Allogeneic human macrophages for cell therapy

Abstract

The present invention relates to an allogeneic myeloid cell, such as a macrophage, for use in therapy, such as the treatment of cancer in a human patient, wherein the allogeneic myeloid cell, such as an allogeneic macrophage, comprises at least one MHC-II complex identical to any one MHC-II complex of the human patient. This advantage is that an antigen-specific reaction of CD4 + T cells of the human patient, for example, against tumor neoantigens, can be initiated. The present invention also relates to an allogeneic myeloid cell, such as an allogeneic macrophage or an allogeneic monocyte, for use in the treatment of cancer in a human patient wherein the allogeneic macrophage or the allogeneic monocyte comprises at least one protein complex selected from the group consisting of HLA-DR, HLA-DP and HLA-DQ, said protein complexes are identical to any corresponding HLA complex of said human patient, preferably wherein the allomacrophages comprise two protein complexes selected from said group, or even wherein the allomacrophages comprise three complexes selected from said group.

Description

Background Art

[0001] Macrophages are plastic cells, and their phenotype depends on the environmental stimuli they encounter. When macrophages are exposed to bacterial components or inflammatory cytokines such as IFNγ, macrophages enhance their microbicidal and tumoricidal abilities and produce high levels of proinflammatory cytokines; this activation state is called M1 or classically activated macrophages (O'Shea and Murray, 2008; Gordon, 2003). In contrast, when macrophages are stimulated by immunosuppressive cytokines such as IL-13, IL-4 or M-CSF, they exhibit an anti-inflammatory phenotype, typically including the production of IL-10 and promoting tissue remodeling and repair as well as angiogenesis (Murray and Wynn, 2011; Mantovani et al., 2002); this activation state is called M2 or alternatively activated macrophages.

[0002] Interestingly, macrophages are the most abundant cells in the tumor microenvironment. Clinical and experimental evidence shows that tumor-associated macrophages (TAMs) promote tumor progression and malignancies (Mantovani et al., 1992; Condeelis and Pollard, 2006; Mantovani et al., 2006), and their presence is associated with low survival (Qian and Pollard, 2010). In fact, TAMs support cancer development by promoting tumor angiogenesis, tumor cell invasion and metastasis, and inhibiting anti-tumor immune responses (Condeelis and Pollard, 2006; Pollard, 2004). It is reported that several cancers and their cell infiltration provide a mixture of cytokines in the surrounding environment, leading to M2 macrophage polarization (Nevala et al., 2009). Therefore, TAMs are clearly similar to the M2 phenotype (Balkwill et al., 2005).

[0003] Bart et al., 2021 reviewed approaches to reprogram macrophages in various pathologies and discussed the potential impact and challenges of macrophage-targeted approaches in human disease. In particular, various attempts to reprogram tumor-associated macrophages to circumvent the M2-like phenotype by small molecules and cytokines, nanocarriers, antibodies, nucleic acids, or viral vectors were discussed.

[0004] For the treatment of diseases such as cancer, macrophages that have been polarized to an M1 phenotype prior to administration have been tested. However, the M1 phenotype is not stable, and the administered macrophages can be repolarized to an M2-like phenotype by the tumor microenvironment.

[0005] In patent application PCT / EP2022 / 056819 we describe highly desirable human macrophages that are resistant to tumor-induced repolarization.

[0006] Understanding the mechanistic features of optimal activity of myeloid cells is highly desirable for the most effective medical use of M1 polarized myeloid cells, such as M1 macrophages. Summary of the invention

[0007] The present invention provides a deep understanding of the characteristics of myeloid cells of M1 polarization, which allow for their optimal anti-tumor activity. We observed in mice that lymphocytes, particularly T cells and / or NK cells, participate in one aspect of the anti-tumor activity of myeloid cells (such as macrophages). We also observed that HLA class II genes in myeloid cells were significantly upregulated, and these myeloid cells were resistant to tumor-induced repolarization and had anti-tumor activity. Based on these observations, but without wishing to be bound by any theory, we propose that the optimal anti-tumor activity involves the interaction of myeloid cells (such as macrophages) with T cells (such as CD4+T cells), which occurs through the interaction of the MHC II complex on myeloid cells (such as macrophages) with the T cell receptor on the T cell. This is of great significance for the improved anti-cancer cell therapy using allogeneic macrophages, monocytes or dendritic cells, especially the anti-cancer cell therapy using macrophages in the strict sense.

[0008] Due to MHC restriction, those T cells specific for tumor-derived neoantigens should respond much better to tumor-derived peptide antigens bound to matching MHC II complexes than to the same tumor-derived peptide antigens bound to mismatched MHC II complexes. Therefore, it is important to consider that allogeneic myeloid cells (such as allogeneic macrophages) carry at least one form of the HLA-DP, HLA-DQ and / or HLA-DR complexes that are also present in the CD4 T cells of the individual to be treated. In other words, there should be at least a partial match between the patient's lymphoid immune cells and allogeneic macrophages at the MHC-II complex level, so that, for example, when the neoantigen is presented on allogeneic antigen-presenting cells (such as macrophages), the antigen-specific recognition of the tumor-derived neoantigen by the patient's CD4+ T cells specific for the neoantigen is significantly improved.

[0009] Thus, the present invention relates to an allogeneic myeloid cell, such as a macrophage, for use in therapy, such as treating cancer in a human patient, wherein the allogeneic myeloid cell, such as an allogeneic macrophage, comprises at least one MHC-II complex identical to any MHC-II complex of the human patient. This has the advantage that an antigen-specific response of the CD4+T cells of the human patient, for example, against a tumor neoantigen, can be elicited. The present invention also relates to an allogeneic myeloid cell, such as an allogeneic macrophage or an allogeneic monocyte, for treating cancer in a human patient, wherein the allogeneic macrophage or the allogeneic monocyte comprises at least one protein complex selected from the group consisting of HLA-DR, HLA-DP and HLA-DQ, the protein complex being identical to any corresponding HLA complex of the human patient, preferably wherein the allogeneic macrophage comprises two protein complexes selected from said group, or even wherein the allogeneic macrophage comprises three complexes selected from said group.

[0010] Partial and preferably complete MHC II matching between allogeneic myeloid cells (such as macrophages) and the patient to be treated can also be described at the genetic level. Therefore, the present invention also relates to an allogeneic myeloid cell, such as a macrophage, for treating cancer in a patient, wherein the allogeneic myeloid cell and the patient to be treated have at least one pair of shared alleles, the at least one pair of shared alleles being selected from the group consisting of the following pairs: HLA-DRA / HLA-DRB1, HLA-DRA / HLA-DRB3, HLA-DRA / HLA-DRB4, HLA-DRA / HLA-DRB5, HLA-DPA1 / HLA-DPB1 and HLA-DQA1 / HLA-DQB1, preferably wherein the allogeneic myeloid cell and the patient to be treated have two, three, four, five or even all six pairs of shared alleles. It should be noted that for a heterozygous patient, this means that one allele pair overlaps with one allele pair of the allogeneic myeloid cells, but not necessarily that both allele pairs of the patient match both allele pairs of the allogeneic myeloid cells (although such a match of two allele pairs is certainly included).

[0011] Attached photos

[0012] Figure 1. Adoptive transfer of mouse Maf-DKO macrophages inhibits tumor growth in vivo.

[0013] (a) Representative route of the experimental procedure.

[0014] (b) Quantification of bioluminescence (luciferase activity) of primary tumors obtained on day 27.

[0015] (c) Quantification of ID8 tumor cells in the peritoneal cavity.

[0016] (**: p≤0,007). UN: untreated mice; WT: mice treated with wild-type derived bone marrow macrophages; BM-DKO: mice treated with bone marrow derived MafB and c-Maf double deficient macrophages

[0017] Figure 2. Adoptive transfer of mouse Maf-DKO macrophages reverses the growth of established tumors in vivo.

[0018] (a) Representative route of the experimental procedure.

[0019] (b) Quantification of bioluminescence (luciferase activity) of primary tumors obtained on day 27.

[0020] (c) Gating strategy and quantification of ID8 tumor cells.

[0021] (*: p≤0,04). UN: untreated mice; WT-BMDM: mice treated with wild-type derived bone marrow macrophages; BM-DKO: mice treated with bone marrow derived MafB and c-Maf double deficient macrophages.

[0022] Figure 3. Cellular contents in ascites fluid.

[0023] (a) Gating strategy for CD8 T cells and NK cells in peritoneal cells of tumor-bearing mice.

[0024] (b) Histogram showing CD8α expression by peritoneal cells in the peritoneal cavity of untreated (dotted line, small circles), WT-BMDM-treated (solid line, triangles), and Maf-DKO-treated (dash-dot line, rectangles) mice at day 27 after tumor initiation.

[0025] (c) Gating strategy for peritoneal macrophages.

[0026] (d) MHC class II expression in peritoneal macrophages.

[0027] (e) Mean fluorescence intensity of MHCII expression by peritoneal macrophages.

[0028] (**: p≤0,007). UN: untreated mice; WT: mice treated with wild-type derived bone marrow macrophages; Maf-DKO: mice treated with MafB and c-Maf double deficient macrophages.

[0029] Figure 4. Sorted macrophages from Maf-DKO treated mice resemble M1 activated macrophages in vivo.

[0030] Total mRNA was isolated from sorted CD11b+ peritoneal cells of tumor-bearing mice for real-time PCR analysis of (a) NOS2, (b) C2TA, (c) IL-6, (d) IL-12, and (e) IL-10.

[0031] (*: p≤0,04). Data are shown as mean values ​​of n=5. UN: untreated mice; WT: mice treated with wild-type derived bone marrow macrophages; Maf-DKO: mice treated with MafB and c-Maf double knockout macrophages.

[0032] Figure 5. Mouse Maf-DKO macrophages are more sensitive to M1 stimulation and more resistant to M2 stimulation than WT macrophages.

[0033] Total mRNA was isolated from cultured macrophages for real-time PCR analysis of (a) IL-6, (b) IL-10, (c) C2TA, (d) arginase, and (e) NOS2 upon stimulation with compounds A, B, C, and D. Maf-DKO macrophages are represented by dotted bars, and WT macrophages are represented by dash-dot lines.

[0034] Figure 6. Mouse Maf-DKO macrophages are not re-educated by tumors in vitro.

[0035] Cell supernatants were collected to analyze the production of (a) IL-6 and (b) TNFα upon stimulation with LPS in the absence (black bars) or presence (square bars) of ID8 tumor cell supernatants. SN = supernatant

[0036] Figure 7. Mouse Maf-DKO macrophages reverse the growth of established melanoma in vivo.

[0037] Experimental transfer of B16 melanoma cells in C57B16 mice.

[0038] (a) Representative route of experimental procedure. Macrophages were injected 7 days after tumor development.

[0039] (b) The lungs were removed and photographed.

[0040] (c) The number of metastatic colonies visible on the lung surface was counted using a magnifying glass and the median value was used for analysis. Results were obtained from 5 mice per group.

[0041] (*: p≤0,04; **: p≤0,007; ***: p≤0,0005). UN: untreated mice; WT: mice treated with wild-type derived bone marrow macrophages; Maf-DKO: mice treated with MAFB and c-Maf double deficient macrophages.

[0042] Figure 8. Mouse MAF DKO cells also recruit other leukocytes to defend against B16 melanoma.

[0043] Experimental metastasis of B16 melanoma cells in Rag2γc knockout mice.

[0044] (a, b) Representative schemes of experimental procedures, in (a), mice were treated with macrophages immediately after tumor initiation (results see 8c and 8e), and in (b), mice were injected with macrophages after tumor establishment (results see 8d and 8f).

[0045] (c, d) Livers were removed and photographed, and bioluminescence was also recorded (pictures are from a representative liver; white light is different from bioluminescence).

[0046] (e, f) The number of surface-visible metastatic colonies in mice treated in (a) and (b) was counted using a magnifying glass and the median value was used for analysis.

[0047] Results were obtained from 5 mice per group. (*: p≤0,04). B16: untreated mice; WT: mice treated with wild-type derived bone marrow macrophages; Maf-DKO: mice treated with DKO macrophages.

[0048] Fig. 9 : Workflow for CRISPR / Cas9-mediated deletion of MAF and MAFB in doxycycline-inducible Cas9-expressing human iPSC lines

[0049] Step 1: Lipofectamine transfection with a vector expressing MAF-targeting sgRNA

[0050] Step 2: Cas9 induction after doxycycline (Dox) treatment

[0051] Step 3: Isolate reporter gene-positive sgRNA-expressing cells by cell sorting to obtain single cell colonies

[0052] Step 4: Selection of MAF KO clones

[0053] Step 5: Repeat steps 1 to 4 using the selected MAF KO iPSC clone and MAFB-targeting sgRNA to subsequently knock out MAFB

[0054] Fig.10 : Gene structure of human MAF and MAFB indicating the location of CRISPR / Cas9 target sites in the 5' and 3' UTRs of both genes, as well as the indels obtained.

[0055] The human MAF gene has short and long isoforms generated by alternative splicing, and the significance of the long isoform is unknown. We knocked out exon 1 of the MAF gene. Human MAFB is a single-exon gene. The first row of each sequence block refers to the wild-type locus, and subsequent rows are indels generated by CRISPR / Cas9 editing. For MAF, only one clone was isolated (indels on both alleles are shown), and for MAFB, indels of 3 isolated clones are shown (C1, C2, C3: clones 1, 2, 3). In the sequence blocks, the start and stop codons are bold and the genomic target sequence is underlined. The position of the protospacer is shown as a black line close to the start or stop codon.

[0056] Fig.11 : Volcano plot of differentially expressed genes between human wt- and DKO- macrophages. iPS cell-derived macrophages were cultured in M-CSF and GM-CSF for 7 days and then transferred to M-CSF for only 2 hours. Differentially expressed genes as identified by deep sequencing are shown. The x-axis shows the degree of change and the y-axis shows statistical significance.

[0057] References

[0058] Asano, K., Nabeyama, A., Miyake, Y., Qiu, CH, Kurita, A., Tomura, M., Kanagawa, O., Fujii, S. and Tanaka, M. (2011). CD169-positive macrophages dominate antitumorimmunity by crosspresenting dead cell-associated antigens. Immunity 34, 85-95.

[0059] Aziz,A.,Soucie,E.,Sarrazin,S. and Sieweke,MH(2009).MafB / c-Mafdeficiency enables selfrenewal of differentiated functional macrophages.Science 326,867-871.

[0060] Bakri et al. (2005) Blood 105(7):2707-16

[0061] Balkwill, F., Charles, K. A., and Mantovani, A. (2005). Smoldering and polarized inflammation in the initiation and promotion of malignant disease. Cancer cell 7, 211 - 217.

[0062] Balkwill, F., and Mantovani, A. (2001). Inflammation and cancer: back to Virchow? Lancet 357, 539 - 545.

[0063] Bart, V et al. (2021). Immunology 163(2): 128 - 144.

[0064] Buchrieser et al. (2017) Stem Cell Reports 8(2): 334 - 345

[0065] Chu et al. (2016) Proc Natl Acad Sci U S A 113(44): 12514 - 12519

[0066] Condeelis, J., and Pollard, J. W. (2006). Macrophages: obligate partners for tumor cell migration, invasion, and metastasis. Cell 124, 263 - 266.

[0067] Cordes, S., and Barsh (1994) Cell 79(6): 1025 - 34

[0068] Eichmann, A. et al. (1997) Mech Dev 65(1 - 2): 111 - 22.

[0069] Freund et al. (2020) J. Exp. Med. 217(7):,, "Efficient gene knockout in primary human and murine myeloid cells by non - viral delivery of CRISPR - Cas9”

[0070] Fusaki et al. (2009) Proc Jpn Acad Ser B Phys Biol Sci 85(8):348-62

[0071] Gemelli et al. (2006) Cell Death Differ 13(10):1686-96

[0072] Gonzalez et al. (2014) Cell Stem Cell 15(2):215-226

[0073] Gordon,S.(2003).Alternative activation of macrophages.Nature reviewsImmunology 3,23-35.

[0074] Hagemann, T., Wilson, J., Burke, F., Kulbe, H., Li, NF, Pluddemann, A., Charles, K., Gordon, S. and Balkwill, FR (2006). Ovarian cancer cells polarize macrophages toward tumor associated phenotype. J Immunol 176, 5023-5032.

[0075] Hegde et al. (1999) Blood 94(5):1578-89.

[0076] Ho et al. (1996). Cell 85(7):973-83

[0077] Isogai et al. (2018) Cell Reprogram 20(6):347-355

[0078] Karpinski et al. (2016) Nat Biotechnol 34(4):401-9

[0079] Kataoka, K. et al. (1994) Mol. Cell. Biol. 14:700-712

[0080] Kelly L. et al. (2000) EMBO J 19(9):1987-97

[0081] Kerkar, S.P. and Restifo, N.P. (2012). Cellular constituents of immune escape within the tumor microenvironment. Cancer research 72, 3125 - 3130.

[0082] Kerppola, T.K. and Curran, T. (1994) Oncogene 9: 675 - 684

[0083] Kim et al. (1999) Immunity 10(6): 745 - 51

[0084] Klichinsky et al. (2020) Nat Biotechnol. 38(8): 947 - 953

[0085] Lansing et al. (2020) Nucleic Acids Res 48(1): 472 - 485

[0086] Mantovani, A., Bottazzi, B., Colotta, F., Sozzani, S. and Ruco, L. (1992). The origin and function of tumor - associated macrophages. Immunology today 13, 265 - 270.

[0087] Mantovani, A., Schioppa, T., Porta, C., Allavena, P. and Sica, A. (2006). Role of tumor associated macrophages in tumor progression and invasion. Cancer metastasis reviews 25, 315 - 322.

[0088] Mantovani, A., Sozzani, S., Locati, M., Allavena, P. and Sica, A. (2002). Macrophage polarization: tumor - associated macrophages as a paradigm for polarized M2 mononuclear phagocytes. Trends in immunology 23, 549 - 555.

[0089] Murray, P.J. and Wynn, T.A. (2011). Protective and pathogenic functions of macrophage subsets. Nature reviews Immunology 11, 723 - 737.

[0090] Nevala, W.K., Vachon, C.M., Leontovich, A.A., Scott, C.G., Thompson, M.A. and Markovic, S.N. (2009). Evidence of systemic Th2-driven chronic inflammation in patients with metastatic melanoma. Clinical cancer research: an official journal of the American Association for Cancer Research 15, 1931 - 1939.

[0091] O'Shea, J.J. and Murray, P.J. (2008). Cytokine signaling modules in inflammatory responses. Immunity 28, 477 - 487.

[0092] Pollard, J.W. (2004). Tumour-educated macrophages promote tumour progression and metastasis. Nature reviews Cancer 4, 71 - 78.

[0093] Qian, B.Z. and Pollard, J.W. (2010). Macrophage diversity enhances tumor progression and metastasis. Cell 141, 39 - 51.

[0094] Scharenberg et al. (2020) Nat Commun 11(1):3327

[0095] Shi et al. (2018) Molecules 23(11):3044

[0096] Taylor et al. (2012) Cell Stem Cell 11(2):147-52

[0097] Tillmanns et al. (2007) Mol Cell Biol 27(15):5554-64

[0098] Wang, B., Li, Q., Qin, L., Zhao, S., Wang, J. and Chen, X. (2011). Transition of tumor associated macrophages from MHC class II(hi) to MHC class II(low)mediates tumor progression in mice. BMC immunology 12,43.

[0099] Wang et al. (2018) Mol Ther Nucleic Acids 11:130-141

[0100] Yoshida et al., (2005) Nucleic Acids Res 33(11):3465-78

[0101] Yumlu et al. (2017) Methods 121-122:29-44

[0102] Zhang et al. (2020) Front Immunol 11:1871 DETAILED DESCRIPTION OF THE INVENTION

[0104] definition:

[0105] As used herein, a "chromosome" is one of the 46 conventional human chromosomes. A "gene located on a chromosome" is a gene that is not located outside a chromosome.

[0106] The term "gene" means such a DNA sequence: its coding RNA or a specific sequence of amino acids constituting all or part of one or more proteins or enzymes, and may or may not include a regulatory DNA sequence, such as a promoter sequence that determines the conditions of, for example, gene expression." Promoter " or " promoter sequence " is a DNA regulatory region that can bind to the RNA polymerase in the cell and initiate transcription of the downstream (3 ' direction) coding sequence. Some genes that are not structural genes can be transcribed into RNA from DNA, but are not translated into amino acid sequences. Other genes can play the role of regulatory factors of structural genes or regulatory factors of DNA transcription. In particular, the term gene can be intended to be used for the genomic sequence of coding proteins, that is, the sequence comprising regulatory factors, promoters, introns and exon sequences.

[0107] In the context of the present invention, the terms "mutant" and "mutation" mean detectable changes in genetic material (i.e., genomic DNA). Mutations include deletions, insertions, or substitutions of one or more nucleotides. Mutations may occur in the coding region of a gene (i.e., in an exon), in an intron, or in a regulatory region of a gene (e.g., an enhancer, a response element, an inhibitor, a signal sequence, a polyadenylation sequence, a promoter). Typically, mutations in an object are identified by comparing the sequence of a nucleic acid or polypeptide expressed by the object with a corresponding nucleic acid or polypeptide expressed in a control population. In the case where a mutation is within a gene coding sequence, a mutation may be a "missense" mutation that replaces an amino acid with another amino acid in a gene product, or a "nonsense" mutation that replaces an amino acid codon with a stop codon. Mutations may also occur at splice sites, where they generate or destroy signals for exon-intron splicing, thereby resulting in structurally altered gene products. In the context of the present invention, mutations are not silent, i.e., the mutations at least result in a change in the nucleotide sequence (when the gene product is a functional RNA) or the amino acid sequence (when the gene product is a protein), making the gene product non-functional or reducing the expression of the gene product at the RNA level by at least 80%. Preferred mutations (e.g., deletion of the entire gene) eliminate gene expression.

