Method for double sandwich detection of 25-OH-VD based on VDR and RXR alpha

Abstract

The invention provides a method for double sandwich detection of 25-OH-VD based on VDR and RXR alpha. The method comprises the following steps: sequentially carrying out VDR sequence synthesis, RXR alpha sequence synthesis, VDR expression, RXR alpha expression, VDR purification and RXR alpha purification; and carrying out double-sandwich detection on the content of 25-OH-VD by utilizing the VDR protein and the RXR alpha protein obtained after purification. The invention provides a method for double sandwich detection of the content of 25-OH-VD by adopting VDR and RXR alpha, the method solves the problems of low precision and narrow linear range in detection of the content of 25-OH-VD by a competition method, is simple and convenient to operate, does not need immune animals to prepare antibodies, and saves preparation time, manpower and material resources.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a method for detecting 25-OH-VD based on a double sandwich of VDR and RXRα. Background Art

[0002] Vitamin D (VD) is a fat-soluble vitamin with many important physiological functions. VD can regulate calcium and phosphorus metabolism and plays an important role in bone development. In addition, VD also plays a role in the occurrence and development of cardiovascular diseases, diabetes, Alzheimer's disease and other diseases.

[0003] VD exerts its physiological function through VD receptor (VDR). VDR is a ligand-dependent transcription factor belonging to the nuclear receptor superfamily. After VDR binds to VD, its conformation changes, thereby exerting its physiological function.

[0004] Retinoid X receptor (RXR) can bind to VDR to form VDR-RXR heterodimers, promoting VDR to activate the transcription of target genes. After binding to VD, VDR tightly binds to RXR to form a ternary complex. There are three subtypes of RXR: RXRα, RXRβ and RXRγ. We chose RXRα as the research object.

[0005] 25-hydroxyvitamin D (25-OH-VD) is the most abundant vitamin D metabolite in the body, which can reflect the nutritional level of vitamin D in the body. Currently, immunoassay is the mainstream method for detecting 25-OH-VD in human blood. However, since 25-OH-VD is a small molecule compound with only a single antigenic determinant, it cannot be detected by double sandwich method. Therefore, the competitive method is currently used for 25-OH-VD detection. The competitive method has the problems of low detection accuracy and narrow linear range. Summary of the invention

[0006] The purpose of the present invention is to overcome the above-mentioned deficiencies of the prior art and provide a method for detecting 25-OH-VD based on a double sandwich of VDR and RXRα.

[0007] A method for detecting 25-OH-VD based on a double sandwich of VDR and RXRα, comprising:

[0008] The steps of VDR sequence synthesis and RXRα sequence synthesis, VDR expression and RXRα expression, VDR purification and RXRα purification are performed in sequence;

[0009] The purified VDR protein and RXRα protein were used to detect the content of 25-OH-VD by double sandwich method.

[0010] Furthermore, the VDR sequence is shown in SEQ ID NO: 1 and is constructed into the pcDNA3.1 vector to obtain the pcDNA3.1-VDR plasmid.

[0011] Furthermore, the RXRα sequence is shown in SEQ ID NO:2, and at the same time, an FC tag is added at the 3' end, the sequence of the FC tag is shown in SEQ ID NO:3, and constructed into the pcDNA3.1 vector to obtain the pcDNA3.1-RXRα plasmid.

[0012] Furthermore, VDR was expressed as follows: the constructed pcDNA3.1-VDR plasmid was transfected into 293F cells by PEI transfection method. After successful transfection, the cells were cultured in a shaker at 37°C, 8% CO2, and 120 rpm for 24 h, and then 3.5% volume ratio of feed medium was added, and the cells were returned to the shaker for further culture for 96 h to obtain 293F cell culture fluid expressing VDR.

[0013] Furthermore, RXRα was expressed as follows: the constructed pcDNA3.1-RXRα plasmid was transfected into 293F cells by PEI transfection method. After successful transfection, the cells were cultured in a shaker at 37°C, 8% CO2, and 120 rpm for 24 h, and then 3.5% volume ratio of feed medium was added, and the cells were returned to the shaker for continued culture for 96 h to obtain 293F cell culture fluid expressing RXRα.

