test bases in Jiangsu in 2022-2023. The field trials were all designed with a randomized block design, with three replicates, and planted in plots. Each plot had 4 rows, 1.5 m in length, and a row spacing of 25 cm (Yangzhou and Hai'an test sites) or 20 cm (Suqian test site). Field management was based on the management of the local test station. The method described in Example 1 was used to analyze and determine the grain filling rate (maximum grain filling rate GFR) of each test material. max , average grain filling rate GFR mean , grain filling rate (GFR2) during the rapid growth period, and the mean of three replicates was used for statistical analysis.

[0047] 2. Tag with KASP AX-95630347-KASP Primer set to detect each test material: According to the method described in Example 2, the genomic DNA of each experimental material was extracted, and the genotype of each experimental material was analyzed using the above-mentioned high-throughput molecular marker detection system. The detection results are as follows: Figure 3As shown. Specifically, the genotype results of 151 wheat varieties are listed in Table 1, of which 94 wheat varieties have an AA genotype and 57 wheat varieties have a CC genotype. The BLUE value (best linear unbiased estimate) data of the grain filling rate phenotype of 151 wheat varieties in four environments (Yangzhou and Hai'an in 2021-2022; Yangzhou and Suqian in 2022-2023) are also listed in Table 1. The PROC TTEST procedure in the internationally used SAS 9.2 statistical software was used to perform T-test analysis on the phenotypic data of 151 wheat varieties in four environments and BLUE value environments. The results showed that in the Yangzhou and Hai'an environments in 2021-2022, Yangzhou in 2022-2023, and when the BLUE value was used for analysis, the maximum grain filling rate GFR of the material with a genotype of AA max and the grain filling rate GFR2 in the rapid growth period were significantly ( P <0.01 or P <0.001) was higher than that of the CC genotype. In the Yangzhou and Hai'an environments in 2021-2022 and the Suqian environments in 2022-2023, and when the BLUE value was used for analysis, the average grain filling rate (GFR) of the AA genotype was mean Significant ( P <0.01 or P <0.001) was higher than that of the CC genotype ( Figure 4 ), these results indicate that KASP marker AX-95630347-KASP The primer set and genotype detection system can be effectively used to assist in identifying the high and low wheat grain filling rates and to be used in molecular-assisted selection breeding aimed at improving the wheat grain filling rate.

[0048] Table 1151 wheat varieties marked with KASP AX-95630347-KASP Genotypes tested The best linear unbiased estimate of the grain filling rate phenotypic value under four different environments

[0049] The present invention measured the grain filling rate-related traits of 174 families in the Yangmai 16 / Zhongmai 895 DH population under multiple different environments, performed genotype analysis on the population using a 660K SNP chip, and constructed a high-density linkage map. Through QTL positioning, it was found that there was a major QTL on the long arm of chromosome 1B that simultaneously regulated the maximum grain filling rate and the grain filling rate during the rapid growth period. The enhancing allele came from Yangmai 16, the genetic confidence interval of the QTL was 128.5-129.5 cM, and the markers on both sides were AX-110534755 and AX-111590092 , the LOD value is 3.03–12.69, explaining 3.53%–13.57% of the phenotypic variation, and the locus is recorded as QGFR.yzu-1BL According to the Chinese Spring reference genome version V1.0, markers AX-110534755 and AX-111590092 The physical locations of the allele variants are bases 653939615 and 665050665 on the positive strand of chromosome 1B. Further analysis revealed that the SNP marker AX-95630347 is distributed in QGFR.yzu-1BL The present invention uses wheat 660K SNP chip markers to AX-95630347 The KASP markers were transformed into high-throughput, low-cost and low-error genotyping markers and were named AX-95630347-KASP .

[0050] The present invention uses a set of grain filling rate phenotypic data of wheat materials in the Huanghuai wheat region under multiple different environments (4 different environments and the best linear unbiased estimate of the phenotypic data in each environment) to identify KASP markers. AX-95630347-KASP The effectiveness and reliability of the test were verified, and the test results showed that in most environments, AX-95630347 The grain filling rates of materials with genotype AA (including: maximum grain filling rate, average grain filling rate, and grain filling rate during the rapid growth period) were significantly ( P <0.01 or P <0.001) was higher than that of the materials with CC genotype. These results show that the KASP molecular markers of the present invention AX-95630347-KASP Can be effectively used for major QTL of wheat grain filling rate QGFR.yzu-1BL Molecular marker-assisted selection breeding.