[0108] As used herein, gene expression is "inhibited" when gene expression at the RNA level is reduced by at least 80% compared to gene expression in the corresponding wild type, as measured by quantitative rt-PCR. Preferably, gene expression at the RNA level is reduced by at least 90%, such as at least 95%.

[0109] As used herein, gene expression is "eliminated" when it is not detectable at the RNA level by q-PCR. In qPCR, mRNA that is "expressed" and therefore present at a detectable level will a) give a sigmoidal fluorescence curve, b) reach a plateau within at least 38 PCR cycles, preferably at least 36 PCR cycles, and c) produce a PCR product of the expected length, i.e., a PCR product corresponding in length to mature mRNA rather than genomic DNA or unprocessed RNA intermediates. Preferably, mRNA expression can be confirmed by these three criteria in three replicate qPCR experiments.

[0110] As used herein, "mutagenesis" is a laboratory procedure whereby the genetic information of an organism is intentionally altered, resulting in mutations. The preferred mutagenesis method herein is a site-specific endonuclease-based method.

[0111] As used herein, "site-specific endonucleases" are enzymes that cut phosphodiester bonds within polynucleotide chains only at highly specific nucleotide sequences in the middle (internal) portion of double-stranded DNA molecules, which preferably appear only once in the human genome, so as to allow specific genetic engineering of human target cells. Examples of site-specific endonucleases typically used for genetic engineering of human target cells are zinc finger nucleases, TALENs, and CRISPR / Cas9 systems.

[0112] As used herein, the term "expression" may refer to gene expression of a polypeptide or protein, or to gene expression of a polynucleotide (such as miRNA or lncRNA), depending on the context. Expression of a polynucleotide can be determined, for example, by measuring the production of RNA transcript levels using methods well known to those skilled in the art. Expression of a protein or polypeptide can be determined, for example, by immunoassay using one or more antibodies that specifically bind to the polypeptide using methods well known to those skilled in the art.

[0113] As used herein, "expression of mRNA" relates to the transcription level of gene expression.

[0114] In the present invention, known methods can be used to detect this expression of gene. Examples of methods for quantitatively detecting mRNA levels in cells or cell collections include, for example, PCR-based methods (real-time PCR, quantitative PCR) and DNA microarray analysis. In addition, according to the so-called next-generation sequencing method, mRNA levels can be quantitatively detected by counting readings. Exemplary methods, conditions and materials for determining mRNA expression levels are described in the experimental section of this disclosure. The preferred method for determining mRNA expression is qPCR, as explained above under "elimination of expression".

[0115] Those skilled in the art can prepare mRNA or nucleic acid cDNA to be detected by the aforementioned detection method by considering the type and state of the sample, etc. and selecting a known method suitable therefor. When the gene expression level in the human macrophages of the present invention is compared with the expression level of the same gene in wild-type macrophages, it is compared under otherwise identical conditions, that is, the two types of macrophages are cultured and treated in the same manner to allow a scientifically meaningful comparison of mRNA levels.

[0116] As used herein, "allele" refers to one of the two copies of the same human gene. The two copies of a gene (one each on two homologous chromosomes) can be identical or slightly different in their respective sequences. Therefore, the use of the term allele is slightly different from its typical usage in this article, because it includes the same form of the same human gene in the same relative position on two homologous chromosomes. In diploid cells, the two alleles of a given gene occupy the corresponding loci on a pair of homologous chromosomes.

[0117] As used herein, an "allele" or "gene" becomes non-functional if further expression of the protein encoded by the gene or allele is undetectable following a procedure that renders the allele or gene non-functional. That is, the allele or gene that becomes non-functional will not express new proteins. Eventually, in a cell population consisting of cells with only non-functional alleles, the protein encoded by the allele or gene that becomes non-functional will become undetectable. The time until the protein encoded by the gene or allele will become undetectable depends on the kinetics of protein and mRNA turnover of the gene.

[0118] As used herein, the term "deletion" means that a portion of a DNA sequence is missing compared to a wild-type reference sequence.

[0119] As used herein, "exon" is any portion of a gene that, after introns are removed by RNA splicing, will encode a portion of the final mature RNA produced by the gene. The term exon refers to both the DNA sequence within a gene and the corresponding sequence in the RNA transcript. In RNA splicing, introns are removed and exons are covalently joined to each other as part of generating a mature messenger RNA.

[0120] As used herein, the term "chromosomal rearrangement" is a chromosomal abnormality involving a change in natural chromosomal structure. Typically, chromosomal rearrangement is caused by the breakage of the DNA double helix at two different locations, followed by the rejoining of the broken ends to produce a new gene chromosome arrangement, which is different from the gene order or chromosome of the chromosome before one or more chromosome breaks. This change may involve several different categories of events, such as large deletions, gene duplications, gene inversions, and translocations of more than 10,000 base pairs within a chromosome or between two chromosomes.

[0121] As used herein, the term "karyotyping" is an analysis of chromosomes within cells from a sample. The chromosomes are stained, and then the technician uses a microscope to examine the size, shape, and number of chromosomes in the cells of the cell sample. Typically, the stained sample is photographed to show the arrangement of the chromosomes. The karyotype describes the chromosome count of an organism and the appearance of these chromosomes under an optical microscope, particularly the length of the chromosomes, the location of the centromere within those chromosomes, the banding pattern of the stained chromosomes, any differences between the sex chromosomes, and any other physical characteristics.

[0122] As used herein, the term "guide RNA" refers to a "guide RNA" as used in the context of the CRISPR / Cas9 DNA editing system. The guide RNA confers target sequence specificity to the CRISPR-Cas9 system. The guide RNA is a non-coding short RNA sequence that first binds to the Cas9 enzyme, and then the guide RNA sequence guides the complex to a specific position on the DNA via base pairing, where Cas9 acts as an endonuclease and cuts the target DNA strand. Examples of guide RNAs are a) synthetic trans-activating CRISPR RNA (tracrRNA) plus synthetic CRISPR RNA (crRNA), where crRNA is designed to recognize a gene target site of interest, and b) single-stranded guide RNA (sgRNA) that combines both crRNA and tracrRNA in a single construct.

[0123] The term "MAF" means human MAF transcription factor. MAF and other Maf family members form homodimers and heterodimers with each other and with Fos and Jun, which is consistent with the known ability of AP-1 protein to pair with each other (Kerppola and Curran (1994); Kataoka, K. et al. (1994)). The DNA target sequence (called MAF response element (MARE)) bound by MAF homodimers is a 13 or 14bp element containing a core TRE (T-MARE) or CRE (C-MARE) palindromic structure, respectively, but MAF can also bind to DNA sequences different from these consensus sites, including composite AP-1 / MARE sites and MARE half sites with 5' rich AT extensions (Yoshida et al., 2005). MAF has been shown to stimulate the transcription of several promoters, and inhibit the transcription of other promoters. MAF also shows that it induces the differentiation of helper T cell type 2 (Th2) cells (Ho et al., 1996), which is due to its ability to activate tissue-specific transcription of interleukin 4 (IL-4) (Kim et al., 1999). In addition, overexpression of MAF in myeloid cell lines induces macrophage differentiation (Hegde et al., 1999). The gene of human MAF is located at position 16q23.2 on chromosome 16 and is described in detail as gene ID 4094 in the NCBI gene database. For sequence and position information, refer to the annotation version 109.20201120, i.e., the reference sequence combination GCF_000001405.39 of the current version Genome Reference Consortium Human Build38 patch version 13 on December 9, 2020. The document identifies the MAF gene on the complementary chain between 79,593,838 and 79,600,737.

[0124] The term "MAFB" means human MAFB transcription factor. The gene is expressed in a variety of cell types (including lens epithelial cells, pancreatic endocrine cells, epidermal cells, chondrocytes, neuronal cells and hematopoietic cells, particularly macrophages), and encodes a protein containing a typical bZip motif in its carboxyl terminal region. In the bZip domain, MAFB not only shares extensive homology with MAF but also with other Maf-related proteins. MAFB can form homodimers through its leucine repeat structure, and specifically binds to Maf recognition element (MARE) palindromic structure, composite AP-1 / MARE site or MARE half site with rich AT 5' extension (Yoshida et al., 2005). In addition, MAFB can form heterodimers (Kataoka et al., 1994) with Maf or Fos by its zipper structure without Jun or other Maf family members. MAFB is also known as kreisler, kr or KrmI1 ("Kreisler Maf Leucine Zipper 1"), because X-ray-induced chromosomal microinversions in Kreisler mutant mice cause tissue-specific loss of MAFB expression in the developing hindbrain that is responsible for the kreisler phenotype (Cordes et al., 1994)(Eichmann et al., 1997). In the hematopoietic system, MAFB is selectively expressed in the myeloid lineage and is continuously upregulated during myeloid differentiation from multipotent progenitors to macrophages. In fact, this induction reflects the important role of MAFB in the differentiation of monocytes and macrophages. Thus, overexpression of MAFB in transformed chicken myeloblasts (Kelly et al., 2000, Bakri et al., 2005) and human hematopoietic progenitor cells (Gemelli et al., 2006) inhibits progenitor cell proliferation (Tillmanns et al., 2007) and accelerates the formation of macrophages (Kelly et al., 2000, Bakri et al., 2005, Gemelli et al., 2006), while the dominant negative form of MAFB inhibits this process (Kelly et al., 2000). The absence of MafB together with Maf in mouse monocytes and macrophages can prolong proliferation (Aziz 2009, Soucie 2016). In summary, this indicates that MAFB induction is a specific and important determinant of the monocytic program in hematopoietic cells and is important for the cell cycle arrest of differentiated monocytes and macrophages.

[0125] The gene for human MAFB is located at position 20q12 on chromosome 20 and is described in detail in the NCBI gene database as gene ID 9935. For sequence and position information, refer to the reference sequence assembly GCF_000001405.39 of the annotation version 109.20201120, the current version of the Genome Reference Consortium Human Build 38 patch version 13 on December 9, 2020. This document identifies the MAFB gene on the complementary strand between 40685848 and 40689236.

[0126] As used herein, IL-4 refers to human interleukin 4. The protein encoded by IL-4 is a pleiotropic cytokine produced by activated T cells. IL-4 is a glycoprotein consisting of 129 amino acids and having a molecular weight of about 20 kDa. It is a ligand for the interleukin 4 receptor. The interleukin 4 receptor also binds to IL13, which may contribute to the many overlapping functions of this cytokine and IL13. IL4 is considered to be an important cytokine for tissue repair, counteracting the effects of proinflammatory type 1 cytokines.

[0127] The gene for human IL-4 is located at position 5q31.1 on chromosome 5 and is described in detail in the NCBI gene database as gene ID 3565. Sequence and position information is available in annotation version 109.20210226. For cell culture experiments, recombinant human IL-4, a 15.1 kDa globulin containing 130 AAs (obtained from Preprotech, catalog #200-04), was used. In a human TF-1 cell proliferation assay, the specific activity was at least 5×10 6 U / mg.

[0128] IL-4 signal transduction occurs through interaction with its receptor. The interaction of IL-4 with its receptor leads to receptor dimerization and activation. Activated receptors activate JAK1 and 3 associated with receptor subunits. Activated JAK phosphorylates the tyrosine residues in the cytoplasmic tail of the receptor, which then serve as docking sites for many adapter molecules or signaling molecules (including STAT6). Activated STAT6 dimerizes, translocates to the nucleus and transcriptionally activates genes that respond to IL-4.

[0129] As used herein, IL-13 relates to human interleukin 13. The protein encoded by IL-13 is a cytokine produced by a variety of immune cells, such as mainly activated Th2 cells, but also by CD4 cells, NKT cells, mast cells, basophils and eosinophils. IL-13 is a central regulator of IgE synthesis, goblet cell hyperplasia, mucus hypersecretion, airway hyperresponsiveness, fibrosis and chitinase upregulation.

[0130] The gene for human IL-13 is located at position 5q31.1 on chromosome 5 and is described in detail in the NCBI gene database as gene ID 3596. Sequence and position information is available in annotation version 109.20210226.

[0131] As used herein, ARG-1 relates to human arginase 1. Arginase catalyzes the hydrolysis of arginine to ornithine and urea. The type I isoform encoded by this gene is a cytosolic enzyme and is primarily expressed in the liver under normal physiological conditions as part of the urea cycle. However, ARG1 is also an immunosuppressive signal primarily present in tumor-associated macrophages. Macrophages polarized to an immunosuppressive phenotype express ARG1.

[0132] The gene for human ARG-1 is located at position 6q23.2 on chromosome 6 and is described in detail in the NCBI gene database as gene ID 383. Sequence and position information is available in annotation version 109.20210226.

[0133] As used herein, IL-10 refers to human interleukin 10. IL-10 is a cytokine produced primarily by monocytes and macrophages and to a lesser extent by lymphocytes. This cytokine has pleiotropic effects in immunomodulation and inflammation. It downregulates the expression of co-stimulatory molecules on Th1 cytokines, MHC class II, and macrophages. This cytokine can block NF-κB activity and participate in the regulation of the JAK-STAT signaling pathway. High IL-10 expression is present in tumor-associated macrophages. Macrophages polarized to an immunosuppressive phenotype express IL-10. IL-10 expression has been described as a predictor of advanced tumor stages and is associated with poor overall survival.

[0134] The gene for human IL-10 is located at position 1q32.1 on chromosome 1 and is described in detail in the NCBI gene database as gene ID 3586. Sequence and position information is available in annotation version 109.20210226.

[0135] As used herein, IL-6 refers to human interleukin 6. The protein encoded by IL-6 is a cytokine that plays a role in inflammation and B cell maturation. In addition, the encoded protein has been shown to be an endogenous pyrogen that can induce fever in people with autoimmune diseases or infections. The protein is mainly produced at sites of acute and chronic inflammation, where it is secreted into the serum and induces transcriptional inflammatory responses through interleukin 6 receptor alpha.

[0136] The gene for human IL-6 is located at position 7p15.3 on chromosome 7 and is described in detail in the NCBI gene database as gene ID 3569. Sequence and position information is available in annotation version 109.20210226.

[0137] As used herein, CXCL10 refers to CXC motif chemokine ligand 10. The protein encoded by CXCL10 is a chemokine of the CXC subfamily and a ligand for the receptor CXCR3. Binding of this protein to CXCR3 results in pleiotropic effects, including stimulation of monocyte, natural killer cell and T cell migration, and regulation of adhesion molecule expression.

[0138] The gene for human CXCL10 is located on chromosome 4 at position 4q21.1 and is described in detail in the NCBI gene database as gene ID 3627. Sequence and position information is available in annotation version 109.20210226.

[0139] As used herein, C2TA (CIITA) refers to the class II major histocompatibility complex transactivator protein. C2TA is a protein with an acidic transcriptional activation domain, four leucine-rich repeats and a GTP-binding domain. The protein is located in the nucleus and acts as a positive regulator of class II major histocompatibility complex gene transcription and is known as a "master controller" of these gene expression.

[0140] The gene for human C2TA is located on chromosome 16 at position 16p13.13 and is described in detail in the NCBI gene database as gene ID 4261. Sequence and position information is available in annotation version 109.20210226.

[0141] As used herein, TNF refers to tumor necrosis factor. TNF is a multifunctional proinflammatory cytokine belonging to the tumor necrosis factor (TNF) superfamily. This cytokine is mainly secreted by macrophages. It can bind to its receptors TNFRSF1A / TNFR1 and TNFRSF1B / TNFBR, and thus exert its effects through its receptors. This cytokine participates in the regulation of a series of biological processes including cell proliferation, differentiation, apoptosis, lipid metabolism and coagulation.

[0142] The gene for human TNF is located at position 6p21.33 on chromosome 6 and is described in detail in the NCBI gene database as gene ID 7124. Sequence and position information is available in annotation version 109.20210226.

[0143] As used herein, M-CSF (also referred to as CSF1) relates to human colony stimulating factor 1. M-CSF is a cytokine that controls the production, differentiation, proliferation and function of macrophages. Different active isoforms of the protein exist as membrane-bound or extracellular disulfide-linked homodimers and are thought to be produced by proteolytic cleavage of membrane-bound precursors.

[0144] The gene for human M-CSF is located at position 1p13.3 on chromosome 1 and is described in detail in the NCBI gene database as gene ID 1435. Sequence and position information is available in annotation version 109.20210226. For cell culture experiments, recombinant human M-CSF, a 38 kDa homodimer produced in HEK293 cells (obtained from Gibco, catalog # PHC9501) was used. The ED50 was up to 5 ng / ml as determined by dose-dependent proliferation of M-NSF60 cells.

[0145] As used herein, MHCII refers to class II of the major histocompatibility complex (MHC) molecules, which are typically found only on professional antigen-presenting cells, such as mononuclear phagocytes, including dendritic cells and macrophages, and B cells. MHCII presents peptides to T cells that are derived from extracellular proteins by endocytosis, rather than from cytoplasmic proteins as is the case with MHC class I.

[0146] In humans, the MHC class II protein complex is encoded by the human leukocyte antigen gene complex (HLA). The HLA corresponding to MHC class II is HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ and HLA-DR.

[0147] HLA-A or "human leukocyte antigen 1" refers to a protein that belongs to the HLA class I heavy chain paralogs. The class I molecule is a heterodimer composed of one heavy chain and one light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. Class I molecules play a central role in the immune system by presenting cytoplasmic peptides that shuttle through the lumen of the endoplasmic reticulum so that they can be recognized by cytotoxic T cells. They are expressed in almost all cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the α1 and α2 domains that both bind peptides, exon 4 encodes the α3 domain, exon 5 encodes the transmembrane region, and exons 6 and 7 encode the cytoplasmic tail region. Polymorphisms within exons 2 and 3 are responsible for the peptide binding specificity of each class 1 molecule. Typing for these polymorphisms is routinely performed for bone marrow and kidney transplants. More than 6000 HLA-A alleles have been described. The gene for human HLA-A is located at position 6p22.1 on chromosome 6 and is described in detail in the NCBI gene database as gene ID 3105. Sequence and position information is available from the reference sequence assembly GCF_000001405.39 of the annotation version 109.20201120, the current version of the Genome Reference Consortium Human Build38 patch version 13 as of December 9, 2020. This document identifies the HLA-A gene on the coding strand between 29942532 and 29945870.

[0148] HLA-B refers to a protein that is a paralog of the HLA class I heavy chain. Hundreds of HLA-B alleles have been described. The gene for human HLA-B is located at position 6p21.33 on chromosome 6 and is described in detail in the NCBI gene database as gene ID 3106. Sequence and position information is available from the reference sequence assembly GCF_000001405.39 of the annotation version 109.20201120, the current version as of December 9, 2020, Genome Reference Consortium Human Build 38 Patch Release 13.

[0149] HLA-DR is a dimeric protein belonging to HLA class II. HLA class II molecules are heterodimers composed of α (such as HLA-DRA) and β chains (such as HLA-DRB1, HLA-DRB3, HLA-DRB4 or HLA-DRB5) all anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells. Since the α chain is almost unchanged, the variability of HLA-DR composition in individuals mainly comes from the ability of α chains to pair with β chains from three different DRβ loci (both HLA-DRB1 and any DRB3, DRB4 or DRB5 alleles). In DR molecules, β chains basically contain all polymorphisms of specified peptide binding specificity. In particular, hundreds of DRB1 alleles have been described, and some alleles have increased frequencies associated with certain diseases or conditions. These alleles are responsible for the variability of HLA-DR composition within a population, and an individual can be homozygous for HLA-DRB1 (i.e., both parents carry the same HLA-DRB1 allele), but in general most individuals are heterozygous for HLA-DRB1. The gene for human HLA-DRB1 is located at position 6p21.32 on chromosome 6 and is described in detail as gene ID 31223 in the NCBI gene database. For sequence and position information, refer to the reference sequence assembly GCF_000001405.39 of the annotation version 109.20201120, the current version of the Genome Reference Consortium Human Build 38 patch version 13 as of December 9, 2020.

[0150] HLA-DQ is a dimeric protein belonging to HLA class II. HLA class II molecules are heterodimers composed of α (such as HLA-DQA1) and β chains (such as HLA-DQB1) both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells. The α and β chains vary greatly between individuals, so there are many alleles described for HLA-DQA1 and HLA-DQB1. As an MHC class II antigen presenting receptor, DQ acts as a dimer (DQ heterodimer) containing two protein subunits α (DQA1 gene product) and β (DQB1 gene product). These receptors can be composed of α+β groups of two different DQ haplotypes, one group from the maternal and paternal chromosomes. If a person carries the haplotype -AB- from one parent and -ab- from the other, the person will produce 2 alpha subtypes (A and a) and 2 beta subtypes (B and b). This can produce 4 slightly different receptor heterodimers (or more simply DQ subtypes). Two of the subtypes are in the cis-haplotype pairing (AB and ab) and 2 are in the trans-haplotype pairing (Ab and aB). Such a person is a double heterozygote for these genes, which is the most common case for DQ. If a person carries the haplotypes -AB- and -Ab-, they can only produce 2 DQs (AB and Ab), but if a person carries the haplotypes -AB- and -AB-, they can only produce the DQ subtype AB, which is called a double homozygote. The gene for human HLA-DQA1 is located at position 6p21.32 on chromosome 6 and is described in detail in the NCBI gene database as gene ID 3117. The gene for human HLA-DQB1 is also located on chromosome 6 at position 6p21.32 and is described in detail in the NCBI gene database as gene ID 3119.