[0014] Furthermore, VDR was purified as follows: the obtained 293F cell culture fluid expressing VDR was centrifuged at 4°C, 12,000 rpm for 30 min, the supernatant was collected, and the cell supernatant was filtered with a 0.22 μm filter membrane; it was diluted 5 times with Buffer A and loaded onto a Q chromatography column; impurities were washed away with Buffer B; the protein was eluted with Buffer C; the purified VDR protein was ultrafiltered, exchanged with liquid, concentrated, and stored in PBS pH 7.4 to obtain the VDR protein.

[0015] Further, RXRα purification is as follows: the obtained 293F cell culture fluid expressing RXRα is centrifuged at 4°C, 12,000rpm for 30min, the supernatant is collected, the cell supernatant is filtered with a 0.22μm filter membrane, and Protein A filler is selected for protein purification; before use, the Protein A column is equilibrated with 5 column volumes of an equilibrium buffer containing 0.02M PB and 0.15M NaCl, pH6.5, the filtered cell culture fluid is passed through the column, and then the column is washed with 5 column volumes of an equilibrium buffer containing 0.02M PB and 0.15M NaCl, pH6.5, and then eluted with 5 column volumes of an eluent containing 0.1M Glycine-HCl, pH2.7, and the eluent is immediately neutralized with a neutralizing solution of 1.0M Tris-HCl, pH9.0, and the purified RXRα protein is ultrafiltered, exchanged, concentrated, and stored in PBS pH6.5 to obtain the RXRα protein.

[0016] Furthermore, the purified VDR protein and RXRα protein were used to detect the content of 25-OH-VD by double sandwich, including:

[0017] Dissolve the VDR protein in the coating solution at a concentration of 1 μg / ml, add 100 μL to the corresponding wells, and incubate at 4°C overnight; aspirate the liquid in the wells, wash three times with 300 μL of washing buffer; add 300 μL of blocking solution to each well, incubate at 37°C for 1 hour; aspirate the liquid in the wells, wash three times with 300 μL of washing buffer; add 100 μL of 3-fold gradient diluted 25-OH-VD sample and calibrated blood sample to each well, incubate at 37°C for 1 hour; aspirate the liquid in the wells, wash three times with 300 μL of washing buffer, and add 100 μL 1μg / ml RXRα protein; aspirate the liquid in the wells, wash three times with 300μL washing buffer, add 100μL HRP-labeled rabbit anti-human antibody to each well, incubate at 37℃ for 30min; aspirate the liquid in the wells, wash five times with 300μL washing buffer; add 100μL color development solution to each well, develop at 37℃ for 10min, add 50μL 2mol / LH2SO4 stop solution, and read the value on the microplate reader at 450 within 20min after adding the stop solution.

[0018] The advantages and beneficial effects of the present invention over the prior art are as follows:

[0019] 1. The detection method provided by the present invention solves the problems of low precision and narrow linear range in the competitive method for detecting 25-OH-VD content, and is easy to operate, does not require immunizing animals to prepare antibodies, and saves preparation time and manpower and material resources.

[0020] 2. The detection method provided by the present invention can be applied to the immunoassay for detecting the 25-OH-VD content. The method adopts the sandwich method for detection, which is easy to operate and produces accurate data.

[0021] 3. The VDR nucleotide sequence provided by the present invention can be used to express the VDR protein, which can specifically bind to 25-OH-VD and undergo conformational changes after binding to 25-OH-VD, thereby tightly binding to RXRα.

[0022] 4. The RXRα nucleotide sequence provided by the present invention can express RXRα protein through the sequence. The RXRα protein can tightly bind to VDR after binding to 25-OH-VD, thereby realizing the sandwich detection of 25-OH-VD.