[0051] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0052] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0053] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A QTL for wheat grain filling rate QGFR.yzu-1BL The molecular markers with significant association are named AX- 95630347 , characterized in that, It has a flanking sequence as shown in SEQ ID NO.1, the polymorphism of the 36th base of the flanking sequence is A or C, the complementary sequence of the flanking sequence is shown in SEQ ID NO.2, and according to the Chinese Spring wheat reference genome version V1.0, SEQ ID NO.2 corresponds to the 658738504 to 658738574 base sequence on the positive strand of chromosome 1B, the polymorphism of the 658738539 base is T or G, and the base in the Chinese Spring genome sequence is T.

2. A KASP primer set for identifying the genotype of the molecular marker according to claim 1, characterized in that: Comprising primer A, primer B and primer C, wherein: The primer A is as follows (a1) or (a2): (a1) From the 5' end to the 3' end, there is a fluorescent tag sequence A and a single-stranded DNA as shown in positions 22-46 of SEQ ID NO.3; (a2) A fluorescent tag sequence A and a DNA having the same function as SEQ ID NO. 3, wherein one or more nucleotides at positions 22-46 are replaced and / or deleted and / or added, from the 5' end to the 3' end; Primer B is as follows (b1) or (b2): (b1) From the 5' end to the 3' end, there are fluorescent tag sequence B and single-stranded DNA as shown in positions 22-46 of SEQ ID NO.4; (b2) A fluorescent tag sequence B and a DNA having the same function as SEQ ID NO. 4, wherein one or more nucleotides at positions 22-46 are replaced and / or deleted and / or added, from the 5' end to the 3' end; Primer C is as follows (c1) or (c2): (c1) a single-stranded DNA as shown in SEQ ID NO.5; (c2) A DNA having the same function as SEQ ID NO.5 after one or more nucleotides are substituted and / or deleted and / or added.

3. The primer set according to claim 2, characterized in that The fluorescent label sequence A is the fluorescent label sequence FAM, and the fluorescent label sequence B is the fluorescent label sequence HEX.

4. Use of the primer set according to claim 2 or 3 in any of the following: 1) Detect or assist in detecting SNP markers in the wheat to be tested AX-95630347 genotype; 2) Preparation and detection of wheat SNP markers AX-95630347 The product of the genotype; 3) Preparation and detection of wheat grain filling rate QTL QGFR.yzu-1BL The product of the genotype; 4) preparing products for screening or breeding wheat plants, lines, strains or varieties with high grain filling rates; 5) Assist in the screening or breeding of wheat plants, plant lines, strains or varieties with high grain filling rate characteristics.

5. The use according to claim 4, characterized in that: In applications 2) to 4), the product is a PCR reagent or a kit.

6. The use according to claim 5, characterized in that: The product also includes fluorescent probe A, fluorescent probe B, quenching probe A and quenching probe B, the fluorescent reporter group A is FAM, the fluorescent reporter group B is HEX, and the fluorescent quenching groups A and B are both BHQ.

7. A method for detecting SNP markers in wheat AX-95630347 A genotyping method, characterized in that The steps include: The wheat genomic DNA to be tested is used as a template, and the primer set described in claim 2 or 3 is used for PCR amplification. The amplified product is scanned for fluorescence signals, and the scan data is analyzed using Kluster Caller software. According to the analysis results, the SNP marker is determined according to the following method AX-95630347 Genotype: If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and clustered in the position close to the X-axis and far away from the origin of the coordinate system of the typing result fluorescence signal, then the SNP marker in the wheat to be tested AX-95630347 The genotype of the wheat to be tested is the homozygous genotype AA; if the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by the Kluster Caller software and clustered in the coordinate system close to the Y axis and far away from the origin of the coordinate system, then the SNP marker in the wheat to be tested AX-95630347 The genotype is the homozygous genotype CC; if the fluorescence signal data of the amplified product of the wheat to be tested is clustered near the middle of the diagonal line in the coordinate system after analysis by the Kluster Caller software, then the SNP marker in the wheat to be tested AX-95630347 The genotype is the heterozygous genotype AC or CA.

8. A method for assisting in identifying or comparing the filling rate of wheat grains to be tested, characterized in that: The steps include: Using the genomic DNA of the wheat to be tested as a template, the method described in claim 7 is used to identify the wheat to be tested. AX- 95630347 If the genotype of the wheat to be tested is AX-95630347 If the genotype AA is AX-95630347 If the genotype is CC, the tested wheat has a relatively lower grain filling rate.

9. A method for assisting in the selection or breeding of wheat plants, strains, lines or varieties with high grain filling rate characteristics, characterized in that: The steps include: Selection of QTLs for grain filling rate in each breeding generation QGFR.yzu-1BL SNP markers within the interval AX-95630347 The genotype of wheat was AA, and finally AX-95630347 A wheat plant, line, strain or variety with the genotype of AA.

Images