[0151] HLA-DP is also a dimeric protein belonging to the HLA class II. HLA class II molecules are heterodimers consisting of α (such as HLA-DPA1) and β chains (such as HLA-DPB1) both anchored in the membrane. It also plays a role in the immune system by presenting peptides derived from extracellular proteins. This situation is similar to that described for HLA-DQ. The α chain and the β chain vary between individuals, so there are several alleles described for HLA-DPA1 and HLA-DPB1. As described for HLA-DQ, HLA-DP can be composed of two different α+β groups of HLA-DP haplotypes, one group comes from the maternal and paternal chromosomes, and a person can be a double heterozygote of HLA-DPA1 and HLA-DPB1, which is the most common case for DP, a person can be a simple zygote, and a person can also be a double homozygote of HLA-DP. The gene for human HLA-DPAl is located at position 6p21.32 on chromosome 6 and is described in detail in the NCBI gene database as gene ID 3113. The gene for human HLA-DPB1 is also located at position 6p21.32 on chromosome 6 and is described in detail in the NCBI gene database as gene ID 3115.

[0152] Depending on the context, as used herein, CD2 relates to the CD2 gene or CD2 as a surface marker, ie the extracellular part of the CD2 protein (also known as LFA-2). The CD2 gene is described in detail in the NCBI gene database as gene ID 914.

[0153] Depending on the context, as used herein, CD28 relates to the CD28 gene or the surface marker, ie the extracellular part of the CD28 protein. The CD28 gene is described in detail in the NCBI gene database as gene ID 940.

[0154] Depending on the context, as used herein, CD38 relates to the CD38 gene or the surface marker, ie the extracellular part of the CD38 protein (also known as ADPRC1). The CD38 gene is described in detail in the NCBI gene database as gene ID 952.

[0155] Depending on the context, as used herein, CD64 relates to the extracellular part of the CD64 gene or the surface marker, FCGR1A (Fc gamma receptor Ia). FCGR1A is described in detail in the NCBI gene database as gene ID 2209.

[0156] Depending on the context, as used herein, CD74 relates to the CD74 gene or the surface marker, ie the extracellular portion of the CD74 protein (also known as HLADG). The CD74 gene is described in detail in the NCBI gene database as gene ID 972.

[0157] Depending on the context, as used herein, C5AR1 relates to the C5AR1 gene or the surface marker, ie the extracellular part of the C5AR1 protein (also known as CD88). The C5AR1 gene is described in detail in the NCBI gene database as gene ID 728.

[0158] Depending on the context, as used herein, CD70 relates to the CD70 gene or the surface marker, ie the extracellular part of the CD70 protein. CD70 is described in detail in the NCBI gene database as gene ID 970.

[0159] Depending on the context, as used herein, CD206 relates to the CD206 gene or the surface marker, the extracellular part of the mannose receptor type C 1. CD206 is described in detail in the NCBI gene database as gene ID 4360.

[0160] Depending on the context, as used herein, CD163 relates to the CD163 gene or surface marker, i.e. the extracellular part of the CD163 protein.CD163 is described in detail as gene ID 9332 in the NCBI gene database.

[0161] Depending on the context, IL15 as used herein relates to the secreted form of the IL15 gene or the IL15 protein, the active cytokine interleukin 15. IL15 is described in detail in the NCBI gene database as gene ID 3600.

[0162] Depending on the context, IL18 as used herein relates to the secreted form of the IL18 gene or the IL18 protein, the active cytokine interleukin 18. IL18 is described in detail in the NCBI gene database as gene ID 3606.

[0163] Depending on the context, as used herein, IL23A relates to the IL23A gene or to IL23A as a subunit of the heterodimeric cytokine IL23. In this context, IL23A is detectable as secreted active cytokine interleukin 23. IL23A is described in detail in the NCBI gene database as gene ID 51561.

[0164] Depending on the context, RXFP2 as used herein relates to the RXFP2 gene or the surface marker, ie the extracellular part of the RXFP2 protein (Relaxin Family Peptide Receptor 2). RXFP2 is described in detail in the NCBI gene database as gene ID 122042.

[0165] Depending on the context, LYVE1 as used herein relates to the LYVE1 gene or the surface marker, ie the extracellular part of the LYVE1 protein (lymphatic hyaluronan receptor 1). LYVE1 is described in detail in the NCBI gene database as gene ID 10894.

[0166] Depending on the context, as used herein, STAB1 relates to the STAB1 gene or the surface marker, the extracellular part of the STAB1 protein stabilin1 (also known as SCARH2 due to its possible role as a scavenger receptor). STAB1 is described in detail in the NCBI gene database as gene ID 23166.

[0167] Depending on the context, LILRB5 as used herein relates to the LILRB5 gene or the surface marker, ie the extracellular part of the LILRB5 protein (leukocyte immunoglobulin-like receptor B5). LILRB5 is described in detail in the NCBI gene database as gene ID 10990.

[0168] Depending on the context, RNASE1 as used herein relates to the secreted form of the RNASE1 gene or the RNASE1 protein (Ribonuclease A family member 1). RNASE1 is described in detail in the NCBI gene database as gene ID 6035.

[0169] Depending on the context, as used herein, F13A1 relates to the secreted form of the F13A1 gene or the F13A1 protein (A subunit of coagulation factor XIII). F13A1 is described in detail in the NCBI gene database as gene ID 2162.

[0170] As used herein, QPCT relates to the secreted form of the QPCT gene or the QPCT protein (glutaminyl cyclase), depending on the context. QPCT is described in detail in the NCBI gene database as gene ID 25797.

[0171] Depending on the context, as used herein, CCL7 relates to the secreted form of the CCL7 gene or the CCL7 protein (chemokine CCL7). CCL7 is described in detail in the NCBI gene database as gene ID 6354.

[0172] Depending on the context, as used herein, RNF128 relates to the RNF128 gene or the RNF128 protein (E3 ubiquitin ligase, also known as GRAIL). RNF128 is described in detail in the NCBI gene database as gene ID 79589.

[0173] STAT6 is described in detail in the NCBI gene database as gene ID 6778.

[0174] IRF4 is described in detail in the NCBI gene database as gene ID 3662.

[0175] PPARγ is described in detail in the NCBI gene database as gene ID 5468.

[0176] KLF4 is described in detail in the NCBI gene database as gene ID 9314.

[0177] C / EPBβ (CEBPB) is described in detail in the NCBI gene database as gene ID 1051.

[0178] GATA3 is described in detail in the NCBI gene database as gene ID 2625.

[0179] JMJD3 (KDM6B) is described in detail in the NCBI gene database as gene ID 23135.

[0180] SOCS2 is described in detail in the NCBI gene database as gene ID 8835.

[0181] SOCS1 is described in detail in the NCBI gene database as gene ID 8651.

[0182] AKT1 is described in detail in the NCBI gene database as gene ID 207.

[0183] FCGBP is described in detail in the NCBI gene database as gene ID 8857.

[0184] In the context of experiments performed in mice, references to genes relate to the mouse gene corresponding to the designated human gene name (e.g., references to "IL-6" in the context of mouse experiments described in Examples 1 to 8 relate to mouse IL-6).

[0185] As used herein, a negative regulator is a gene product, particularly a polypeptide, which hinders the binding of RNA polymerase to the promoter region, thereby inhibiting the activity of enhancers or inhibiting the activity of transcriptional activators, thereby resulting in reduced transcription of target genes (such as C2TA).

[0186] CD8+ T cells (also called cytotoxic T lymphocytes or CTLs) develop in the thymus and express T cell receptors. They express a dimeric coreceptor CD8 that is usually composed of one strand of CD8α and one strand of CD8β. CD8+ T cells recognize peptides presented by MHC class I molecules, which are present in all nucleated cells. CD8+ T cells are important for immune defense against intracellular pathogens, including viruses and bacteria, as well as for tumor surveillance.

[0187] NK cells (also called natural killer cells or large granular lymphocytes (LGL)) are a type of cytotoxic lymphocyte that is critical to the innate immune system. NK cells can be identified by the presence of CD56 and the absence of CD3 (CD56+, CD3-). NK cells are innate immune cells that function similarly to cytotoxic T cells in the adaptive immune response. NK cells provide a rapid response to virus-infected cells, become active around 3 days after infection, and respond to tumor formation. NK cells are able to recognize and kill stressed cells in the absence of antibodies and MHC. This role is important because harmful cells that lack the MHCI marker cannot be detected and destroyed by other immune cells, such as T lymphocytes.

[0188] The "recruitment" of cells (such as CD8+T cells and / or NK cells) to tumors can be tested in mouse models (e.g., humanized mouse models) by extracting tumor masses, isolating cells, and analyzing the number of CD8+T cells and / or NK cells associated with the tumor masses, for example, by FACS after appropriate staining. Treatments that enable the recruitment of said cells to tumors (such as injection of macrophages of the invention) will over time result in a situation where these cells account for a higher percentage of the number of cells in the analyzed tumor mass when compared to an appropriate control that has not undergone said treatment.

[0189] As used herein, the term "proliferating cell" refers to a cell that is capable of undergoing cell division. A cell is a proliferating cell if the cell number of a population of at least 1000 "proliferating cells" increases at least 4-fold after 8 days under appropriate culture conditions, i.e., when n(192 hours) / n(0 hours) (where n is the total number of cells in the cell population at the specified time point) is at least 4,00.

[0190] As used herein, the term "differentiated human cell" is a cell that does not change cell type and produces two cells of the same cell type even when the cell divides. This is in contrast to "pluripotent cells" and oligopotent cells, which can differentiate into all cell types of an adult organism, and oligopotent cells, which can differentiate into several closely related cell types.

[0191] As used herein, a "myeloid cell" is a cell of hematopoietic origin that is not a lymphocyte and is not an erythroid megakaryocyte and is not a multi-lineage progenitor cell with potential beyond myeloid.

[0192] As used herein, iPS cells or "induced pluripotent stem cells" means cells with pluripotency obtained by reprogramming somatic cells. Several teams including the team of Professor Shinya Yamanaka et al. of Kyoto University, the team of Rudolf Jaenisch et al. of Massachusetts Institute of Technology, the team of James Thomson et al. of University of Wisconsin, and the team of Konrad Hochedlinger et al. of Harvard University have successfully produced such induced pluripotent stem cells. As ideal pluripotent cells with neither immune rejection nor ethical issues, induced pluripotent stem cells have attracted great attention. For example, International Publication WO2007 / 069666 describes nuclear reprogramming factors of somatic cells including gene products of Oct family genes, Klf family genes, and Myc family genes, and nuclear reprogramming factors of somatic cells including gene products of Oct family genes, Klf family genes, Sox family genes, and Myc family genes. The disclosure also describes a method for producing induced pluripotent stem cells by nuclear reprogramming of somatic cells, the method comprising the step of allowing the aforementioned nuclear reprogramming factors to contact the somatic cells.

[0193] "Monocytes" are mononuclear phagocytes of peripheral blood. Monocytes vary considerably, ranging in size from 10 to 30 μm in diameter. The ratio of nucleus to cytoplasm ranges from 2:1 to 1:1. The nucleus is usually ribbon-shaped (horseshoe-shaped) or reniform (kidney-shaped). It can be folded on top of itself, thereby showing cerebral-like gyri. There are no visible nucleoli. The chromatin pattern is very fine and arranged in twisted filamentous chains. The cytoplasm is abundant and blue-gray in color, with many tiny azure-loving granules, giving a ground-glass appearance in Giemsa staining. Vacuoles may be present. More preferably, the expression of specific surface antigens is used to determine whether a cell is a monocyte. Phenotypic markers of human monocytes include CD11b, CD11c, CD33, CD45, and CD115. Typically, human monocytes express CD9, CD11b, CD11c, CDw12, CD13, CD15, CDw17, CD31, CD32, CD33, CD35, CD36, CD38, CD43, CD45, CD49b, CD49e, CD49f, CD63, CD64, CD65s, CD68, CD84, CD85, CD86, CD87, CD89, CD91, CDw92, CD93, CD98, CD101, CD102, CD111, CD112, CD115, CD116, CD119, CDw121b, CDw123, CD127, CDw128, CDw131, CD147 , CD155, CD156a, CD157, CD162, CD163, CD164, CD168, CD171, CD172a, CD180, CD131a1, CD213a2, CDw210, CD226, CD281, CD282, CD284, CD286 and optionally CD4, CD14, CD16, CD40, CD45RO, CD45RA, CD45RB, CD62L, CD74, CD141, CD142, CD169, CD170, CD181, CD182, CD184, CD191, CD192, CD194, CD195, CD197, CD206, CX3CR1. Unless explicitly excluded, as used herein, "monocytes" are encompassed by the term "macrophages".

[0194] "Dendritic cells" (DC) are antigen presenting cells present in vivo, in vitro, in vitro or in a host or subject, or they may be derived from hematopoietic stem cells, hematopoietic progenitor cells or monocytes. Dendritic cells and their precursors can be isolated from a variety of lymphoid organs (e.g., spleen, lymph nodes) as well as bone marrow and peripheral blood. DC has a characteristic morphology, with thin sheets (lamellar pseudopodia) extending away from the dendritic cell body in multiple directions. DC constitutively expresses both MHC class I and class II molecules, which present peptide antigens to CD8+ and CD4+ T cells respectively and can activate immature T cells. In addition, human skin and mucosal DC also express the CD1 gene family, i.e., MHC class I related molecules presenting microbial lipids or glycolipid antigens. The DC membrane is also rich in molecules (e.g., intercellular adhesion molecule 1 or CD54) that allow T cell adhesion or molecules such as B7-1 and B7-2 (also referred to as CD80 and CD86, respectively) that costimulate T cell activation. Typically, DCs express CD85, CD180, CD187, CD205, CD281, CD282, CD284, CD286 and in a subset, CD206, CD207, CD208 and CD209. Unless explicitly excluded, as used herein, "dendritic cells" are encompassed by the term "macrophages".

[0195] As used herein, "macrophage" includes macrophages, monocytes and dendritic cells. Preferably, however, as used herein, "macrophage" is a macrophage in the strict sense. Macrophages are cells that exhibit phagocytic properties. The morphology of macrophages is different between different tissues and between normal and pathological states, and not all macrophages can be identified by morphology alone. However, most macrophages are large cells with round or concave nuclei, developed Golgi bodies, abundant pinocytic vacuoles, lysosomes and phagolysosomes, and plasma membranes covered with wrinkles or microvilli. The key functions of macrophages in innate immunity and adaptive immunity are phagocytosis and subsequent degradation of aging or apoptotic cells, microorganisms and tumor cells, secretion of cytokines, chemokines and other soluble mediators, and presentation of exogenous antigens (peptides) to T lymphocytes on their surface. Macrophage is derived from multipotent progenitor cells, common myeloid progenitor cells and granulocyte-monocyte progenitor cells in mammalian organism bone marrow, and they eventually develop into monocytes by further progenitor cell stage, and then enter peripheral blood flow.Different from neutrophil granulocytes with multilobed nuclei, monocytes have kidney-shaped nuclei and present larger cell bodies during further differentiation and activation.During whole life, some monocytes adhere and migrate to enter all organs through capillary endothelium, wherein some of them can be differentiated into resident tissue macrophages or dendritic cells (vide infra).Except monocyte source, tissue resident macrophage can also establish the early primitive macrophage progenitor cells of yolk sac before directed hematopoiesis, from erythroid-macrophage progenitor cells (EMP) of different hematopoietic sites of embryo or from fetal monocytes derived from embryonic hematopoietic stem cells and develop.These embryonic macrophages can last to adulthood, and are independent of adult hematopoietic stem cell and monocyte input and maintain for a long time. Lymphoid tissues such as lymph nodes and spleen are particularly rich in macrophages, but tissue-resident macrophages are present in essentially every organ of the body. In some organs, macrophages have special names, as summarized in Table 1.

[0196] Table 1 Examples of tissue macrophages

[0197]

[0198]

[0199] Additional examples of macrophages are peritubular and interstitial macrophages, myocardial macrophages from the heart, adipose tissue macrophages from adipose tissue, large and small intestinal macrophages from the intestine, skeletal muscle macrophages, synovial macrophages from joints, adventitial macrophages, intimal macrophages, vessel-associated macrophages, resident pancreatic macrophages, meningeal macrophages, pleural macrophages, and omental macrophages.

[0200] In the context of the present invention, macrophages can be selected from any of the above-mentioned macrophages, preferably, macrophages are selected from the group consisting of microglia, tissue cells, Hofbauer cells, mesangial cells, Kupffer cells, peritoneal macrophages, alveolar macrophages, epidermal or dermal macrophages, marginal zone macrophages, metallophilic macrophages, red pulp macrophages, white pulp macrophages and osteoclasts. Macrophages can also be derived from human iPS cells via an in vitro differentiation protocol, as will be described elsewhere.

[0201] Macrophages are an important source of cytokines. Functionally, the numerous products can be divided into several groups: (1) cytokines that mediate proinflammatory responses (i.e., help recruit additional inflammatory cells) (e.g., IL-1, II-6, TNF, CC and CXC chemokines, such as IL-8 and monocyte-chemoattractant protein 1); (2) cytokines that mediate activation of T cells and natural killer (NK) cells (e.g., IL-1, IL-12, IL-15, IL-18); (3) cytokines that exert feedback effects on macrophages themselves (e.g., IL-1, TNF, IL-12, IL-18, M-CSF, IFNα / β, IFNγ); (4) cytokines that downregulate macrophages and / or help terminate inflammation (e.g., IL-10, TGFβ), and (5) cytokines that are important for wound healing or support of tissue stem cells (e.g., EGF, PDGF, bFGF, TGFβ) or support of blood vessel growth (e.g., VEGF) or neurons (e.g., neurotrophins, kinins). The production of cytokines by macrophages can be initiated by microbial products such as LPS, by interaction with type 1 T helper cells, or by soluble factors including prostaglandins, leukotrienes, and most importantly, other cytokines (e.g., IFNγ). Typically, human macrophages express CD11c, CD11b, CD14, CD18, CD26, CD31, CD32, CD36, CD45RO, CD45RB, CD63, CD68, CD71, CD74, CD87, CD88, CD101, CD115, CD119, CD121b, CD155, CD156a, CD204, CD206, CDw210, CD281, CD282, CD284, CD286 and express CD163, CD169, CD170, MARCO, FOLR2, LYVE1 in a subset manner. Activated macrophages can further express CD23, CD25, CD69, CD105 and HLA-DR, HLA-DP and HLA-DQ.

[0202] As used herein, a macrophage is resistant to M2 polarization by M-CSF (or a cytokine such as a combination of M-CSF and IL-4 and / or IL-13) if long-term culture of a macrophage (or macrophages) does not result in a loss of all features characteristic of M1 polarized macrophages, in particular it does not result in a loss of all features typical of M1 polarized macrophages. As used herein, the characteristic features of M1 polarized macrophages may be any of the following: upregulated expression of HLA class II genes such as HLA-DPA1, HLA-DPB1, HLA-DPB2, HLA-DRA, HLA-DRB5, HLA-DQA1, HLA-DQB1, and / or upregulated expression of RXFP2, CD74, CD38, CD2, IL18 and / or IL23A, and / or upregulated secretion of IL18, IL15 and / or IL23, and / or downregulated expression of RNASE1, PPBP, CD28, LYVE1, FCGBP, F13A1, QPCT, CCL7 and / or RNF128, and / or downregulated secretion of PPBP, CCL7, RNASE1, F13A1, QPCT and / or FCGBP. M1 macrophages may also be characterized by the surface markers they express or do not express and / or the pattern of surface markers expressed and / or not expressed. As used herein, further examples of typical characteristics of M1 macrophages may be positive for MHC II, positive for CD74, positive for CD2, negative for LYVE1, negative for CD28, negative for STAB1, and / or negative for LILRB5.

[0203] A "surface marker" is a molecule, typically a protein or carbohydrate structure, that is present on the outside of the plasma membrane of a cell and is specific for a particular cell type or a limited number of cell types and is therefore a "marker" for these cell types. Examples of surface markers on human macrophages are CD11c, CD11b, CD14, CD16, CD18, CD26, CD31, CD32, CD33, CD36, CD45RO, CD45RB, CD63, CD64, CD68, CD71, CD74, CD87, CD88, CD101, CD115, CD119, CD121b, CD155, CD156a, CD163, CD169, CD170, CD204, CD206, CDw210, CD281, CD282, CD284, CD286, MARCO, FOLR2, CX3CR1, and LYVE1.

[0204] If the specific fluorescent signal is produced by staining with surface marker specific antibodies in FACS experiments, the cell is "positive" for the surface marker. The principle of FACS is explained in detail in the book "Practical Flow Cytometry" 4th edition written by Howard M.Shapiro. In FACS experiments, cell collections are typically stained with several fluorescent antibodies, each of which selectively binds to different surface markers and has different fluorescent dyes. This allows the selection of specific cell types in heterogeneous cell collections by appropriate gating strategies in FACS experiments. Then, the specific fluorescent signal of the surface marker specific antibody is verified in a one-dimensional histogram by comparing the staining histogram of all antibodies with the staining histogram of the antibody mixture that only omits the surface marker specific antibody (so-called "FMO" or "fluorescence minus one" signal). If the two histograms are different, so that the staining with the mixture of all antibodies produces more fluorescence than the FMO control, the tested cell collection is positive for the tested cell surface marker. In terms of the visual appearance of the histogram, this means that when compared with the FMO control, the fluorescence peak of all antibody mixture staining moves to a higher fluorescence value. Preferably, the two histograms - all antibodies on the one hand and FMO on the other hand - overlap by at most 70 area % (area under the curve), such as at most 50 area %, for example at most 25 area %.

[0205] The "secretion" of cytokines such as IL18 and / or IL15 can be determined by qualitatively and / or quantitatively measuring the appearance of the cytokines in the cell culture supernatant with immunobiochemical methods, such as by ELISA-based methods or microbead-based multiple determinations, such as Luminex technology, to name just two examples. In short, before being added to a cell collection and after the cells to be tested for cytokine secretion are cultured in a culture medium, the culture medium used for cell growth is analyzed for the presence of a specific cytokine to be tested. If the concentration of the cytokine in the supernatant increases during the culture period, and if this increase in cytokine concentration can be confirmed in three consecutive independent measurements, the cytokine is "secreted" by the cells cultured in the culture medium. IL6 can be detected at a concentration of 0.1 pg / ml or even lower, such as by the meso scalediscovery immunoassay "V-PLEX human IL-6 kit" of Meso Scale Diagnostics. CXCL10 can be detected at concentrations of 5 pg / ml or even lower, for example by Perkin Elmer's LANCE Ultra Human CXCL10 Detection Kit.