[0023] 5. For the purpose of convenient detection, the RXRα protein provided by the present invention is added with a human FC tag, which can be bound by HRP-labeled rabbit anti-human or mouse anti-human antibodies, and then color is developed to achieve the purpose of detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0025] Figure 1 This is the electrophoresis diagram of VRD purification in the embodiment of the present invention;

[0026] Figure 2 This is the electrophoresis diagram of RXRα purification in the embodiment of the present invention;

[0027] Figure 3 This is a graph showing the results of ELISA detection of 25-OH-VD content in an embodiment of the present invention. DETAILED DESCRIPTION

[0028] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0029] Example 1

[0030] A method for detecting 25-OH-VD based on double sandwich of VDR and RXRα

[0031] (1) VDR sequence synthesis

[0032] The VDR sequence was obtained from NCBI KR710973.1 (SEQ ID NO: 1), and was commissioned to Shanghai Bioengineering to synthesize the sequence and construct it into the pcDNA3.1 vector.

[0033] SEQ ID NO:1

[0034]

[0035] (2) RXRα sequence synthesis

[0036] The RXRα sequence was from NCBI NM_002957.6 (SEQ ID NO: 2), with an FC tag added at the 3' end (SEQ ID NO: 3). The sequence was synthesized by Shanghai Bioengineering and constructed into the pcDNA3.1 vector.

[0037] SEQ ID NO:2

[0038]

[0039] SEQ ID NO:3

[0040] GAGCCCAAGAGCTGCGACAAGACCCACACATGCCCTCCCTGTCCCGCTCCCGAGCTGCTGGGCGGCCCTAGCGTGTCCTGTTCCCCCCCAAGCCCAAGGACACCCTGATGATCAGCAGAACCCCCGAGGTGACCTGCGTGGTCGTGGACGTGAGCCACGAGGACCCCGAGGTG AAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCACAACGCCAAGACCAAGCCTAGAGAGGAGCAGTACAACAGCACCTACAGAGTGGTGAGCGTGCTGACCGTGCTGCACCAAGACTGGCTGAACGGCAAGGAGTACAAGTGCAAGGTGAGCAACAAAGCCCTGCCTGCCCCT ATCGAGAAGACCATCAGCAAGGCCAAGGGGCAGCCTAGAGAGCCCCAAGTGTACACCCTGCCCCCTAGCAGAGACGAGCTGACCAAGAACCAAGTGAGCCTGACCTGCCTGGTCAAGGGCTTCTACCCTAGCGACATCGCCGTGGAGTGGGAGAGCAACGGGCAGCCCGAGAAC AACTACAAGACCACCCCCCCCGTGCTGGACAGCGACGGCAGCTTTTCCTGTACAGCAAGCTGACAGTGGACAAGAGCAGATGGCAGCAAGGCAACGTGTTTAGCTGCAGCGTGATGCACGAGGCCCTGCACAACCACTACACACAGAAAAGCCTGAGCCTGAGCCCTGGCAAA

[0041] (3) VDR expression

[0042] The constructed pcDNA3.1-VDR plasmid was transfected into 293F cells by PEI transfection method. After successful transfection, the cells were cultured in a shaker at 37°C, 8% CO2, and 120 rpm for 24 h, and then 3.5% volume ratio of feed medium was added. The cells were returned to the shaker and cultured for 96 h to obtain 293F cell culture fluid expressing VDR.

[0043] (4) RXRα expression

[0044] The constructed pcDNA3.1-RXRα plasmid was transfected into 293F cells by PEI transfection method. After successful transfection, the cells were cultured in a shaker at 37°C, 8% CO2, and 120 rpm for 24 h, and then 3.5% volume ratio of feed medium was added. The cells were returned to the shaker and cultured for 96 h to obtain 293F cell culture fluid expressing RXRα.

[0045] (5) VDR purification

[0046] Centrifuge at 4°C, 12 000rpm for 30min, collect the supernatant, and filter the cell supernatant with a 0.22μm filter membrane. Dilute 5 times with BufferA (20mM PB, adjust pH to 7.4) and load onto the Q chromatography column; wash away impurities with BufferB (20mM PB, 20mM sodium chloride, adjust pH to 7.4); elute the protein with BufferC (20mM PB, 500mM sodium chloride, adjust pH to 7.4); ultrafilter the purified VDR protein, change the buffer, concentrate, and store in PBS pH7.4. The results are shown in Figure 1 As shown, VDR protein with high purity can be expressed and purified.