[0206] The terms "phagocytic cells" and "phagocytes" are used interchangeably herein to refer to cells that are capable of engulfing. There are different major categories of professional phagocytes: mononuclear phagocytes (including macrophages strictly speaking), monocytes and dendritic cells, and polymorphonuclear leukocytes (neutrophils). However, there are also "non-professional" phagocytes known to participate in efferocytosis, a process by which both professional and non-professional phagocytes dispose of apoptotic cells in a rapid and efficient manner.

[0207] As used herein, the term "progenitor cell" refers to a cell that is a descendant of a stem cell and can further differentiate to produce a specialized cell type. There are many types of progenitor cells in the human body. Each progenitor cell can only differentiate into cells belonging to the same tissue or organ. Some progenitor cells have a final target cell that they differentiate into, while other progenitor cells have the potential to end up in more than one cell type. Progenitor cells are therefore intermediate cell types that participate in the production of mature cells in human tissues and organs, blood, and the central nervous system. Hematopoietic progenitor cells are intermediate cell types in the development of blood cells. They are immature cells that develop from hematopoietic stem cells and eventually differentiate into one of more than a dozen different types of mature blood cells.

[0208] As used herein, the term "CD34+ multipotent progenitor cells" is a stem cell-enriched population of hematopoietic progenitor cells that express the CD34 surface antigen and are not macrophages, monocytes or dendritic cells.

[0209] As used herein, the term "monoblast" refers to committed progenitor cells in the bone marrow that differentiate from myeloid progenitor cells during hematopoiesis. They can mature into monocytes, which in turn can develop into macrophages.

[0210] As used herein, the term "collection of cells" relates to at least 10,000 cells, which cells are alive.

[0211] As used herein, the term "expansion" of cells is the process of culturing cells under suitable laboratory conditions and increasing the number of living cells by mitosis of the cultured cells.

[0212] As used herein, the term "after exposure to" means that the cells are cultured in the continued presence of a particular factor, such as a cytokine, for a specified period of time and then tested immediately thereafter.

[0213] As used herein, the term "genetically modified" cell relates to a cell in which the cell's DNA has been altered using a biotechnological method. For example, a cell in which the cell's DNA has been manipulated using the CRISPR / Cas9 DNA editing system is a genetically modified cell, wherein the manipulation leaves a detectable change in the cell's DNA.

[0214] As used herein, the term "under suitable culture conditions" is a condition in which the phagocytes of the present invention can grow. Cultivation is typically carried out in a cell culture medium supplemented with appropriate growth factors and at a suitable temperature and in a suitable controlled atmosphere. RPMI culture medium (RPMI is named after Roswell Park Memorial Institute and is a culture medium often used to culture human lymphocytes) supplemented with 10% FBS (PAA-GE Healthcare, A15-101), supplemented with 100 units / ml penicillin, 100ug / ml streptomycin (Thermo Fisher, #15140122), 2mM GlutaMAX (Thermo Fisher, #35050038), 1mM sodium pyruvate (Thermo Fisher, #11360-039), 50ng / ml M-CSF (Thermo Fisher, #PHC9504) and, if necessary, 50ng / ml GM-CSF (Peprotech, #300-03) (as described in Example 3) is a suitable culture medium. Cultures are typically performed at 37°C and 5% CO2, 21% O2.

[0215] As used herein, the term "reactive oxygen species" refers to unstable molecules that contain oxygen and are prone to react with other molecules in the cell. Typically, reactive oxygen species are free radicals. Reactive oxygen species are known to be components of the killing response of immune cells to microbial invasion.

[0216] As used herein, the term "activation" refers to the phenomenon that external stimuli can induce changes in cells so that the cells are activated. For example, macrophages can be activated by cytokines such as interferon gamma (IFN-γ) and bacterial endotoxins such as lipopolysaccharide (LPS). Activated macrophages undergo many changes that allow them to kill invading bacteria or infected cells. They release toxic chemicals and proteins that have toxic effects on other cells. Activated macrophages are larger, have increased metabolism, increased lysosomal protein levels, and a stronger ability to engulf and kill microorganisms. Activated macrophages also release proteases, neutrophil chemotactic factors; reactive oxygen species, such as nitric oxide and peroxides; cytokines such as tumor necrosis factor alpha (TNF-α), interleukins 1 and 8 (IL-1 and IL-8), eicosanoids, and growth factors. The products of these activated macrophages can cause certain tissue destruction, which is a sign of inflammation.

[0217] As used herein, the term "adherent" relates to the property of adherent cells to attach to a solid substrate, such as the bottom of a tissue culture flask. In contrast, suspension cells will float and grow in suspension in the culture medium, so that there is no need to mechanically or chemically remove them.

[0218] As used herein, lamellipodia are protrusions on the leading edge of a cell. They contain a quasi-two-dimensional actin network. Filopodia are finger-like structures within lamellipodia that have extended beyond the borders of the lamellipodia and thus extend from them.

[0219] When referring to polypeptides or nucleotide sequences, the so-called "purified" and "isolated" mean that the specified molecule is present in the substantial absence of other biological macromolecules. When referring to cells or cell populations, the term means that the cells or the cell population are present in the substantial absence of other cells or cell populations. As used herein, the term "purified" preferably means the presence of at least 75% by weight or number, more preferably at least 85% by weight or number, still preferably at least 95% by weight or number, and most preferably at least 98% by weight or number of the same type of biological macromolecules or cells. An "isolated" nucleic acid molecule encoding a specific polypeptide refers to a nucleic acid molecule that is substantially free of other nucleic acid molecules that do not encode the subject polypeptide; however, the molecule may include some additional bases or parts that do not adversely affect the basic characteristics of the composition.

[0220] As used herein, the terms "tumor," "tumor cell," "cancer," and "cancer cell" refer to cells that exhibit relatively autonomous growth such that they exhibit an abnormal growth phenotype characterized by a marked loss of control of cell proliferation (i.e., dysregulated cell division) and / or disruption / noncompliance with the organization and structure of normal tissues. Tumor cells can be malignant or benign, while cancer cells are malignant. "Metastatic cells or tissues" means that the cells can invade, colonize, and destroy adjacent and distant body structures.

[0221] As used herein, a "solid tumor" is a non-hematological tumor. Solid tumors can be benign (not cancer) or malignant (cancer). Different types of solid tumors are named after the type of cells that form them. Examples of solid tumors are sarcomas, carcinomas, and some lymphomas, while leukemias (blood cancers) do not usually form solid tumors.

[0222] As used herein, the term "subject" refers to a human being.

[0223] In the context of the present invention, as used herein, the term "treating" or "treatment" means to reverse, alleviate, inhibit the progression of, or prevent the disease or condition, or one or more symptoms of such a disease or condition, to which the term applies.

[0224] As used herein, the term "chimeric antigen receptor" is a fusion of an extracellular recognition domain (e.g., an antigen-specific targeting region), a transmembrane domain, and one or more intracellular signaling domains. When the antigen is engaged by the extracellular recognition domain, the intracellular signaling portion of the CAR can trigger activation-related reactions in immune cells, such as releasing cytolytic molecules to induce tumor cell death, etc.

[0225] As used herein, the term "ex vivo" means outside a living body.

[0226] As used herein, the term "in vitro" means outside a living body and in a laboratory environment. For example, cells cultured "in vitro" are cultured in a controlled and usually artificial culture medium.

[0227] As used herein, "autologous" is a term referring to cells that are derived from an individual's own cells. For example, in an autologous transfusion, a patient's own blood is collected and re-infused into the body.

[0228] As used herein, "allogeneic" is a term referring to human cells that are not derived from an individual's own cells. For example, an allogeneic stem cell transplant is distinct from an autologous stem cell transplant, which uses stem cells from the patient's own body.

[0229] All numerical designations (e.g., pH, temperature, time, concentration, and molecular weight, including ranges) are approximate and vary in increments of 0.1 (+) or (-). It is understood that, although not always explicitly stated, all numerical designations are preceded by the term "about". It is also understood that, although not always explicitly stated, the agents described herein are merely examples and that equivalents are known in the art.

[0230] It should be understood that the present invention is not limited to the specific materials and methods described herein. It should also be understood that the terms used herein are for the purpose of describing specific embodiments, and are not intended to limit the scope of the present invention, which is limited only by the appended claims. As used herein, the singular forms "one", "a kind of" and "said" include plural references unless the context clearly indicates otherwise. Unless otherwise defined, all technical terms and scientific terms used herein have the same meanings as those of ordinary skill in the art to which the present invention belongs. The following references provide a general definition of many terms used in the present invention for those skilled in the art, unless otherwise defined herein, and are arranged in ascending order of priority: Singleton et al., Dictionary of Microbiology and Molecular Biology (3rd Edition, 2006); The Glossary of Genomics Terms (JAMA. 2013; 309 (14): 1533-1535), Janeway's Immunobiology, 9th Edition and "Practical Flow Cytometry", 4th Edition, HM Saphiro.

[0231] All publications mentioned herein are cited for the purpose of describing and disclosing the cell lines, protocols, reagents, and vectors reported in the publications and which might be used in connection with the present invention. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate disclosure by virtue of prior invention.

[0232] Detailed Description

[0233] We observed, for example, in Example 8, that lymphocytes, particularly T cells and / or NK cells, participate in important aspects of the anti-tumor activity of macrophages. In lymphocyte-deficient Rag2γc mice, administration of myeloid cells after the establishment of metastasis no longer leads to regression of metastasis, whereas in wild-type mice with a physiological lymphocyte compartment, metastasis regression is caused. In Example 11, we observed that certain HLA class II genes were significantly upregulated in human MAF / MAFB DKO macrophages, which correspond to mouse MAF / MAFB DKO macrophages with anti-tumor activity. Based on these observations, but without being bound by any theory, we propose that one aspect of the anti-tumor activity of myeloid cells (such as macrophages) is mediated by the interaction of myeloid cells (such as macrophages) with T cells (such as CD4+T cells), via the interaction of the MHC II complex on myeloid cells (especially myeloid cells with at least one typical M1 marker) with the T cell receptor on CD4+ cells. This has important implications for improved anticancer cell therapy with allogeneic myeloid cells (such as macrophages), monocytes or dendritic cells, especially anticancer cell therapy with macrophages strictly speaking.

[0234] Due to MHC restriction, those T cells specific for tumor-derived neoantigens should respond much better to tumor-derived peptide antigens bound to autologous MHC complexes than to the same tumor-derived peptide antigens bound to mismatched allogeneic MHC complexes. Therefore, we propose that it is important to consider that allogeneic myeloid cells (such as allogeneic macrophages) carry at least one form of the HLA-DP, HLA-DQ and / or HLA-DR complexes that are also present in the individual to be treated. In other words, there should be at least a partial match between the patient's lymphoid immune cells and allogeneic myeloid cells (such as allogeneic macrophages) at the MHC-II complex level, so that, for example, when the neoantigen is presented on allogeneic myeloid antigen-presenting cells (such as macrophages), the antigen-specific recognition of the tumor-derived neoantigen by the neoantigen-specific patient's CD4+ T cells is significantly improved.

[0235] Therefore, in another aspect, the present invention relates to an allogeneic myeloid cell, such as an allogeneic macrophage, for use in therapy (such as treating cancer in a human patient), wherein the allogeneic myeloid cell (such as an allogeneic macrophage) comprises at least one MHC-II complex identical to any MHC-II complex of the human patient. Such an advantage is that an antigen-specific response of the CD4+T cells of the human patient can be elicited. The present invention also relates to an allogeneic myeloid cell, such as an allogeneic macrophage, for treating cancer in a human patient, wherein the allogeneic macrophage comprises at least one protein complex selected from the group consisting of HLA-DR, HLA-DP and HLA-DQ, the protein complex being identical to any corresponding HLA complex of the human patient, preferably wherein the allogeneic myeloid cell (such as an allogeneic macrophage) comprises two protein complexes selected from said group, or even wherein the allogeneic myeloid cell (such as an allogeneic macrophage) comprises three complexes selected from said group. The present invention also relates to an allogeneic myeloid cell, such as an allogeneic macrophage, for treating cancer in a human patient, wherein the allogeneic myeloid cell (such as an allogeneic macrophage) comprises at least one HLA-DR protein complex that is identical to any corresponding HLA-DR complex of the human patient. The present invention also relates to an allogeneic myeloid cell, such as an allogeneic macrophage, for treating cancer in a human patient, wherein the allogeneic myeloid cell (such as an allogeneic macrophage) comprises at least one HLA-DP protein complex that is identical to any corresponding HLA-DP complex of the human patient. The present invention also relates to an allogeneic myeloid cell, such as an allogeneic macrophage, for treating cancer in a human patient, wherein the allogeneic myeloid cell (such as an allogeneic macrophage) comprises at least one HLA-DQ protein complex that is identical to any corresponding HLA-DQ complex of the human patient.

[0236] The (partial) MHC II match between the allogeneic myeloid cells (such as allogeneic macrophages) and the patient to be treated can also be described at the genetic level. Therefore, the present invention also relates to an allogeneic myeloid cell, such as an allogeneic macrophage, for treating cancer in a patient, wherein the allogeneic myeloid cell (such as an allogeneic macrophage) and the patient to be treated have at least one pair of alleles in common, these at least one pair of alleles in common are selected from the group consisting of the following pairs: HLA-DRA / HLA-DRB1, HLA-DRA / HLA-DRB3, HLA-DRA / HLA-DRB4, HLA-DRA / HLA-DRB5, HLA-DPA1 / HLA-DPB1 and HLA-DQA1 / HLA-DQB1, preferably wherein the allogeneic myeloid cell (such as an allogeneic macrophage) and the patient to be treated have two, three, four, five or even all six pairs of alleles in common. It should be noted that for a heterozygous patient, this means that one allele pair overlaps with one allele pair of the allogeneic myeloid cells (such as allogeneic macrophages), but not necessarily that the patient's two allele pairs match two allele pairs of the allogeneic myeloid cells (such as allogeneic macrophages) (although such a match of two allele pairs is certainly included).

[0237] The principle of at least partial MHC-II overlap as described above applies to all myeloid cells intended for cancer therapy, such as macrophages, for example allogeneic macrophages polarized to an M1 phenotype ex vivo prior to administration or genetically engineered human macrophages equipped with a CAR (CAR=chimeric antigen receptor), for example, as described by Klichinsky et al., 2020 (as discussed in the introduction). Preferably, however, the allogeneic human myeloid cells comprise at least one mutation in both alleles of a gene located on a chromosome, wherein the human macrophages are resistant to M-CSF-induced M2 polarization.

[0238] Therefore, the present invention also relates to an allogeneic human myeloid cell, such as an allogeneic macrophage, for treating cancer in a human patient, wherein the allogeneic myeloid cell (such as an allogeneic macrophage) comprises at least one MHC-II complex that can elicit an antigen-specific response of CD4+ T cells of the human patient, and / or wherein the allogeneic myeloid cell and the patient to be treated have at least one pair of shared alleles selected from the group consisting of the following pairs: HLA-DRA / HLA-DRB1, HLA-DRA / HLA-DRB3, HLA-DRA / HLA-DRB4, HLA-DRA / HLA-DRB5, HLA-DPA1 / HLA-DPB1 and HLA-DQA1 / HLA-DQB1, and wherein the human myeloid cell (such as a human macrophage) is resistant to M-CSF-induced M2 polarization, in particular wherein the human myeloid cell (such as a human macrophage) is resistant to M-CSF-induced M2 polarization upon exposure to 50 ng / ml M-CSF. After 48 hours, it contains typical features of M1 macrophages. Human myeloid cells (such as human macrophages) can be genetically modified, for example, by introducing genes encoding surface proteins (such as chimeric antigen receptors), but human myeloid cells (such as human macrophages) can also be myeloid cells (such as human macrophages) that have not been genetically modified, for example, derived from iPS cells and have been polarized to an M1 phenotype, for example, by LPS or interferon gamma.

[0239] The present invention also relates to a method for treating a human subject suffering from cancer, the method comprising administering to the human subject an amount of allogeneic human myeloid cells (such as human macrophages), or a collection of allogeneic human myeloid cells (such as human macrophages), sufficient to at least inhibit further growth of the cancer, wherein the allogeneic myeloid cells (such as human macrophages) comprise at least one MHC-II complex that can elicit a response from CD4+ T cells of the human patient, and / or wherein the allogeneic myeloid cells (such as human macrophages) and the patient to be treated have at least one pair of common alleles, the at least one pair of common alleles being selected from the group consisting of the following pairs: HLA-DRA / HLA-DRB1, HLA-DRA / HLA-DRB3, HLA-DRA / HLA-DRB4, HLA-DRA / HLA-DRB5, HLA-DPA1 / HLA-DPB1 and HLA-DQA1 / HLA-DQB1.

[0240] Preferred human myeloid cells for therapy are myeloid cells containing at least one mutation in both alleles of a gene located on a chromosome, wherein the macrophages are resistant to M-CSF-induced M2 polarization. The macrophages of the present invention are anti-tumorigenic and thus can be used in macrophage therapy, particularly anti-cancer therapy.

[0241] In particular, the human myeloid cells for use in therapy of the present invention are resistant to M2 polarization caused by a combination of M-CSF and IL-4 and / or even a combination of M-CSF and IL-4 and IL-13.

[0242] Being resistant to M2 polarization means that, for example, the allogeneic human myeloid cells (such as allogeneic human macrophages) used for therapy according to the invention comprise typical features of M1 macrophages even after exposure to M-CSF and / or IL-4 and / or IL-13 for 24 hours, in particular 48 hours, such as 72 hours or more. For example, allogeneic human myeloid cells (such as allogeneic human macrophages) can be exposed to 50 ng / ml M-CSF and / or 20 ng / ml IL-4 for 24 hours, or even, for example, to 50 ng / ml M-CSF and / or 20 ng / ml IL-4 for 48 hours, such as 72 hours, and still comprise at least one typical feature of M1 macrophages. Preferred allogeneic human myeloid cells (such as allogeneic human macrophages) for use in therapy of the present invention still display at least one, such as at least 2, 3, 4 or even 5 typical characteristics of M1 macrophages after 24 hours of exposure to a combination of 50 ng / ml M-CSF and 40 ng / ml IL-4 and 20 ng / ml IL-13, in particular after 48 hours, or even 72 hours of exposure.

[0243] The human allogeneic human myeloid cells (such as allogeneic human macrophages) used for therapy of the present invention can be characterized by their gene expression profiles. A typical feature of M1 macrophages may be, for example, the expression of the HLA-DRA gene. In particular, the expression level of HLA-DRA mRNA in human myeloid cells (such as human macrophages) containing at least one mutation in both alleles of the gene located on the chromosome is higher, such as at least 4 times, for example at least 8 times, such as at least 16 times or even at least 32 times, compared to the expression of HLA-DRA mRNA in otherwise identical wild-type myeloid cells (such as human macrophages) tested under otherwise equivalent culture conditions.

[0244] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, the expression of the HLA-DRB5 gene. In particular, the expression level of HLA-DRB5 mRNA in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of the gene located on the chromosome is higher, such as at least 4 times, for example at least 8 times, such as at least 16 times, or even at least 32 times, compared to the expression of HLA-DRB5 mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0245] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, the expression of the HLA-DPA1 gene. In particular, the expression level of HLA-DPA1 mRNA in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is higher, such as at least 4 times, such as at least 8 times, such as at least 16 times, or even at least 32 times, compared to the expression of HLA-DPA1 mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0246] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, the expression of the HLA-DQA1 gene. In particular, the expression level of HLA-DQA1 mRNA in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of the gene located on the chromosome is higher, such as at least 4 times, such as at least 8 times, such as at least 16 times, or even at least 32 times, compared to the expression of HLA-DQA1 mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0247] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, the expression of the RXFP2 gene. In particular, the expression level of RXFP2 mRNA in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of the gene located on the chromosome is higher, such as at least 4 times, for example at least 8 times, such as at least 16 times, or even at least 32 times, compared to the expression of RXFP2 mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0248] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, the expression of the CD74 gene. In particular, the expression level of CD74 mRNA in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is higher, for example, at least 4 times, for example, at least 8 times, or even at least 16 times, compared to the expression of CD74 mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0249] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, the expression of the CD70 gene. In particular, the expression level of CD70 mRNA in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is at least 4 times higher, for example at least 8 times higher, or even at least 16 times higher, compared to the expression of CD70 mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0250] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, the expression of the CD38 gene. In particular, the expression level of CD38 mRNA in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is higher, for example, at least 4 times, for example, at least 8 times, or even at least 16 times, compared to the expression of CD38 mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0251] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, the expression of the IL15 gene. In particular, the expression level of IL15 mRNA in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is at least 2 times higher, for example at least 2.5 times higher, than the expression of IL15 mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0252] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, the expression of the IL18 gene. In particular, the expression level of IL18 mRNA in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is at least 4 times higher, for example at least 6 times higher, than the expression of IL18 mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0253] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, the expression of the IL23A gene. In particular, the expression level of IL23A mRNA in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is at least 4 times higher, for example at least 6 times higher, compared to the expression of IL23A mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0254] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, the expression of the APOBEC3A gene. In particular, the expression level of APOBEC3A mRNA in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of the gene located on the chromosome is higher, for example, at least 4 times, for example, at least 5 times, compared to the expression of APOBEC3A mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0255] The preferred typical characteristics of the human macrophages of the present invention are the expression of the HLA-DRA gene, the HLA-DRB5 gene, the HLA-DPA1 gene, the HLA-DPB1 gene, the HLA-DQA1 gene and the HLA-DQB1 gene. In particular, the expression level of each mRNA corresponding to the above-mentioned genes in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of the genes located on the chromosome is higher, such as at least 4 times, for example at least 8 times, such as at least 16 times, or even at least 32 times, compared to the expression of mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0256] The preferred typical characteristics of the human macrophages of the present invention are the expression of the HLA-DRA gene, the HLA-DRB5 gene, the HLA-DPA1 gene, the HLA-DPB1 gene, the HLA-DQA1 gene, the HLA-DQB1 gene, the RXFP2 gene and the CD74 gene. In particular, the expression level of each mRNA corresponding to the above-mentioned genes in human myeloid cells (e.g., human macrophages) containing at least one mutation in both alleles of the genes located on the chromosome is as high as at least 4 times, for example, at least 8 times, such as at least 16 times, compared to the expression of mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0257] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, down-regulated expression of the RNASE1 gene. In particular, the expression level of RNASE1 mRNA in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is lower, such as at least 4 times, such as at least 8 times, such as at least 16 times, at least 32 times, or even at least 64 times, compared to the expression of RNASE1 mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions. 64 times lower means that the number of copies of RNASE1 mRNA in the human myeloid cells (e.g., human macrophages) of the present invention is only 1 / 64 of the number of copies of RNASE1 mRNA in the corresponding wild-type myeloid cells (e.g., human macrophages).

[0258] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, down-regulated expression of the CD28 gene. In particular, the expression level of CD28 mRNA in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is lower, for example, at least 4 times, for example, at least 8 times, such as at least 16 times, at least 32 times, or even at least 64 times, compared to the expression of CD28 mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0259] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, down-regulated expression of the LYVE1 gene. In particular, the expression level of LYVE1 mRNA in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is lower, for example, at least 4 times, for example, at least 8 times, such as at least 16 times, at least 32 times, or even at least 64 times, compared to the expression of LYVE1 mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0260] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, down-regulated expression of the C5AR1 gene. In particular, the expression level of C5AR1 mRNA in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is lower, for example, at least 4 times, for example, at least 8 times, such as at least 16 times, or even at least 25 times, compared to the expression of C5AR1 mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0261] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, down-regulated expression of the FCGBP gene. In particular, the expression level of FCGBP mRNA in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is lower, for example, at least 4 times, for example, at least 8 times, such as at least 16 times, at least 32 times, or even at least 64 times, compared to the expression of FCGBP mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0262] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, down-regulated expression of the F13A1 gene. In particular, the expression level of F13A1 mRNA in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is lower, such as at least 4 times, for example at least 8 times, such as at least 16 times, at least 32 times, or even at least 64 times, compared to the expression of F13A1 mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0263] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, down-regulated expression of the QPCT gene. In particular, the expression level of QPCT mRNA in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is lower, for example, at least 4 times, for example, at least 8 times, such as at least 16 times, at least 32 times, or even at least 64 times, compared to the expression of QPCT mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0264] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, down-regulated expression of the DUSP6 gene. In particular, the expression level of DUSP6 mRNA in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is at least 4 times lower, for example at least 6 times lower, compared to the expression of DUSP6 mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0265] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, down-regulated expression of the CCL7 gene. In particular, the expression level of CCL7 mRNA in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is lower, for example, at least 4 times, for example, at least 8 times, such as at least 16 times, or even at least 32 times, compared to the expression of CCL7 mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0266] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, down-regulated expression of the RNF128 gene. In particular, the expression level of RNF128 mRNA in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is low, such as at least 4 times, for example at least 8 times, such as at least 16 times, at least 32 times, or even at least 64 times, compared to the expression of RNF128 mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0267] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, down-regulated expression of the IL10 gene. In particular, the expression level of IL10 mRNA in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is lower, for example, at least 4 times, for example, at least 8 times, such as at least 16 times, at least 32 times, or even at least 64 times, compared to the expression of IL10 mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0268] The preferred typical feature of the human macrophages of the present invention is that the expression of RNASE1 gene, CD28 gene and LYVE1 gene is downregulated. In particular, compared with the expression of mRNA in wild-type myeloid cells (e.g., human macrophages) tested under otherwise identical culture conditions, the expression level of each mRNA corresponding to the above-mentioned genes in human myeloid cells (e.g., human macrophages) containing at least one mutation in both alleles of the gene located on the chromosome is low, such as at least 4 times, for example, at least 8 times, such as at least 16 times, at least 32 times or even at least 64 times.

[0269] Another preferred typical feature of the human macrophages of the present invention is the up-regulation of the expression of the HLA-DRA gene, the HLA-DRB5 gene, the HLA-DPA1 gene, the HLA-DPB1 gene, the HLA-DQA1 gene and the HLA-DQB1 gene on the one hand, and the down-regulation of the expression of the RNASE1 gene, the CD28 gene and the LYVE1 gene on the other hand. In particular, the expression level of each mRNA corresponding to the above-mentioned up-regulated genes in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of the gene located on the chromosome is at least 4-fold higher, for example at least 8-fold higher, such as at least 16-fold, or even at least 32-fold higher, compared to the expression of the mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions, while the expression level of each mRNA corresponding to the above-mentioned down-regulated genes in human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of the gene located on the chromosome is at least 4-fold lower, for example at least 8-fold lower, such as at least 16-fold, at least 32-fold, or even at least 64-fold lower, compared to the expression of the mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0270] Other preferred typical features of the human myeloid cells (e.g., human macrophages) for use in therapy of the present invention are that the expression of the following gene combinations is upregulated by at least 10-fold (compared to the expression of the corresponding mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions): combination A) HLA-DRA and RXFP2, B) HLA-DRA and CD74, C) HLA-DOA and RXFP2, D) HLA-DOA and CD74, E) HLA-DPA1 and RXFP2, F) HLA-DPA1 and CD74, G) HLA-DRA and RXFP2 and CD74, H) HLA-DOA and RXFP2 and CD74, and combination I) HLA-DPA1 and RXFP2 and CD74.

[0271] Other preferred typical features of the human myeloid cells (e.g., human macrophages) for use in therapy of the present invention are that the expression of the following gene combinations is downregulated by at least 50-fold (compared to the expression of the corresponding mRNA in otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions): the combination m) RNASE1 and LYVE1, n) RNASE1 and FCGBP, o) RNASE1 and CD28, p) RNASE1 and F13A1, q) RNASE1 and RNF128, r) LYVE1 and CD28, s) LYVE1 and FCGBP, t) LYVE1 and F13A1, u) LYVE1 and RNF128, v) CD28 and F13A1, and the combination w) CD28 and RNF128.

[0272] Other preferred typical features of the human myeloid cells (e.g., human macrophages) for use in therapy of the present invention are up-regulated expression of one gene combination and down-regulated expression of another gene combination, as described in combination with the following combinations: Am (A and m are as described directly above; expression of both HLA-DRA and RXFP2 (A) is up-regulated by at least 10-fold, together with expression of both RNASE1 and LYVE1 (m) being down-regulated by at least 50-fold), An, Ao, Ap, Aq, Ar, As, At, Au, Av, Aw, Bm, Bn, Bo, Bp, Br, Bq, Bs, Bt, Bu, B v, Bw, Vm, Cn, Co, Cp, Cq, Cr, Cs, Ct, Cu, Cv, Cw, Dm, Dn, Do, Dp, Dq, Dr, Ds, Dt, Du, Dv, Dw, Em, En, Eo, Ep, Eq, Er, Es, Et, Eu, Ev, Ew, Fm, Fn, Fo, Fp, Fq, Fr, Fs, Ft, Fu, Fv, Fw, Gm, Gn, Go, Gp, Gq, Hr, Hs, Ht, Hu, Hv, Hw, Im, In, Io, Ip, Iq, Ir, Is, It, Iu, Iv and Iw.

[0273] The human myeloid cells (e.g., human macrophages) used for therapy of the present invention may also be characterized by their cytokine and / or enzyme secretion profiles in the culture medium. Alternatively or additionally, a typical feature of M1 macrophages may be, for example, the secretion of IL23A. In particular, the IL23A secretion of human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is as high as at least 3 times, for example at least 4 times, such as at least 5 times, 6 times, or even 8 times, compared to the IL23A secretion of otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0274] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, the secretion of IL18. In particular, the secretion of IL18 by human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is higher, for example, at least 3 times, for example, at least 4 times, such as at least 5 times, 6 times, or even 8 times, compared to the secretion of IL18 by otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0275] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, the secretion of IL15. In particular, the secretion of IL15 by human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is higher, for example, at least 2 times, for example, at least 3 times, for example, at least 4 times, compared to the secretion of IL15 by otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0276] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, downregulated secretion of RNASE 1. In particular, the secretion of RNASE 1 by human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is lower, for example, at least 3-fold, for example, at least 5-fold, such as at least 7-fold, 10-fold or even 30-fold, compared to the secretion of RNASE 1 by otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0277] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, down-regulated secretion of FCGBP. In particular, the secretion of FCGBP by human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is lower, for example, at least 3-fold, for example, at least 5-fold, such as at least 7-fold, 10-fold, or even 30-fold, compared to the secretion of FCGBP by otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0278] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, down-regulated secretion of CCL7. In particular, human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome may secrete CCL7 at least 3 times, for example at least 5 times, such as at least 7 times, 10 times, or even 20 times less than the secretion of CCL7 by otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0279] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, down-regulated secretion of IL10. In particular, IL10 secretion of human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is lower, for example, at least 3-fold, for example, at least 5-fold, such as at least 7-fold, 10-fold, or even 30-fold, compared to IL10 secretion of otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture conditions.

[0280] Therefore, another preferred typical feature of the human macrophages of the present invention is that the secretion of IL18 and / or IL23A is upregulated on the one hand, and the secretion of RNASE1 and / or FCGBP and / or IL10 and / or CCL7 is downregulated.

[0281] The human myeloid cells (e.g., human macrophages) used for therapy of the present invention can also be characterized by their cell surface markers. Alternatively or additionally, the typical characteristics of M1 macrophages may be, for example, the presence of the cell surface marker MHC II, or more specifically, the HLA class II proteins on the surface of the myeloid cells (e.g., human macrophages) of the present invention, such as proteins selected from the group consisting of HLA-DRA, HLA-DRB5, HLA-DPA1, HLA-DPB1, HLA-DQA1, and HLA-DQB1, in particular the presence of HLA-DRA. In particular, compared to the number of MHC II proteins accessible to the antigen on the cell surface of the otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under culture and immunostaining conditions, the number of MHC II proteins accessible to antibodies on the cell surface of human macrophages containing at least one mutation in both alleles of the gene located on the chromosome is as high as at least 3 times, for example, at least 4 times, such as at least 5 times, 8 times, or even 10 times.

[0282] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, the presence of the cell surface marker CD74. In particular, the amount of CD74 on the cell surface of human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is higher, for example, at least 3 times, for example, at least 4 times, such as at least 5 times, 6 times, or even 8 times, compared to the amount of CD74 on the cell surface of otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture and immunostaining conditions.

[0283] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, the presence of the cell surface marker CD70. In particular, the amount of CD70 on the cell surface of human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is higher, for example, at least 3 times, for example, at least 4 times, such as at least 5 times, 6 times, or even 8 times, compared to the amount of CD70 on the cell surface of otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture and immunostaining conditions.

[0284] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, the presence of the cell surface marker CD2. In particular, the amount of CD2 on the cell surface of a human myeloid cell (e.g., human macrophage) comprising at least one mutation in both alleles of a gene located on a chromosome is as high as at least 3 times, for example at least 4 times, such as at least 5 times, 6 times, or even 8 times, compared to the amount of CD2 on the cell surface of an otherwise identical wild-type myeloid cell (e.g., human macrophage) tested under otherwise equivalent culture and immunostaining conditions.

[0285] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, downregulation of the cell surface marker CD28. In particular, the number of CD28 on the cell surface of human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is lower, such as at least 2 times, for example at least 4 times, such as at least 6 times, 8 times, or even 10 times, compared to the number of CD28 on the cell surface of otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture and immunostaining conditions.

[0286] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, downregulation of the cell surface marker LYVE 1. In particular, the amount of LYVE 1 on the cell surface of human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is lower, for example, at least 2-fold, for example, at least 4-fold, such as at least 6-fold, 8-fold, or even 10-fold, compared to the amount of LYVE 1 on the cell surface of otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture and immunostaining conditions.

[0287] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, downregulation of the cell surface marker STAB 1. In particular, the amount of STAB 1 on the cell surface of human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is lower, for example, at least 2-fold, for example, at least 4-fold, such as at least 6-fold, 8-fold, or even 10-fold, compared to the amount of STAB 1 on the cell surface of otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture and immunostaining conditions.

[0288] Alternatively or additionally, a typical feature of M1 macrophages may be, for example, downregulation of the cell surface marker LILRB5. In particular, the amount of LILRB5 on the cell surface of human myeloid cells (e.g., human macrophages) comprising at least one mutation in both alleles of a gene located on a chromosome is lower, such as at least 2 times, such as at least 4 times, such as at least 6 times, 8 times, or even 10 times, compared to the amount of LILRB5 on the cell surface of otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture and immunostaining conditions. For the purposes of the present invention, the signal intensity in an immunostaining assay is considered to represent the amount of a cell surface marker of a particular type.

[0289] Alternatively or additionally, the typical characteristics of M1 macrophages can be, for example, the downregulation of cell surface marker CD163. In particular, compared with the number of CD163 on the cell surface of otherwise identical wild-type myeloid cells (e.g., human macrophages) tested under otherwise equivalent culture and immunostaining conditions, the number of CD163 on the cell surface of human myeloid cells (e.g., human macrophages) comprising at least one mutation in two alleles of a gene located on a chromosome is low such as at least 2 times, for example, at least 4 times, such as at least 6 times, 8 times, or even 10 times. For purposes of the present invention, the signal intensity in the immunostaining assay is considered to represent the number of cell surface markers of a particular type.

[0290] Particularly preferred human macrophages for use in therapy according to the invention are positive for at least one, preferably two, or even all three of the surface markers MHC II, CD70 and CD74, but negative for at least one, preferably two, such as three, four or even all five of the surface markers CD28, LYVE1, STAB1, CD163 and LILRB5.

[0291] Preferred combinations of surface markers: positive for HLA-DR and CD74, but negative for LYVE1; positive for HLA-DR and CD70, but negative for LYVE1; positive for HLA-DR and CD74, but negative for CD28; positive for HLA-DR and CD70, but negative for CD28; positive for HLA-DR and CD74, but negative for CD163; positive for HLA-DR and CD70, but negative for CD163; positive for HLA-DR and CD70, but negative for STAB1; positive for HLA-DR and CD74, but negative for STAB1; positive for HLA-DR and CD70, but negative for LILRB5; positive for HLA-DR and Positive for CD74, but negative for LILRB5; negative for LYVE1 and STAB1, but positive for HLA-DR; negative for LYVE1 and STAB1, but positive for CD70; negative for LYVE1 and STAB1, but positive for CD74; negative for LYVE1 and CD163, but positive for HLA-DR; negative for LYVE1 and CD163, but positive for CD70; negative for LYVE1 and CD163, but positive for CD74; negative for LYVE1 and LILRB5, but positive for HLA-DR; negative for LYVE1 and LILRB5, but positive for CD74; negative for LYVE1 and LILRB5, but positive for CD70.

[0292] The human myeloid cells (e.g., human macrophages) used for therapy of the present invention that contain at least one mutation in both alleles of a gene located on a chromosome can also be characterized by any of the above-mentioned gene expression markers, in particular the above-mentioned preferred gene expression markers and the above-mentioned secretion profile, in particular a combination of the above-mentioned preferred secretion profile.

[0293] The human myeloid cells (e.g., human macrophages) used for therapy of the present invention, which contain at least one mutation in both alleles of a gene located on a chromosome, can also be characterized by any one of the above-mentioned gene expression markers, in particular the above-mentioned preferred gene expression markers, in combination with the above-mentioned surface markers, in particular with the above-mentioned preferred surface marker spectrum.

[0294] The human myeloid cells (e.g., human macrophages) for use in therapy of the present invention that contain at least one mutation in both alleles of a gene located on a chromosome can also be characterized by any of the above-mentioned secretion profiles, in particular the above-mentioned preferred secretion profiles and the above-mentioned surface markers, in particular the above-mentioned preferred surface marker profiles in combination.

[0295] The human myeloid cells (e.g., human macrophages) used for therapy of the present invention, which contain at least one mutation in both alleles of a gene located on a chromosome, can also be characterized by any of the above-mentioned gene expression profiles, in particular the above-mentioned preferred gene expression profiles and the above-mentioned surface markers, in particular the above-mentioned preferred surface marker profiles, and the above-mentioned secretion profiles, in particular the above-mentioned preferred secretion profiles in combination.

[0296] The human myeloid cells (eg, human macrophages) used for therapy of the present invention contain at least one mutation in both alleles of a gene located on a chromosome. The mutation may render the gene non-functional, and / or it may inhibit gene expression or even eliminate gene expression.

[0297] The mutation may be an insertion or a frameshift. However, a preferred mutation is a deletion, such as a deletion in a promoter, exon, or splice site. Although only a few base pairs of small deletions may have an impact on gene function, preferably, the deletion is at least 50 base pairs, such as at least 100 base pairs, at least 200 base pairs, at least 500 base pairs, or even at least 1000 base pairs.

[0298] Preferred human myeloid cells (eg, human macrophages) for use in therapy of the present invention comprise at least two different mutations, and preferably the two mutations are deletions in at least two different genes.

[0299] As explained above, the present invention preferably uses myeloid cells, such as human macrophages, for therapy of the present invention that contain at least one mutation in both alleles of a gene located on a chromosome, wherein the macrophages are resistant to M2 polarization induced by M-CSF. The present invention provides a new selectable phenotype for cells that contain at least one mutation in both alleles of a gene located on a chromosome, which can be screened for, and thus, it is possible to identify as yet unknown genes whose mutations make myeloid cells (such as human macrophages) resistant to M2 polarization induced by M-CSF. Therefore, the nature of the gene is not particularly limited, as long as the biallelic mutation of the gene produces the desired phenotype. However, the preferred human myeloid cells (such as human macrophages) for therapy of the present invention have biallelic mutations in genes that are involved in M-CSF, IL-4, IL-10 and / or TGFB1-mediated downregulation of C2TA, such as negative regulators of C2TA, particularly negative transcriptional regulators. Preferably, the gene may be selected from the group consisting of STAT6, IRF4, PPARg, MAFB, MAF, KLF4, C / EPBb, GATA3, JMJD3, SOCS2, SOCS1, TMEM106A and AKT1, particularly selected from the group consisting of STAT6, IRF4, TMEM106A, MAFB and MAF.

[0300] Preferred human myeloid cells (e.g., human macrophages) comprising at least one mutation in two alleles of a gene located on a chromosome are myeloid cells (e.g., human macrophages) in which the mutated gene is MAFB, wherein the myeloid cells (e.g., human macrophages) are resistant to M2 polarization induced by M-CSF. It is preferred that MAFB is the only transcription factor encoding gene comprising a biallelic deletion. Alternatively, it is preferred that MAFB is the only protein encoding gene comprising a biallelic deletion. Alternatively, it is preferred that MAFB is the only gene comprising a biallelic deletion. If other transcription factors except MAF and / or MAFB are missing, myeloid cell (e.g., human macrophage) function may be impaired, or it may be impossible for induced pluripotent stem cells to differentiate into macrophages. For example, Buchrieser et al. show that induced pluripotent stem cells with transcription factor RUNX1 or SPI1 missing cannot differentiate into iPSC-derived macrophages.

[0301] The preferred human myeloid cells (e.g., human macrophages) for therapy of the present invention can also be characterized by the nature and size of the deletion, wherein the mutated gene is MAFB. For example, all deletions can be in the exon portion of MAFB. For example, the deletion can be greater than 50 base pairs each, such as at least 100 base pairs each or at least 250 base pairs each. For example, the deletion of the MAFB gene or the deletion in the MAFB gene can be 100 base pairs to 10000 base pairs each, such as 500 base pairs to 3000 base pairs each, particularly 700 base pairs to 2000 base pairs. The preferred human myeloid cells (e.g., human macrophages) for therapy of the present invention can show one or more (e.g., all) of these deletions, wherein the mutated gene is MAFB.

[0302] Preferred human myeloid cells (e.g., human macrophages) for therapy of the present invention can also be characterized by the position of the deletion in a specific chromosome, wherein the mutated gene is MAFB. For example, MAFB deletion is preferably in a region from 40685000 to 40690000, such as from 40685200 to 40689800, such as from 40685400 to 40689600, such as from 40685600 to 40689400 and particularly from 40685700 to 40689300 on human chromosome 22.

[0303] The preferred human myeloid cell (e.g., human macrophage) comprising at least one mutation in the two alleles of the gene located on the chromosome is a myeloid cell (e.g., human macrophage) wherein the gene of the mutation is MAF, wherein the myeloid cell (e.g., human macrophage) is resistant to the M2 polarization induced by M-CSF. It is preferred that MAF is the only transcription factor encoding gene that comprises biallelic deletion. Alternatively, it is preferred that MAF is the only protein encoding gene that comprises biallelic deletion. Alternatively, it is preferred that MAF is the only gene that comprises biallelic deletion.

[0304] The preferred human myeloid cells (such as human macrophages) for therapy of the present invention can also be characterized by the nature and size of deletion, wherein the gene of the mutation is MAF. For example, all deletions can be in the exon part of MAF. For example, deletion can be greater than 50 base pairs each, such as at least 100 base pairs or at least 250 base pairs each. For example, the deletion of MAF gene or the deletion in MAF gene can be 100 base pairs to 10000 base pairs each, such as 500 base pairs to 3000 base pairs each, particularly 700 base pairs to 2000 base pairs. The preferred human myeloid cells (such as human macrophages) for therapy of the present invention can show one or more (such as all) in these deletions, wherein the gene of the mutation is MAF.