[0047] (6) RXRα purification

[0048] Centrifuge at 4°C, 12,000 rpm for 30 min, collect the supernatant, filter the cell supernatant with a 0.22 μm filter membrane, and select Protein A filler for protein purification; before using the Protein A column, balance the column with 5 column volumes of equilibration buffer containing 0.02M PB and 0.15M NaCl, pH 6.5, pass the filtered cell culture fluid through the column, and then wash the column with 5 column volumes of equilibration buffer containing 0.02M PB and 0.15M NaCl, pH 6.5, and then elute with 5 column volumes of elution buffer containing 0.1M Glycine-HCl, pH 2.7, and immediately neutralize the eluent with 1.0M Tris-HCl, pH 9.0 neutralizing solution, ultrafilter the purified RXRα protein, exchange the buffer, concentrate, and store in PBS pH 6.5. The results are as follows: Figure 2 As shown, RXRα protein with high purity can be expressed and purified.

[0049] (7) ELISA detection of 25-OH-VD content

[0050] Dissolve the VDR protein in the coating solution at a concentration of 1 μg / ml, add 100 μL (i.e. 100 ng / well) to the corresponding wells, and incubate overnight at 4°C. Aspirate the liquid in the wells and wash 3 times with 300 μL of washing buffer. Add 300 μL of blocking solution (5% skim milk, prepared in PBST) to each well and incubate at 37°C for 1 hour. Aspirate the liquid in the wells and wash 3 times with 300 μL of washing buffer. Add 100 μL of 3-fold gradient dilution of 25-OH-VD sample and calibrated blood sample to each well and incubate at 37°C for 1 hour. Aspirate the liquid in the wells, wash 3 times with 300 μL of washing buffer, and add 100 μL of 1 μg / ml RXRα protein to each well. Aspirate the liquid in the wells, wash three times with 300 μL washing buffer, add 100 μL HRP-labeled rabbit anti-human antibody (1:5 000, diluted in PBST) to each well, and incubate at 37°C for 30 min. Aspirate the liquid in the wells, wash five times with 300 μL washing buffer. Add 100 μL color development solution to each well, develop at 37°C for 10 min, add 50 μL 2 mol / L H2SO4 stop solution, and read the value on the microplate reader at 450 within 20 min after adding the stop solution. The results are as follows Figure 3 , as shown in Table 1.

[0051]

[0052] from Figure 3 It can be seen that the detection method has a good linear gradient in the range of 25-OH-VD concentration of 0.15-333.33 ng / mL. VDR has good binding activity with 25-OH-VD and can bind to RXRα, which can be used for double sandwich detection of 25-OH-VD. Compared with the detection range of 5-100 ng / mL of the control competition kit, the linear detection range is wider. Combined with the results in Table 1, the deviation between the ELISA method for detecting the concentration of 25-OH-VD in blood samples and the calibration concentration is within ±10%, which can be used for the detection of 25-OH-VD concentration in blood samples.

[0053] The present invention provides a new 25-OH-VD detection method, the principle of which is as follows: VDR combines with 25-OH-VD in the detection sample, and RXRα forms a sandwich complex with the former two, thereby improving the detection precision and accuracy, expanding the linear range, and solving the problems existing in the competition method.

[0054] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for detecting 25-OH-VD based on double sandwich of VDR and RXRα, characterized in that: include: The steps of VDR sequence synthesis and RXRα sequence synthesis, VDR expression and RXRα expression, VDR purification and RXRα purification are performed in sequence; The purified VDR protein and RXRα protein were used to detect the content of 25-OH-VD by double sandwich method.

2. The method for detecting 25-OH-VD based on double sandwich of VDR and RXRα according to claim 1, characterized in that: The VDR sequence is shown in SEQ ID NO: 1 and was constructed into the pcDNA3.1 vector to obtain the pcDNA3.1-VDR plasmid.