[0305] The preferred human myeloid cells (e.g., human macrophages) for therapy of the present invention can also be characterized by the position of deletion in a specific chromosome, wherein the mutated gene is MAF. For example, MAF deletion is preferably in a region from 79593000 to 79602000, such as from 79593200 to 79601500, for example from 79593400 to 79601100, and particularly from 79593600 to 79600900 on human chromosome 16.

[0306] Preferred human myeloid cells (e.g., human macrophages) containing at least one mutation in two alleles of a gene located on a chromosome are myeloid cells (e.g., human macrophages) in which two alleles of MAFB and two alleles of MAF are preferably rendered nonfunctional due to a deletion of at least 50 base pairs, wherein myeloid cells (e.g., human macrophages) are resistant to M2 polarization induced by M-CSF. The inventors found that inhibiting MAFB and MAF gene expression in human cells has surprisingly proven to be more difficult than in mouse cells, in part because genetic methods for double-deficient cells are not an option for human cells. Although the use of one guide RNA per gene in a CRISPR / Cas9-based method has provided many successful examples of inactivating gene expression of other genes in the past, such as Chu et al. (2016), several attempts to make both MAFB and MAF genes nonfunctional by using CRISPR / Cas9 methods and one guide RNA each for MAFB and MAF to create smaller deletions did not produce cells observed to expand in vitro. Surprisingly, each gene uses two guide RNAs to generate a larger deletion of at least 50 base pairs, successfully providing a phagocyte of proliferation. These cells have the additional advantage of non-tumorigenicity. Preferably MAF and MAFB are the only transcription factor encoding genes that comprise bi-allelic deletion. Alternatively, preferably MAF and MAFB are the only protein encoding genes that comprise bi-allelic deletion. Alternatively, preferably MAF and MAFB are the only genes that comprise bi-allelic deletion.

[0307] Preferred human myeloid cells (e.g., human macrophages) of the present invention can also be characterized by the nature and size of deletions, wherein two alleles of MAFB and two alleles of MAF become non-functional. For example, all deletions can be in the exon portion of the MAFB and MAF groups. For example, the deletion can be greater than 50 base pairs each, such as at least 100 base pairs each or at least 250 base pairs each. For example, the deletion of MAFB and MAF genes or the deletion in MAFB and MAF genes can be 100 base pairs to 10000 base pairs each, such as 500 base pairs to 3000 base pairs each, particularly 700 base pairs to 2000 base pairs. The human macrophages with stable M1 polarization of the present invention can show one or more of these deletions, such as all.

[0308] The preferred human myeloid cells (e.g., human macrophages) with stable M1 polarization of the present invention can also be characterized by the position of the deletion in a specific chromosome. For example, MAFB deletion is preferably in the region from 40685000 to 40690000 on human chromosome 22, such as from 40685200 to 40689800, for example from 40685400 to 40689600, such as from 40685600 to 40689400 and particularly from 40685700 to 40689300. For example, MAF deletion is preferably in the region from 79593000 to 79602000 on human chromosome 16, such as from 79593200 to 79601500, for example from 79593400 to 79601100, and particularly from 79593600 to 79600900.

[0309] The human myeloid cells (e.g., human macrophages) of the present invention can be prepared by cell manipulation, wherein the myeloid cells (e.g., human macrophages) are resistant to M-CSF-induced M2 polarization. The cells from which the human myeloid cells (e.g., human macrophages) of the present invention can be derived can be cells that are progenitor cells for developing human myeloid cells (e.g., human macrophages), such as cells selected from the group consisting of: iPS cells; blood monocytes; monocytes, monoblasts, myeloid or CD34+ multipotent progenitors from umbilical cord blood; monocytes, monoblasts, myeloid or CD34+ multipotent progenitors from bone marrow; mobilized monoblasts, myeloid or CD34+ multipotent progenitors from adult blood; and monocytes, monoblasts, myeloid or CD34+ progenitors from extramedullary hematopoiesis. The human myeloid cells (e.g., human macrophages) of the present invention can also be derived from macrophages, particularly relatively easy-to-obtain macrophages, such as alveolar macrophages or macrophages from adipose tissue, wherein the myeloid cells (e.g., human macrophages) are resistant to M-CSF-induced M2 polarization. The preferred cells from which the human macrophages of the present invention can be derived are human iPS cells. Another preferred cell from which the human myeloid cells (e.g., human macrophages) of the present invention can be derived is CMP (common myeloid progenitor cells). Another preferred cell from which the human myeloid cells (e.g., human macrophages) of the present invention can be derived is GMP (granulocyte / macrophage progenitor cells).

[0310] The preparation of human induced pluripotent stem cells is now well established in the art. Isogai et al. (2018) for example described the preparation of iPS cells from human blood monocytes. Fusaki N. et al. (2009) described the generation of human iPS cell lines using modified Sendai viruses. In particular, when human induced pluripotent stem cells are used as starting materials for differentiation of myeloid cells (e.g., human macrophages), it is preferred that MAF and / or MAFB are the only one or more transcription factor encoding genes comprising a biallelic deletion. Alternatively, it is preferred that MAF and / or MAFB are the only protein encoding genes comprising a biallelic deletion. Alternatively, it is preferred that MAF and / or MAFB are the only genes comprising a biallelic deletion. If other genes are missing, macrophage function may be impaired, or differentiation of induced pluripotent stem cells into macrophages may be impossible.

[0311] Human mononuclear phagocytes with biallelic mutations of the gene can also be derived from primary human blood monocytes, which can be obtained by leukocyte apheresis and elutriation; or derived from monocyte-derived macrophages, and their culture conditions are well known in the art. Human macrophages can also be obtained from bronchoalveolar lavage fluid, and by differentiating CD34+ hematopoietic stem cells and progenitor cells obtained from umbilical cord blood, peripheral blood mobilized by stem cells, or bone marrow using differentiation protocols well known in the art.

[0312] Cas9 and gRNA can be expressed by publicly available and commercially available DNA expression plasmids known in the art (e.g., SantaCruz Sc-418922, https: / / www.scbt.com / de / p / control-crispr-cas9-plasmid). DNA expression plasmids can be introduced into human mononuclear phagocyte target cells by electroporation or lipid-based transfection protocols known in the art. Cas9 and gRNA can also be introduced into target cells as ribonucleic acid / protein complexes by electroporation. Cas9 / gRNA-mediated gene editing has been demonstrated in mononuclear phagocytes (Zhang et al. (2020); Wang et al. (2018); Freund et al. (2020)) and human CD34+ hematopoietic stem cells and progenitor cells differentiated into macrophages (Scharenberg et al. (2020)) using such methods. Target genes such as MAFB and MAF genes can also be deleted using engineered site-directed recombinases (Lansing et al. (2020); Karpinski et al. (2016)), which can be introduced by methods known in the art such as electroporation of proteins, encoding mRNA or DNA expression plasmids, and used for gene editing in mononuclear phagocytes (Shi et al. (2018)).

[0313] Gonzalez F. et al. (2014) described an iCRISPR platform based on the introduction of a doxycycline-inducible Cas9 expression cassette into the AAVS1 locus for rapid, multiplexed and inducible genome editing in human pluripotent stem cells. This strategy can be used to introduce an inducible Cas9 expression cassette into a variety of self-generated or publicly available human iPS cell lines. Such modified cell lines can then be used to target selected genes, such as MAF and / or MAFB.

[0314] It has been found that human macrophages in which both MAF and MAFB have become non-functional are non-tumorigenic. Karyotyping shows that they contain 46 chromosomes, and none of those chromosomes show chromosomal rearrangements. These cells can therefore be used for macrophage-based cell therapy.

[0315] These markers were maintained even in the presence of tumor cells in vitro.

[0316] Stem cells are useful intermediates and / or starting materials for the preparation of allogeneic MHC II-matched myeloid cells for therapeutic uses of the present invention.

[0317] Therefore, the present invention also relates to an allogeneic human induced pluripotent stem cell or allogeneic human embryonic stem cell or allogeneic hematopoietic stem cell or allogeneic multipotent progenitor cell or allogeneic human common myeloid progenitor cell or allogeneic human granulocyte / macrophage progenitor cell, in particular a human induced pluripotent stem cell, wherein the allogeneic cells mentioned above, such as the allogeneic induced pluripotent stem cell, contain at least one MHC-II complex identical to any MHC-II complex of the human patient to be treated. Such an advantage is that the antigen-specific response of the CD4+T cells of the human patient can be elicited. The present invention also relates to an allogeneic stem cell or progenitor cell for preparing an MHC II matched allogeneic myeloid cell, such as an allogeneic induced pluripotent stem cell, which MHC II matched allogeneic myeloid cell comprises at least one protein complex selected from the group consisting of HLA-DR, HLA-DP and HLA-DQ, which protein complex is identical to any corresponding HLA complex of the human patient, preferably wherein the allogeneic myeloid cell (such as an allogeneic macrophage) comprises two protein complexes selected from said group, or even wherein the allogeneic myeloid cell (such as an allogeneic macrophage) comprises three complexes selected from said group. The present invention also relates to an allogeneic stem cell or progenitor cell for preparing MHC II matched allogeneic myeloid cells, allogeneic myeloid cells (such as allogeneic macrophages), such as allogeneic induced pluripotent stem cells, wherein the allogeneic myeloid cells are used to treat cancer in a human patient, wherein the allogeneic myeloid cells (such as allogeneic macrophages) comprise at least one HLA-DR protein complex that is identical to any corresponding HLA-DR complex of the human patient.

[0318] The present invention also relates to the use of the human induced pluripotent stem cells or human embryonic stem cells or human common myeloid progenitor cells or human granulocyte / macrophage progenitor cells of the present invention, in particular human induced pluripotent stem cells, for producing human MHC II-matched antigen-presenting cells, in particular for producing human MHC II-matched myeloid antigen-presenting cells such as macrophages or dendritic cells.

[0319] The present invention further relates to the following embodiments:

[0320] 1. An allogeneic human myeloid cell for therapeutic use in a human patient, wherein the allogeneic myeloid cell comprises at least one MHC-II complex that is identical to any MHC-II complex of the human patient.

[0321] 2. The allogeneic human myeloid cells for therapeutic use according to 1, wherein the therapeutic use is to treat cancer.

[0322] 3. The allogeneic human myeloid cell for therapeutic use according to any one of 1 or 2, wherein the myeloid cell is a macrophage, a dendritic cell or a monocyte.

[0323] 4. The allogeneic human myeloid cells for treating cancer in a human patient according to 2, wherein the allogeneic myeloid cells are allogeneic macrophages, and wherein the allogeneic macrophages comprise at least one MHC-II complex that is identical to any MHC-II complex of the human patient.

[0324] 5. The allogeneic human myeloid cells for therapeutic use according to any one of 1 to 4, wherein the allogeneic myeloid cells comprise at least one protein complex selected from the group consisting of HLA-DR, HLA-DP and HLA-DQ, which is identical to any corresponding HLA complex of the human patient.

[0325] 6. The allogeneic human myeloid cells for therapeutic use according to any one of 1 to 5, wherein the allogeneic myeloid cells comprise two protein complexes selected from said group, preferably wherein the allogeneic macrophages comprise three complexes selected from said group.

[0326] 7. The allogeneic human myeloid cell for therapeutic use according to any one of 1 to 6, wherein the allogeneic myeloid cell comprises at least one HLA-DR protein complex that is identical to any corresponding HLA-DR complex of the human patient.

[0327] 8. The allogeneic human myeloid cell for therapeutic use according to any one of 1 to 7, wherein the allogeneic myeloid cell comprises at least one HLA-DP protein complex that is identical to any corresponding HLA-DP complex of the human patient.

[0328] 9. The allogeneic human myeloid cells for therapeutic use according to any one of 1 to 8, wherein the allogeneic macrophages comprise at least one HLA-DQ protein complex that is identical to any corresponding HLA-DQ complex of the human patient.

[0329] 10. An allogeneic human myeloid cell for therapeutic use in a patient, wherein the allogeneic myeloid cell and the patient to be treated have at least one pair of common alleles, and the at least one pair of common alleles is selected from the group consisting of the following pairs: HLA-DRA / HLA-DRB1, HLA-DRA / HLA-DRB3, HLA-DRA / HLA-DRB4, HLA-DRA / HLA-DRB5, HLA-DPA1 / HLA-DPB1 and HLA-DQA1 / HLA-DQB1.

[0330] 11. The allogeneic human myeloid cells for therapeutic use according to 10, wherein the therapeutic use is to treat cancer.

[0331] 12. Allogeneic human myeloid cells for therapeutic use according to 11, wherein the cancer is a solid tumor.

[0332] 13. The allogeneic human myeloid cell for therapeutic use according to any one of 10 to 12, wherein the myeloid cell is a macrophage, a monocyte or a dendritic cell, in particular a macrophage.

[0333] 14. Allogeneic human myeloid cells for therapeutic use according to any one of 10 to 13, wherein the allogeneic myeloid cells and the patient to be treated have two, three, four, five or even all six pairs of common alleles.

[0334] 15. The allogeneic human myeloid cells for therapeutic use according to any one of 1 to 14, wherein the human myeloid cells, in particular the human macrophages, are resistant to M-CSF-induced M2 polarization.

[0335] 16. The allogeneic human myeloid cells for therapeutic use according to any one of 1 to 15, wherein the human myeloid cells, in particular the human macrophages, comprise typical features of M1 macrophages after exposure to 50 ng / ml M-CSF for 48 hours.

[0336] 17. The allogeneic human myeloid cells for therapeutic use according to any one of 1 to 16, wherein the human myeloid cells, in particular the human macrophages, wherein the human myeloid cells are genetically modified.

[0337] 18. The allogeneic human myeloid cells for therapeutic use according to 17, wherein the genetic modification is the introduction of a gene encoding a surface protein such as a chimeric antigen receptor.

[0338] 19. The allogeneic human myeloid cells for therapeutic use according to any one of 1 to 16, wherein the human macrophages are macrophages that have not been genetically modified.

[0339] 20. The allogeneic human myeloid cell for therapeutic use according to any one of 1 to 19, wherein the human myeloid cell is derived from an iPS cell.

[0340] 21. Allogeneic human myeloid cells, in particular allogeneic human macrophages, for therapeutic use according to any one of 1 to 20, wherein the allogeneic human myeloid cells, such as the allogeneic human macrophages, are myeloid cells according to any one of 22 to 114.

[0341] 22. A human myeloid cell, preferably a macrophage, comprising at least one mutation in both alleles of a gene located on a chromosome, wherein the macrophage is resistant to M-CSF-induced M2 polarization, preferably wherein the human macrophage is not a dendritic cell, and more preferably wherein the human macrophage is not a dendritic cell and is not a monocyte.

[0342] 23. The human myeloid cell, preferably macrophage, according to 22, wherein the myeloid cell, preferably the macrophage, is resistant to M2 polarization caused by a combination of M-CSF and IL-4.

[0343] 24. The human myeloid cell, preferably a macrophage, according to any one of 22 to 23, wherein the macrophage is resistant to M2 polarization caused by a combination of M-CSF and IL-4 and IL-13.

[0344] 25. The human myeloid cell, preferably a macrophage, according to any one of 22 to 24, wherein the myeloid cell comprises typical features of M1 macrophages after exposure to 50 ng / ml M-CSF for 24 hours.

[0345] 26. The human myeloid cell, preferably macrophage, according to 25, wherein the myeloid cell comprises typical features of M1 macrophages after exposure to 50 ng / ml M-CSF for 48 hours.

[0346] 27. The human myeloid cell, preferably a macrophage, according to any one of 22 to 26, wherein the myeloid cell comprises typical features of M1 macrophages after exposure to 20 ng / ml IL-4 for 24 hours.

[0347] 28. The human myeloid cell, preferably macrophage, according to 27, wherein the myeloid cell comprises typical features of M1 macrophages after exposure to 20 ng / ml IL-4 for 48 hours.

[0348] 29. The human myeloid cell, preferably a macrophage, according to any one of 22 to 28, wherein the myeloid cell comprises typical features of M1 macrophages after exposure to a combination of 40 ng / ml IL-4 and 50 ng / ml M-CSF for 24 hours.

[0349] 30. The human myeloid cell, preferably macrophage, according to 29, wherein the myeloid cell comprises typical features of M1 macrophages after exposure to a combination of 40 ng / ml IL-4 and 50 ng / ml M-CSF for 48 hours.

[0350] 31. The human myeloid cell, preferably a macrophage, according to any one of 22 to 30, wherein the myeloid cell comprises typical features of M1 macrophages, wherein GM-CSF is absent during the past 2 hours.

[0351] 32. The human myeloid cell, preferably macrophage, according to 31, wherein the myeloid cell comprises typical features of M1 macrophages, wherein GM-CSF is absent during the past 6 hours.

[0352] 33. The human myeloid cell, preferably a macrophage, according to any one of 25 to 32, wherein a typical feature of M1 macrophages is that the expression of at least one mRNA in the human myeloid cells comprising at least one mutation in both alleles of a gene located on a chromosome is increased by at least 4 times compared to the expression of the mRNA in otherwise identical wild-type myeloid cells, wherein the at least one mRNA is selected from the list consisting of HLA-DRA, HLA-DRB5, HLA-DPA1, HLA-DQA1, RXFP2, CD74, CD38, CD2, IL18 and IL23A.

[0353] 34. The human myeloid cells of 33, wherein the expression of at least one mRNA in the human myeloid cells comprising at least one mutation in both alleles of a gene located on a chromosome is at least 6 times higher than the expression of the same mRNA in otherwise identical wild-type myeloid cells.

[0354] 35. The human myeloid cells of any one of 25 to 32, wherein a typical feature of M1 macrophages is that the expression of at least three mRNAs in the human myeloid cells comprising at least one mutation in both alleles of a gene located on a chromosome is increased by at least 4-fold compared to the expression of the same at least three mRNAs in otherwise identical wild-type myeloid cells, wherein the at least three mRNAs are selected from the list consisting of HLA-DRA, HLA-DRB5, HLA-DPA1, HLA-DQA1, RXFP2, CD74, CD38, CD2, IL18 and IL23A.

[0355] 36. The human myeloid cells of 35, wherein the expression of at least three mRNAs in the human myeloid cells comprising at least one mutation in both alleles of a gene located on a chromosome is at least 6 times higher than the expression of the same at least three mRNAs in otherwise identical wild-type myeloid cells.

[0356] 37. The human myeloid cells of any one of 25 to 32, wherein a typical feature of M1 macrophages is that the expression of at least six mRNAs in the human myeloid cells comprising at least one mutation in both alleles of a gene located on a chromosome is increased by at least 4-fold compared to the expression of the same at least six mRNAs in otherwise identical wild-type myeloid cells, wherein the at least six mRNAs are selected from the list consisting of HLA-DRA, HLA-DRB5, HLA-DPA1, HLA-DQA1, RXFP2, CD74, CD38, CD2, IL18 and IL23A.

[0357] 38. The human myeloid cells of 37, wherein the expression of at least six mRNAs in the human myeloid cells comprising at least one mutation in both alleles of a gene located on a chromosome is at least 6 times higher than the expression of the same at least six mRNAs in otherwise identical wild-type myeloid cells.

[0358] 39. The human myeloid cells of any one of 33 to 38, wherein the expression of HLA-DRB5 mRNA in the human myeloid cells comprising at least one mutation in both alleles of a gene located on a chromosome is at least 4 times, such as at least 8 times, at least 16 times or even at least 32 times higher than the expression of HLA-DRB5 mRNA in otherwise identical wild-type myeloid cells.

[0359] 40. The human myeloid cell according to any one of 33 to 39, wherein the expression of HLA-DPA1 mRNA in the human myeloid cell comprising at least one mutation in both alleles of a gene located on a chromosome is at least 4 times higher, such as at least 8 times, at least 16 times or even at least 32 times higher than the expression of HLA-DPA1 mRNA in an otherwise identical wild-type myeloid cell.

[0360] 41. The human myeloid cell according to any one of 33 to 40, wherein the expression of HLA-DQA1 mRNA in the human myeloid cell comprising at least one mutation in both alleles of a gene located on a chromosome is at least 4 times, such as at least 8 times, at least 16 times or even at least 32 times higher than the expression of HLA-DQA1 mRNA in an otherwise identical wild-type myeloid cell.

[0361] 42. The human myeloid cell of any one of 33 to 41, wherein the expression of HLA-DRA mRNA in the human myeloid cell comprising at least one mutation in both alleles of a gene located on a chromosome is at least 4-fold, such as at least 8-fold, at least 16-fold or even at least 32-fold higher than the expression of HLA-DRA mRNA in an otherwise identical wild-type myeloid cell.

[0362] 43. The human myeloid cells of any one of 33 to 42, wherein a typical feature of M1 myeloid cells is the expression of the HLA-DRA gene, the HLA-DRB5 gene, the HLA-DPA1 gene, the HLA-DPB1 gene, the HLA-DQA1 gene and the HLA-DQB1 gene, and wherein the expression of each of the HLA-DRA gene, the HLA-DRB5 gene, the HLA-DPA1 gene, the HLA-DPB1 gene, the HLA-DQA1 gene and the HLA-DQB1 gene in the human myeloid cells comprising at least one mutation in both alleles of the gene located on a chromosome is at least 4 times, such as at least 8 times, at least 16 times or even at least 32 times, higher than the expression of the mRNA in otherwise identical wild-type myeloid cells.

[0363] 44. The human myeloid cell of any one of 31 to 43, wherein a typical feature of M1 macrophages is that the expression of at least one mRNA in the human myeloid cells comprising at least one mutation in both alleles of a gene located on a chromosome is reduced by at least 10-fold compared to the expression of the mRNA in otherwise identical wild-type myeloid cells, wherein the at least one mRNA is selected from the list consisting of RNASE1, CD28, LYVE1, FCGBP, F13A1, QPCT, CCL7 and RNF128.

[0364] 45. Human myeloid cells according to 44, wherein the expression of at least one mRNA in the human myeloid cells comprising at least one mutation in both alleles of a gene located on a chromosome is at least 50 times lower than the expression of the same mRNA in otherwise identical wild-type myeloid cells.

[0365] 46. ​​The human myeloid cell according to any one of 31 to 45, wherein a typical feature of M1 macrophages is that the expression of at least three mRNAs in the human myeloid cells comprising at least one mutation in both alleles of a gene located on a chromosome is reduced by at least 10 times compared to the expression of the same at least three mRNAs in otherwise identical wild-type myeloid cells, wherein the at least three mRNAs are selected from the list consisting of RNASE1, CD28, LYVE1, FCGBP, F13A1, QPCT, CCL7 and RNF128.

[0366] 47. The human myeloid cells of 46, wherein the expression of at least three mRNAs in the human myeloid cells comprising at least one mutation in both alleles of a gene located on a chromosome is at least 50 times lower than the expression of the same at least three mRNAs in otherwise identical wild-type myeloid cells.

[0367] 48. The human myeloid cells of any one of 31 to 47, wherein a typical feature of M1 macrophages is that the expression of at least six mRNAs in the human myeloid cells comprising at least one mutation in both alleles of a gene located on a chromosome is reduced by at least 10-fold compared to the expression of the same at least six mRNAs in otherwise identical wild-type myeloid cells, wherein the at least six mRNAs are selected from the list consisting of RNASE1, CD28, LYVE1, FCGBP, F13A1, QPCT, CCL7 and RNF128.

[0368] 49. The human myeloid cell according to any one of 31 to 48, wherein the typical feature of M1 macrophages is down-regulated secretion of RNASE1.

[0369] 50. The human myeloid cell according to any one of 31 to 49, wherein the typical feature of M1 macrophages is down-regulated secretion of FCGBP.

[0370] 51. The human myeloid cell of any one of 22 to 50, wherein the myeloid cell is positive for the surface marker HLA-DRA.

[0371] 52. The human myeloid cell according to any one of 22 to 51, wherein the myeloid cell is positive for the surface marker HLA-DPAl.

[0372] 53. The human myeloid cell according to any one of 22 to 52, wherein the myeloid cell is positive for the surface marker HLA-DQA1.

[0373] 54. The human myeloid cell of any one of 22 to 53, wherein the myeloid cell is positive for the surface marker HLA-DRB5.

[0374] 55. The human myeloid cell of any one of 22 to 54, wherein the myeloid cell is positive for the surface marker CD74.

[0375] 56. The human myeloid cell of any one of 22 to 55, wherein the myeloid cell is positive for the surface marker CD2.

[0376] 57. The human myeloid cell of any one of 22 to 56, wherein the myeloid cell is negative for the surface marker CD28.

[0377] 58. The human myeloid cell according to any one of 22 to 57, wherein the myeloid cell is negative for the surface marker LYVE1.

[0378] 59. The human myeloid cell according to any one of 22 to 58, wherein the myeloid cell is negative for the surface marker STAB1.

[0379] 60. The human myeloid cell of any one of 22 to 59, wherein the myeloid cell is negative for the surface marker LILRB5.

[0380] 61. The human myeloid cell according to any one of 22 to 60, wherein the myeloid cell is positive for the surface marker HLA-DR but negative for the surface markers CD28 and LYVE1.

[0381] 62. The human myeloid cell according to any one of 22 to 61, wherein the myeloid cell is positive for the surface markers HLA-DR and CD74, but negative for the surface markers CD28, LYVE1, STAB1 and LILRB5.

[0382] 63. A human myeloid cell according to any one of 22 to 62, wherein the mutation renders the gene non-functional.

[0383] 64. A human myeloid cell according to any one of 22 to 62, wherein the mutation inhibits gene expression.

[0384] 65. A human myeloid cell according to any one of 22 to 62, wherein the mutation eliminates gene expression.

[0385] 66. A human myeloid cell according to any one of 22 to 65, wherein the mutation is a deletion.

[0386] 67. The human myeloid cell of 66, wherein the deletion is within a promoter, exon or splice site.

[0387] 68. The human myeloid cell of any one of 66 to 67, wherein the deletion is a deletion of at least 50 base pairs.

[0388] 69. The human myeloid cell according to 22 to 68, comprising at least two different mutations.

[0389] 70. The human myeloid cell of 69, wherein the two mutations are deletions within at least two different genes.

[0390] 71. The human myeloid cell according to any one of 22 to 70, wherein the gene is a gene involved in M-CSF, IL-4, IL-10 and / or TGFB1-mediated downregulation of C2TA.

[0391] 72. A human myeloid cell according to any one of 22 to 71, wherein the gene is selected from the group consisting of STAT6, IRF4, PPARγ, MAFB, MAF, KLF4, C / EPBβ, GATA3, JMJD3, SOCS2, SOCS1 and AKT1.

[0392] 73. A human myeloid cell according to any one of 22 to 72, wherein the gene encodes a negative regulator of C2TA transcription.

[0393] 74. A human myeloid cell according to any one of 1 to 73, wherein the gene is MAFB.

[0394] 75. The human myeloid cell of 74, wherein the mutation is a mutation within the region from 40685000 to 40690000 on human chromosome 22.

[0395] 76. The human myeloid cell according to 75, wherein the mutation is a mutation in the region from 40685200 to 40689800, for example from 40685400 to 40689600, such as from 40685600 to 40689400 and in particular from 40685700 to 40689300 on human chromosome 22.

[0396] 77. The human myeloid cell of any one of 74 to 76, wherein MAFB is rendered non-functional due to a deletion of at least 50 base pairs.

[0397] 78. The human myeloid cell of any one of 77, wherein the deletion is a deletion of at least 100 base pairs.

[0398] 79. The human myeloid cell of any one of 77 to 78, wherein the deletion is a deletion of at least 250 base pairs.

[0399] 80. The human myeloid cell of any one of 77 to 79, wherein the deletion is a deletion of 100 base pairs to 10,000 base pairs.

[0400] 81. The human myeloid cell of 80, wherein the deletion is from 500 base pairs to 3000 base pairs, such as from 600 base pairs to 1500 base pairs.

[0401] 82. The human myeloid cell of any one of 74 to 81, further comprising a mutation in the gene MAF.

[0402] 83. The human myeloid cell of 82, wherein the mutation in MAF is a deletion.

[0403] 84. A human myeloid cell according to any one of 1 to 73, wherein the gene is MAF.

[0404] 85. The human myeloid cell of 84, wherein the mutation is a mutation within the region from 79593000 to 79602000 on human chromosome 16.

[0405] 86. The human myeloid cell according to 85, wherein the mutation is a mutation in the region from 79593200 to 79601500, for example from 79593400 to 79601100, and in particular from 79593600 to 79600900 on human chromosome 16.

[0406] 87. The human myeloid cell of any one of 84 to 86, wherein MAF becomes non-functional due to a deletion of at least 50 base pairs.

[0407] 88. The human myeloid cell of 87, wherein the deletion is a deletion of at least 100 base pairs.

[0408] 89. The human myeloid cell of any one of 87 to 88, wherein the deletion is a deletion of at least 250 base pairs.

[0409] 90. The human myeloid cell of any one of 88 to 89, wherein the deletion is a deletion of 100 base pairs to 10,000 base pairs.

[0410] 91. The human myeloid cell of 90, wherein the deletion is from 500 base pairs to 3000 base pairs, such as from 600 base pairs to 1500 base pairs.

[0411] 92. A human myeloid cell according to any one of 84 to 91, further comprising a mutation in the gene MAFB.

[0412] 93. The human myeloid cell of 92, wherein the mutation in MAFB is a deletion.

[0413] 94. The human myeloid cell of 69, wherein the two genes are MAFB and MAF.

[0414] 95. The human myeloid cell of 94, wherein both alleles of MAFB and both alleles of MAF are rendered non-functional due to a deletion of at least 50 base pairs.

[0415] 96. The human myeloid cell of 95, wherein all deletions comprise exonic DNA.

[0416] 97. A human myeloid cell according to any one of 94 to 96, wherein each of the deletions is at least 100 base pairs.

[0417] 98. A human myeloid cell according to any one of 94 to 96, wherein each of the deletions is at least 250 base pairs.

[0418] 99. A human myeloid cell according to any one of 94 to 98, wherein each of the deletions is 100 base pairs to 10,000 base pairs.

[0419] 100. The human myeloid cell of any one of 94 to 99, wherein the deletion is 500 base pairs to 3000 base pairs, such as 600 base pairs to 1500 base pairs.

[0420] 101. A human myeloid cell according to any one of 94 to 100, wherein the MAFB deficiency is within the region from 40685000 to 40690000 on human chromosome 22.

[0421] 102. The human myeloid cell of 101, wherein the MAFB deletion is within the region from 40685200 to 40689800, for example from 40685400 to 40689600, such as from 40685600 to 40689400 and in particular from 40685700 to 40689300 on human chromosome 22.

[0422] 103. The human myeloid cell of any one of 94 to 102, wherein the MAF deficiency is within the region from 79593000 to 79602000 on human chromosome 16.

[0423] 104. The human myeloid cell according to 103, wherein the MAF deletion is within the region from 79593200 to 79601500, for example from 79593400 to 79601100, and in particular from 79593600 to 79600900 on human chromosome 16.

[0424] 105. The human myeloid cell of any one of 1 to 104, wherein the myeloid cell is non-tumorogenic.

[0425] 106. A human myeloid cell according to any one of 1 to 105, wherein the myeloid cell has 46 chromosomes.

[0426] 107. The human myeloid cell of any one of 1 to 106, wherein the myeloid cell does not contain a chromosome with a chromosomal rearrangement.

[0427] 108. The human myeloid cell according to any one of 1 to 107, wherein the myeloid cell maintains expression of at least two, such as at least four, M1 phenotypic markers in the presence of tumor cells in vitro.

[0428] 109. A human myeloid cell according to any one of 1 to 108, wherein the gene located on the chromosome that contains a biallelic deletion is the only gene that contains a biallelic deletion.

[0429] 110. The human myeloid cell of any one of 1 to 109, wherein the gene located on the chromosome comprising a biallelic deletion is the only protein-coding gene comprising a biallelic deletion.

[0430] 111. The human myeloid cell according to any one of 1 to 110, wherein the gene located on the chromosome comprising a biallelic deletion is a transcription factor encoding gene comprising a biallelic deletion.

[0431] 112. A human myeloid cell according to any one of 1 to 111, wherein MAF and / or MAFB are the only one or more transcription factor encoding genes comprising a biallelic deletion.

[0432] 113. A human myeloid cell according to any one of 1 to 112, wherein MAF and / or MAFB are the only one or more protein-coding genes comprising a biallelic deletion.

[0433] 114. A human myeloid cell according to any one of 1 to 113, wherein MAF and / or MAFB are the only gene or genes comprising a biallelic deletion.

[0434] Unless otherwise indicated, the practice of the present invention adopts conventional techniques of molecular biology (including recombinant technology), microbiology, cell biology, biochemistry and immunology, which are fully within the capabilities of the technician. These techniques are fully explained in the literature, such as "Molecular Cloning: A Laboratory Manual", Fourth Edition (Sambrook, 2012); "Handbook of Experimental Immunology" (Weir, 1997); "Short Protocols in Molecular Biology" (Ausubel, 2002); "Polymerase Chain Reaction: Principles, Applications and Troubleshooting", (Babar, 2011); "Current Protocols in Immunology" (Coligan, 2002). These techniques can be considered when formulating and implementing the present invention.

[0435] Those skilled in the art will appreciate that, in addition to those specifically described, the invention described herein is susceptible to variations and modifications. It should be understood that the invention includes all such variations and modifications without departing from its spirit or essential characteristics. The invention also includes all steps, features, compositions and compounds mentioned or indicated individually or jointly in this specification, as well as any and all combinations or any two or more of the steps or features. Therefore, the present disclosure is considered to be illustrative and not restrictive in all aspects, the scope of the invention is specified by the appended claims, and all changes falling within the meaning and scope of equivalents are intended to be included therein.

[0436] Various references are cited throughout this specification, each of which is incorporated herein by reference in its entirety.

[0437] The foregoing description will be more fully understood by reference to the following examples. However, such examples are exemplary methods of practicing the invention and are not intended to limit the scope of the invention. Example

[0438] Aziz et al., 2009 showed that the combined deficiency of MafB and c-Maf does not affect hematopoiesis in mice, as all lineages can be generated, including monocytes and macrophages (Aziz et al., 2009). On the contrary, it is able to expand the proliferation of mature mouse macrophages without losing the differentiated phenotype or function (Aziz et al., 2009).

[0439] We studied the role of Maf-DKO macrophages in ID8 ovarian or B16 melanoma models. To this end, we treated tumor-bearing mice with Maf-DKO mouse macrophages, and we showed that mouse Maf-DKO macrophages inhibited the growth of both initial and established tumors. In addition, our in vitro results show that Maf-DKO macrophages have an M1-like phenotype and are not repolarized to an M2-like phenotype by typical M2 stimulation. Importantly, tumor cells also do not repolarize mouse Maf-DKO macrophages.

[0440] We then generated human MAF / MAFB DKO macrophages. In vitro experiments confirmed that, like mouse Maf-DKO macrophages, they have a stable M1-like phenotype and will not be repolarized to an M2-like phenotype by typical M2 stimulation or tumor cells. As far as we know, MAF / MAFB DKO macrophages are the first examples of human macrophages, and they are resistant to tumor-induced repolarization due to the functional inactivation mutation of two alleles of chromosomal genes. More generally, this indicates that the human macrophages in a stable anti-tumor polarization state due to the functional inactivation mutation of two alleles of the chromosomal gene required for M2 induction can be used for cell therapy, such as tumor cell therapy.

[0441] Mouse MafB / c-Maf DKO macrophages

[0442] Materials and methods

[0443] Mice: Female mice (C57BL / 6 or Rag2γc knockout) aged 6 to 8 weeks were used for all experiments. Mice were housed under specific pathogen-free conditions and handled according to French and European directives of CIML (Centre d'Immunologie de Marseille Luminy).

[0444] Cell lines: Mouse ovarian cancer cell line ID8 and B16 melanoma cell line were cultured in DMEM medium supplemented with 10% fetal calf serum (FCS), 1% penicillin and streptomycin at 37°C and 5% CO2. Cells were passaged twice a week using trypsin.

[0445] Generation of mouse macrophages: Mouse macrophages were derived from the bone marrow of wild-type or Maf double knockout mice and cultured for 10-12 days in DMEM medium supplemented with 10% FBS, 10-50 ng / ml rMCSF or 20% M-CSF L929 cell-conditioned IMDM / 0.5FCS medium (LCM), 2 mM glutamine, 1% sodium pyruvate and 50 ug / ml penicillin / streptomycin at 37°C and 5% CO2. Maf-DKO primary cell lines (sorted from blood (Aziz et al., 2009)) were passaged every 4 days, and part of the medium was replaced every 2 days.

[0446] Macrophages were adopted into tumor-bearing mice: 6-8 week old C57BL / 6 female mice were injected ip with 5×10 6 ID8-Luc cells. Mice were treated with macrophages immediately or tumors were allowed to establish for 14 days before macrophage transfer. 5 × 10 6 WT or Maf-DKO macrophages were transferred into mice ip, and the transfer was repeated four times for immediate or delayed treatment on days 0, 2, 4, and 6 or 14, 16, 18, and 20. To assess tumor progression, ID8 cells were counted by flow cytometry on day 27 after scarifying mice, and luciferase activity was measured in cell lysates.

[0447] Place 1 × 10 in 100 μl of PBS 5 B16-F10 (or B16-Luc) cells were injected iv into the eye. As before, 1×10 6 Macrophage-treated mice were treated with 1000 macrophages. The macrophage treatment was repeated 4 times in a row. Mice were sacrificed on day 14 after tumor injection, and the lungs and livers were removed. The number of metastatic colonies visible on the surface of the lungs and liver was counted.

[0448] Bioluminescence imaging: Bioluminescence imaging was performed based on Berthold Night-Owl technology. Mice were injected ip with luciferin solution (3 mg per mouse) and imaged until peak radiance was achieved (10 min). Total flux values ​​were obtained for the anatomical region of interest. Data are expressed as relative light units (RLU) / s / mm of photon emission. 2 Images were taken of tumor development kinetics from day 0 to day 27 (for ID8 model) or day 14 (for B16 model).

[0449] Luciferase assay: Luciferase assay was performed using a luciferase assay system (TB281) from Promega. Briefly, cells were washed with 1X PBS and lysed in 20 μl of the provided lysis buffer. Cells were then resuspended in 100 μl of luciferase assay reagent and the light produced was measured by a luminometer.

[0450] Isolation of cells from the peritoneal cavity: After sacrifice, cells from the peritoneal cavity effluent were obtained by washing the cavity with 10 ml PBS. Red blood cells were removed by incubation with red blood cell lysis buffer for 5 minutes at RT. The cellular content of the cavity was evaluated by using multicolor flow cytometry. Gene expression of the total population was evaluated by qPCR.

[0451] Flow cytometry analysis: Cell suspensions were resuspended in FACS buffer (PBS 1X containing 2 mM EDTA and 0.5% FCS). All samples were blocked with 1:100 CD16 / 32 (2.4G2 BD PharMingen) and then surface stained on ice with CD45, CD11b (M1 / 70), F4 / 80, CD3e, Ly6G (1A8), NK1.1, CD19, CD8α, and MHCII antibodies. Absolute cell counts were performed by adding 20 μl of calibrated microbead suspension to each sample before collection. Flow cytometric analysis and cell sorting were performed on LSRII and FACSAria (Becton Dickinson).

[0452] M1 / M2 in vitro stimulation: 200,000 WT BMDM or Maf-DKO macrophages were incubated in DMEM medium containing 20 ng / ml mouse recombinant M-CSF. Cells were then stimulated with 100 ng / ml LPS (8 hours) or 100 ng / ml IFNγ (8 hours) or with 20 ng / ml IL-4 (24 hours). Macrophage stimulation occurred in the presence or absence of 50% supernatant from ID8 conditioned medium. ID8 conditioned medium was harvested after 72 hours of culture. After the specified time points, supernatants were harvested to evaluate cytokine production by CBA, and cells were lysed by RLT to evaluate gene expression by QPCR. The conditions are summarized in the following table:

[0453] condition Stimulate Analysis time 1 0.5:0.5 ratio of ID8-SN: medium + 20ng / ml M-CSF 24h 2 0.5:0.5 ratio of ID8-SN: medium + 20ng / ml M-CSF + 20ng / ml IL-4 24h 3 0.5:0.5 ratio of ID8-SN: medium + 20ng / ml M-CSF + 100ng / ml LPS 8h 4 0.5:0.5 ratio of ID8-SN: medium + 20ng / ml M-CSF + 100ng / ml IFNg 8h 5 Medium + 20ng / ml M-CSF 24h 6 Culture medium + 20ng / ml M-CSF + 20ng / ml IL-4 24h 7 Culture medium + 20ng / ml M-CSF + 100ng / ml LPS 8h 8 Culture medium + 20ng / ml M-CSF + 100ng / ml IFNg 8h

[0454] RNA extraction and reverse transcription: At the time points mentioned above, the total peritoneal cell population, sorted CD11b+CD45+Lin- macrophages or macrophages stimulated in vitro were harvested. The cells were washed with PBS and lysed in RLT buffer containing β-ME. RNA was extracted using the Qiagen RNeasy Mini kit (Qiagen Biotech) according to the manufacturer's instructions. The RNA amount was measured by nanodrop.

[0455] 500ng of RNA from each sample was used for reverse transcription. In sterile nuclease-free water, 1μl of oligodt (500μg / ml), 1μl of dNTP mixture (10mM each) were added to a final volume of 12μl. The mixture was heated to 65°C to denature the RNA, and rapidly cooled to maintain the denatured form. After a brief centrifugation, 4μl of first-chain buffer (5x), 2μl of 0.1M DTT and 1μl of RNaseOut (40 units / μl) from Invitrogen were added. The mixture was incubated at 42°C for 2 minutes, and then 1μl of Super-ScriptII reverse transcriptase (200 units) from Invitrogen was added. Then, the mixture was incubated at 42°C for 50 minutes. The reverse transcriptase was heat-inactivated at 70°C for 15 minutes.

[0456] Quantitative PCR: cDNA was diluted 1 in 10 and quantitative PCR was performed using 2 μl of diluted cDNA. QPCR was performed using SyberGreen (applied Biosciences) 2X master mix according to the manufacturer's instructions. The primers used for QPCR are listed in the table below.

[0457] CBA: Cytokine Bead Array: Cytokines were assayed using BD Biosciences "Mouse Inflammation CBA" kit Cat. No: 552364 and Canto II according to the manufacturer's instructions. Undiluted sample supernatants were assayed.

[0458] Statistical analysis: All experiments were performed in triplicate and representative data are shown. Results were tested for statistical significance using Student's t-test using GraphPad prism software.

[0459] result

[0460] Example 1

[0461] MafB and c-Maf double knockout macrophages inhibited initial tumor growth.

[0462] We have previously shown that MafB and c-Maf double knockout (Maf-DKO) mouse macrophages can be indefinitely expanded in vitro under M-CSF stimulation without loss of function or malignant transformation (Aziz et al., 2009). To evaluate the role of MafB and c-Maf in TAM biology, we examined the development of ID8 ovarian tumor cells in mice treated with Maf-DKO macrophages. We first studied the role of macrophages in the early stages of tumor establishment.