3. The method for detecting 25-OH-VD based on double sandwich of VDR and RXRα according to claim 1, characterized in that: The RXRα sequence is shown in SEQ ID NO:

2. At the same time, an FC tag is added at the 3' end. The sequence of the FC tag is shown in SEQ ID NO:

3. The FC tag is constructed into the pcDNA3.1 vector to obtain the pcDNA3.1-RXRα plasmid.

4. The method for detecting 25-OH-VD based on double sandwich of VDR and RXRα according to claim 2, characterized in that: VDR was expressed as follows: the constructed pcDNA3.1-VDR plasmid was transfected into 293F cells by PEI transfection method. After successful transfection, the cells were cultured in a shaker at 37°C, 8% CO2, and 120 rpm for 24 h, and then 3.5% volume ratio of feed medium was added. The cells were returned to the shaker and cultured for 96 h to obtain 293F cell culture fluid expressing VDR.

5. The method for detecting 25-OH-VD based on double sandwich of VDR and RXRα according to claim 3, characterized in that: RXRα was expressed as follows: the constructed pcDNA3.1-RXRα plasmid was transfected into 293F cells by PEI transfection method. After successful transfection, the cells were cultured in a shaker at 37°C, 8% CO2, and 120 rpm for 24 h, and then 3.5% volume ratio of feed medium was added. The cells were returned to the shaker and cultured for 96 h to obtain 293F cell culture fluid expressing RXRα.

6. The method for detecting 25-OH-VD based on double sandwich of VDR and RXRα according to claim 1, characterized in that: VDR purification is as follows: the obtained 293F cell culture fluid expressing VDR is centrifuged at 4°C, 12,000 rpm for 30 min, the supernatant is collected, and the cell supernatant is filtered with a 0.22 μm filter membrane; it is diluted 5 times with Buffer A and loaded onto a Q chromatography column; impurities are washed away with Buffer B; the protein is eluted with Buffer C; the purified VDR protein is ultrafiltered, exchanged with liquid, concentrated, and stored in PBS pH 7.4 to obtain the VDR protein.

7. The method for detecting 25-OH-VD based on double sandwich of VDR and RXRα according to claim 1, characterized in that: Purification of RXRα is as follows: the obtained 293F cell culture fluid expressing RXRα is centrifuged at 4°C, 12,000 rpm for 30 min, the supernatant is collected, the cell supernatant is filtered with a 0.22 μm filter membrane, and Protein A filler is used for protein purification; before use, the Protein A column is equilibrated with 5 column volumes of an equilibrium buffer containing 0.02M PB and 0.15M NaCl, pH 6.5, the filtered cell culture fluid is passed through the column, and then the column is washed with 5 column volumes of an equilibrium buffer containing 0.02M PB and 0.15M NaCl, pH 6.5, and then eluted with 5 column volumes of an eluent containing 0.1M Glycine-HCl, pH 2.7, and the eluent is immediately neutralized with a neutralizing solution of 1.0M Tris-HCl, pH 9.0, and the purified RXRα protein is ultrafiltered, exchanged, concentrated, and stored in PBS pH 6.5 to obtain the RXRα protein.

8. The method for detecting 25-OH-VD based on double sandwich of VDR and RXRα according to claim 1, characterized in that: Using the purified VDR protein and RXRα protein, double sandwich detection of 25-OH-VD content, including: Dissolve the VDR protein in the coating solution at a concentration of 1 μg / ml, add 100 μL to the corresponding wells, and incubate at 4°C overnight; aspirate the liquid in the wells, wash three times with 300 μL of washing buffer; add 300 μL of blocking solution to each well, incubate at 37°C for 1 hour; aspirate the liquid in the wells, wash three times with 300 μL of washing buffer; add 100 μL to each well The 3-fold gradient dilution of 25-OH-VD samples and the calibrated blood samples were incubated at 37°C for 1h; the liquid in the wells was aspirated, and the wells were washed 3 times with 300μL washing buffer, and 100μL 1μg / ml RXRα protein was added to each well; the liquid in the wells was aspirated, and the wells were washed 3 times with 300μL washing buffer, and 100μL HRP-labeled rabbit anti-human antibody was added to each well, and incubated at 37°C for 30min; the liquid in the wells was aspirated, and the wells were washed 5 times with 300μL washing buffer; 100μL of color development solution was added to each well, and after color development at 37°C for 10min, 50μL 2mol / L H2SO4 stop solution was added, and the value was read on the microplate reader at 450 within 20min after adding the stop solution.

Images