[0463] The ID8 mouse ovarian surface epithelial cell line is frequently used as a syngeneic mouse model of human ovarian cancer. ID8 cancer cells expressing firefly luciferase were injected i.p. into wild-type C57BL6 mice on day 0, and mice were then treated or left untreated with wild-type bone marrow-derived macrophages (WT) or Maf-DKO bone marrow-derived macrophages (BM-DKO) on days 0, 1, 2, and 3. Figure 1a ). Tumor progression was assessed in situ by bioluminescent imaging at the designated days between day 0 and day 27 after adoptive transfer (data not shown). Untreated tumor-bearing mice developed malignant ascites from day 4 to day 27, as assessed by the quantification of emitted photons. In the same manner, tumor-bearing mice treated with WT bone marrow-derived macrophages (WT-BMDM) developed into ID8 tumors during the experimental time course. In contrast, mice treated with bone marrow-derived Maf-DKO macrophages (DKO-BMDM) showed a significant reduction in tumor mass 27 days after tumor induction. Then, by lysing peritoneal cells and performing luciferase assays, we quantified the luciferase levels in ascites ( Figure 1b ). Luciferase levels were significantly reduced in the DKO-BMDM treated group (squares) compared to the WT treated or untreated groups (black dots). We then investigated the absolute number of tumor cell populations in the peritoneum of tumor-bearing mice. To this end, we performed flow cytometric analysis of peritoneal cells, as shown in Figure 2. Figure 1c As shown; ID8 cells SSC high and CD45 negative (CD45-). Quantification of tumor cell number shows that the number of ID8 cells in the peritoneum of untreated and WT treated mice increases, however, when mice are treated with DKO-BMDM macrophages, this number is significantly reduced. Therefore, Maf-DKO macrophages can reduce peritoneal tumor masses.

[0464] Example 2

[0465] MafB and c-Maf DKO macrophages induce regression of established tumors.

[0466] To evaluate the effect of Maf-DKO macrophages on advanced tumors, ID8-luciferase tumor cells were injected i.p. into C57BL6 mice on day 0 ( Figure 2a At day 14, these mice had malignant ascites and established tumors, as visualized by bioluminescence (data not shown). We then adoptively transferred WT-, DKO-BMDM or blood-DKO four times at 2-day intervals ( Figure 2a ). As before, at the designated days between day 0 and day 27, tumor progression was assessed by in situ bioluminescent imaging. The bioluminescent quantification of emitted photons showed that untreated tumor-bearing mice had a lot of peritoneal malignant ascites on day 27 (data not shown). Similarly, mice treated with WT-BMDM developed stronger peritoneal tumors on day 27 (data not shown). In contrast, mice treated with DKO macrophages showed a significant reduction in bioluminescent signals and therefore tumor masses on day 27 (data not shown). For further analysis, we sacrificed mice on day 27, and we quantified tumor masses by luciferase assay and flow cytometry. Luciferase levels were higher in peritoneal cells of untreated mice, and even slightly higher in mice treated with WT-BMDM ( Figure 2b , black dots), reflecting higher levels of peritoneal tumor mass. In contrast, mice treated with DKO macrophages showed reduced luciferase levels, reflecting reduced tumor mass ( Figure 2b , squares, right column). To confirm the reduction in tumor cell numbers, we analyzed the absolute number of ID8 cells in the peritoneal cavity by flow cytometry. As before, ID8 cells were identified as SSChi CD45- cells ( Figure 2c Untreated and WT-BMDM-treated mice showed a high proportion of ID8 cells ( Figure 2c , left panel); whereas Maf-DKO treated mice showed a significant decrease in the proportion of ID8 cells ( Figure 2c , right panel). These data indicate that Maf-DKO macrophages are even able to fight and reduce established tumor masses.

[0467] Example 3

[0468] The cellular composition of ascites.

[0469] In general, tumors are composed of a variety of immune cells that contribute to the tumor stroma of the growing malignancy (Kerkar and Restifo, 2012). To determine whether leukocyte subsets (such as T cells, NK cells, etc.) are recruited during tumor development, we performed flow cytometric analysis of the ascites of tumor-bearing mice on day 27. Peritoneal washings were recovered and the cells were stained with a cocktail of antibodies against NK cells, CD8 T cells, granulocytes, and macrophages, which are the most representative cells in the tumor stroma (Kerkar and Restifo, 2012).

[0470] Initially, on day 21 after tumor initiation and using an established tumor strategy ( Figure 2a ), in addition to macrophages, we were able to detect NK cells and T cells (such as CD8 T cells) in the peritoneal leukocyte fraction, as Figure 3a When mice were treated with macrophages immediately as in Example 1, those cell populations were not detected (data not shown). We observed that in untreated or WT-BMDM treated mice ( Figure 3b , dots and triangles) showed little CD8 T cell infiltration in the peritoneum. However, mice treated with Maf-DKO macrophages showed a significant increase in the CD8 T cell population ( Figure 3b , rectangle). In addition, we observed that Maf-DKO treated mice had more NK cell recruitment compared with untreated or WT-BMDM treated mice. These results suggest that CD8 T cells and NK cells may be involved in the Maf-DKO macrophage-mediated reduction of tumor mass.

[0471] Next, we examined the peritoneal macrophage population based on CD11b and F4 / 80 markers ( Figure 3c ). We saw that the peritoneal cavity of untreated, WT-BMDM-treated, and Maf-DKO-treated mice was filled with macrophages, but we did not detect differences in the proportion of macrophages among the three groups (data not shown). Therefore, based on previously published studies suggesting that the levels of MHCII in macrophage populations may vary - higher in tumor-suppressive macrophages and lower in tumor-promoting macrophages (Wang et al., 2011); we hypothesized that the activation state of macrophage populations may differ, which may explain our previous results of reduced tumor mass in Maf-DKO-treated mice. To test this hypothesis, we stained peritoneal cells with different macrophage activation markers (CD80, CD86, CD69, and MHCII). We observed that all macrophages from Maf-DKO-treated mice were MHCII+ ( Figure 3d , rectangle), whereas only a small fraction of macrophages from untreated or WT-BMDM-treated mice were MHCII+ ( Figure 3d , dots and triangles). In addition, the mean fluorescence intensity of MHCII+ in macrophages from mice treated with Maf-DKO macrophages was higher compared with that in MHCII+ macrophages from untreated or WT-BMDM-treated mice with low MHCII ( Figure 3e), indicating that Maf-DKO macrophages are MHCII high. Our data indicate that MHCII hi TAMs are associated with tumor suppression (in the case of Maf-DKO macrophages), while MHCIIlo macrophages are associated with tumor promotion (in the case of WT macrophages).

[0472] Example 4

[0473] MafB and c-Maf deficiency leads to classical macrophage activation in vivo.

[0474] Pro-inflammatory and anti-inflammatory cytokines produced by tumor-infiltrating leukocytes play a crucial role in the regulation of immune responses to tumors (Balkwill and Mantovani, 2001). Classically activated macrophages (M1) display a cytotoxic pro-inflammatory phenotype (high IL-12, IL-6, IFNγ, NOS2), while alternatively activated macrophages (M2) suppress immune and pro-inflammatory responses by increasing the production of IL-10 or arginase (O'Shea and Murray, 2008)(Gordon, 2003)(Murray and Wynn, 2011)(Mantovani et al., 2002). To analyze macrophage phenotypes in vivo, we sorted peritoneal macrophages (CD11b+Lin-) from tumor-bearing mice (which had been treated as before). The mRNA levels of NOS2, C2TA (MHC II transactivator protein), IL-6, IL-12, and IL-10 were measured by real-time RTPCR.

[0475] CD11b+ cells from Maf-DKO treated mice (Fig. 4, striped) but not WT treated or untreated control mice (dotted and black, respectively) showed significantly increased NOS2, CIITA, and IL-6 mRNA levels and IL-12 mRNA ( Figure 4a -d). In contrast, CD11b+ sorted macrophages from WT treated mice showed high IL-10 expression compared to Maf-DKO CD11b+ ( Figure 4e ). Together, these results show that Maf-DKO macrophages appear to be refractory to tumor cells in vivo reprogramming to an M2 phenotype.

[0476] Example 5

[0477] Maf-DKO macrophages displayed enhanced classical M1 activation in vitro.

[0478] Our in vivo results on macrophage phenotypes indicate that Maf-DKO macrophages are most likely similar to M1 macrophages in tumor-bearing mice. To further characterize Maf-DKO macrophages, we performed in vitro experiments in which macrophages (WT or Maf-DKO) were stimulated with known M1 stimuli (LPS, IFNγ) or M2 stimuli (IL-4). Cells were then lysed to measure gene expression by real-time QPCR.

[0479] As expected, IL-6 expression was detected upon LPS stimulation ( Figure 5a ), and IL-6 mRNA levels were significantly higher in Maf-DKO macrophages compared with WT ( Figure 5a 5 , note that DKO is dotted, while WT is striped). When compared to WT macrophages, the expression of C2TA (which is a positive regulator of MHCII genes, an M1 marker) was increased in Maf-DKO macrophages upon stimulation with IFNγ, LPS, and also to a lesser extent with IL-4 ( Figure 5b , dotted vs. striped), which is another indicator of the M1-like phenotype of Maf-DKO macrophages. NOS2 expression was also increased in Maf-DKO macrophages upon LPS or IFNγ stimulation compared with WT macrophages ( Figure 5c In contrast, when monitoring the expression of M2 genes, we observed that WT macrophages highly expressed IL-10 (upon IL-4 and LPS stimulation) ( Figure 5d ) and arginase (under IL-4 stimulation) ( Figure 5e ), but not in Maf-DKO macrophages. These results suggest that Maf-DKO macrophages are sensitive to M1 stimulation, similar to classically activated macrophages, but are less sensitive, if any, to M2 stimulation.

[0480] Example 6

[0481] Maf-DKO macrophages are difficult to be recultured with tumor cells in vitro.

[0482] We then investigated whether Maf-DKO macrophages could be cultured with tumors in vitro. To this end, we mimicked the in vivo environment by culturing WT or Maf-DKO macrophages in medium containing ID8 supernatant. We examined the production of inflammatory cytokines by CBA (see Materials and Methods). Both WT and Maf-DKO macrophages produced IL-6 ( Figure 6a In the presence of ID8 tumor cell supernatant, IL-6 production by WT macrophages dropped dramatically, whereas levels produced by Maf-DKO macrophages remained high under the same conditions ( Figure 6a, square bars). Similar to IL-6, we showed that both WT and Maf-DKO macrophages produced TNFα in the absence of ID8-SN ( Figure 6b However, in the presence of ID8-SN, Maf-DKO macrophages still produced higher amounts of TNFα, whereas WT macrophages showed a strong decrease in TNFα production ( Figure 6b , checkered bars). These results indicate that Maf-DKO macrophages are M1-like macrophages and that they are difficult and resistant to being reprogrammed by the tumor microenvironment, whereas WT macrophages can be reprogrammed by tumors.

[0483] Example 7

[0484] Maf-DKO macrophages inhibit melanoma development.

[0485] To address the antitumor activity of Maf-DKO macrophages in a second independent tumor model, we examined the effect of these macrophages on the development of B16 melanoma. We used B16 as an experimental metastasis model. B16 melanoma is a murine tumor cell line that has been explored as a model for studying metastasis and solid tumor formation. B16 tumor cells (1×10 5 The cells were transferred intravenously into C57BL6 mice via retro-orbital injection and developed tumors in the lungs. The mice were then injected with Maf-DKO macrophages, WT macrophages, or no injection. The mice were only injected after tumors were established ( Figure 7a ) were treated with different types of macrophages. On day 14, the mice were sacrificed and metastatic tumors appeared as black colonies 1 to 3 mm in diameter with a tendency to fuse with each other. We showed that B16 tumor cells led to the formation of numerous tumor nodules in the lungs of untreated mice ( Figure 7b , left column), as confirmed by tumor colony quantification ( Figure 7c Left panel). Compared with untreated control mice, Maf-DKO macrophages ( Figure 7b and c, right column) strongly reduced tumor formation and had a stronger effect than that in WT-treated mice ( Figure 7b and c, middle column). Thus, deficiency of MafB and c-Maf in macrophages leads to reduced lung metastasis.

[0486] Together, these data show that Maf-DKO macrophages are able to suppress tumor development in both preventive as well as therapeutic settings, independent of the tumor model.

[0487] Example 8

[0488] T cells, NK cells, and B cells are also involved in the defense against B16 melanoma.

[0489] To evaluate the potential contribution of other immune cells such as T cells, B cells, and NK cells to antitumor mechanisms, we used Rag2γc knockout mice that lack T cells, B cells, and NK cells. We injected 1 × 10 5 Mice were challenged with B16 tumor cells expressing firefly luciferase. Figure 8a ) or 7 days after tumor establishment ( Figure 8b ), we treated mice four times in a row with Maf-DKO, WT macrophages, or we did not treat them. We monitored tumor growth using bioluminescent imaging as well as tumor nodule quantification. At day 14, all mice developed tumors as confirmed by bioluminescent imaging. We found that tumors were located in the lungs and liver, and the number of metastatic colonies was increased in these two organs compared to our results for B16 development in WT mice (Example 7) (data only for liver are shown; Figure 8c We show strong infiltration of both lungs and livers of untreated and WT treated mice by B16 tumor cells (data for liver shown, c). Importantly, mice immediately treated with Maf-DKO macrophages exhibited a significant reduction in liver metastases compared to WT treated mice (left panel) or untreated mice (not shown). Figure 8c , right). This Maf-DKO-mediated tumor reduction was confirmed by quantification of metastatic nodules ( Figure 8e , with dotted bars). However, only a slight tumor reduction was observed in the lungs following treatment with both Maf-DKO and WT macrophages in mice with established tumors. In addition, no reduction in liver metastases was observed in this second group of mice ( Figure 8d , f), indicating that effector immune cells (NK, T and B cells) are involved in the anti-tumor effect of Maf-DKO. These data indicate that Maf-DKO macrophages have a direct effect of inhibiting tumor growth and metastasis in the early stages of tumor development, as well as an indirect effect of continuously inhibiting tumors by collaborating with other immune cells to achieve the above-mentioned therapeutic effects.

[0490] Discussion of Mouse Experiments

[0491] In this study, we provide evidence of the role of Maf-DKO macrophages in preventing tumor growth. We show that transferring Maf-DKO macrophages, but not WT macrophages, into tumor-bearing mice (ID8 ovarian cancer or B16 melanoma) resulted in a significant reduction in both initial and established tumor masses (Figures 1, 2 & 7) and an increase in mouse survival. In addition, the long-term maintenance of Maf-DKO macrophages in M-CSF (Maf-DKO cells obtained from blood and maintained in culture for an extended period of time showed antitumor activity comparable to Maf-DKO derived from bone marrow) did not reduce their antitumor activity.

[0492] Without being bound by any theory, the as yet unknown mechanisms of tumor suppression by Maf-DKO may be both direct and indirect. Results from Rag2γc knockout mice (which lack T cells, B cells, and NK cells) suggest that, unlike WT macrophages, Maf-DKO macrophages continuously collaborate with other immune cells to achieve tumor reduction even in the presence of tumors in vivo. Furthermore, we show that T cells (such as CD8 T cells) and, to a lesser extent, NK cells are recruited to the peritoneal cavity of mice bearing established tumors at early time points following Maf-DKO adoptive transfer ( Figure 3a , b). In summary, these results indicate that Maf-DKO macrophages can also inhibit tumor growth through T cell activation, such as CD4 T cells or CD8 T cells, or NK cell activation. In addition, we show that compared with peritoneal macrophages of mice treated with WT, macrophages of mice treated with Maf-DKO are MHC II (hi). Importantly, it has been shown that the transition from MHC II (hi) to MHC II (low) in TAMs mediates tumor progression in mice (Wang et al., 2011). In addition, another study showed that CD169+ macrophages lead to anti-tumor immune responses via their ability to phagocytose cells and cross-present tumor cell peptides to cytotoxic T cells (Asano et al., 2011). In summary, these data and our results enable us to show that Maf-DKO anti-tumor activity may be triggered in part by presentation of tumor peptides to T cells and their subsequent activation.

[0493] Preliminary in vitro results of Maf-DKO macrophages or WT macrophages co-cultured with ID8 tumor cells showed that more lactate dehydrogenase (LDH) (data not shown) was released when tumor cells were co-cultured with Maf-DKO macrophages, which supports more ID8 cell lysis when in contact with Maf-DKO macrophages. This indicates that Maf-DKO macrophages also have a direct killing effect on tumor cells at least in vitro.

[0494] Previous literature shows that co-culture with ID8 cells polarizes macrophages to M2-like phenotypes by increasing IL-10 expression and reducing IL-12 (Hagemann et al., 2006). When monitoring the TAM spectrum from mice treated with Maf-DKO in vitro, we show that despite exposure to the tumor environment, Maf-DKO macrophages are stable M1-like macrophages compared to WT macrophages. In addition, we analyzed the Maf-DKO macrophage phenotype in vitro by measuring IL-6, C2TA, NOS2, arginase and Il-10mRNA expression levels. We show that Maf-DKO macrophages are more sensitive to M1 stimulation (LPS and IFNγ) by the upregulation of NOS2, C2TA and IL-6 and the downregulation of arginase and IL-10, while WT macrophages are more sensitive to M2 stimulation (IL-4) and show opposite expression profiles.

[0495] Furthermore, in vitro treatment of Maf-DKO macrophages with tumor cell-conditioned medium (ID8-SN) did not shift their phenotype from M1 to M2, further confirming that Maf-DKO macrophages resist repolarization by the tumor secretome.

[0496] These experiments provide evidence for the role of Maf-DKO macrophages in driving anti-tumor immune responses, which could open up new avenues for cancer cell therapy.

[0497] Human MAF / MAFB DKO macrophages

[0498] Methods for generating human induced pluripotent stem cells are well known in the art. Human iPS cell lines are prepared from dermal fibroblasts obtained from the foreskin of the penis of healthy human Caucasian male newborns. Reprogramming was performed with non-integrated Sendai viruses containing POU5F1, SOX2, KLF4 and MYC (Fusaki N. et al. (2009)). HIV1, HIV2, hepatitis B and C viruses and mycoplasma virus screening were negative. Karyotype showed a normal 46 (X, Y) karyotype. In this cell line, a doxycycline-inducible Cas9 expression cassette was introduced into the AAVS1 locus by TALEN-mediated gene targeting, essentially as described by Gonzalez et al. (2014), thereby providing a cell line BIHi001-A-1.

[0499] Example 9

[0500] Generation of double knockout (DKO) cells from human iPS cells

[0501] a) iPSC culture

[0502] iPSCs were cultured in StemFlex medium (Thermo Fisher, #A3349401) on vitronectin-coated (Thermo Fisher, #A14700) tissue culture plates without feeder layers at 37°C, 5% CO2 and normoxia. When 60-80% confluence was reached, cells were passaged with ReLeSR (Stem Cell Technologies, #05872) and maintained in the presence of 10 μM ROCK inhibitor Y-27632 (biomol, #Cay10005583) on the day after passage. Single cell suspensions of iPSCs were obtained by incubation with Accutase (Merck Millipore, #SF006).

[0503] b) Genome editing

[0504] We used the CRISPR / Cas9 system to delete the coding sequences of MAF (gene ID: 4094, 373 amino acids) and MAFB (gene ID: 9935, 323 amino acids) in human cells. To this end, we transfected a healthy donor-derived iPSC line containing a doxycycline-inducible Cas9 expression cassette (BIHi001-A-1, https: / / hpscreg.eu / cell-line / BIHi001-A-1; also known as iBCRT Cas9v1-3G-K1.16) targeting MAF and MAFB with sgRNA expression plasmids (pU6-(BbsI)sgRNA_CAG-venus-bpA, AddgeneID 86985, https: / / www.addgene.org / 86985 / ) according to published protocols (Yumlu, (2017)).

[0505] To make complete CDS deletions, we designed 2 sgRNAs for each gene using the CrispRGold program for sequence design to target sequences in the 5'UTR at least 20 nt upstream of the start codon of each gene and in the 3'UTR at least 20 nt downstream of the stop codon (https: / / crisprgold.mdc-berlin.de / Chu et al. (2016)). The 2 sgRNAs for each gene were expressed together by the sgRNA expression vector pU6-(BbsI)sgRNA_CAG-venus-bpA, which also encoded a fluorescent reporter gene (Venus, derived from YFP) to positively select transfected cells by FACS.

[0506]

[0507] Table 1: sgRNAs and protospacer sequences for CRISPR / Cas9-mediated deletion of CDSs of MAF and MAFB. The position of the target-specific 20-nucleotide-long protospacer is marked with an "N" within the sgRNA sequence. The genomic target sequence of the sgRNA expressed by pU6-(BbsI)sgRNA_CAG-venus-bpA and the designated protospacer sequences are located in the 5'UTR and 3'UTR of MAF and MAFB, respectively. UTR, untranslated region.

[0508] SEQ ID No.1 (MAF-5'UTR):

[0509] 5'ATCTGGCGGAGCGGCGGCGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTT-3'

[0510] SEQ ID No.2 (MAF-3'UTR):

[0511] 5'ACCCTGATAAGTGCTCCGCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTT-3'

[0512] SEQ ID No.3 (MAFB-5'UTR):

[0513] 5'CGGCCGCAAAGTTTCCCGGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTT-3'

[0514] SEQ ID No.4 (MAFB-3'UTR):

[0515] 5'TGACCTGTTTGACTTGAGCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTT-3'

[0516] Using Lipofectamine 3000 (Thermo Fisher, #L3000001), we transfected BIHi001-A-1 with sgRNA expression vectors and pCAG-mTrex2-bpA (Addgene ID 86984, https: / / www.addgene.org / 86984 / ) to enhance the propensity for indel formation. Throughout this text, control cells labeled "WT" or "wild type" were treated in the same manner, except that (BbsI) sgRNA_CAG-venus-bpA without any pre-spacer sequence inserted was used. Transfected BIHi001-A-1 cells were treated with 1 μg / ml doxycycline hydrochloride (Sigma-Aldrich, #D9891) to induce Cas9 expression, and cells expressing the Venus reporter gene were subsequently isolated by FACS from the vector carrying the sgRNA. Sorted cells were seeded at low density to allow isolation of single-cell derived colonies. In the first round of transfection, sgRNA targeting MAF was used, and colonies were screened for full-length deletion of the MAF CDS using PCR and Sanger sequencing of the edited locus ( Fig. 9 ). Cells were cultured under iPS cell conditions as described above.

[0517] MAF KO iPSCs were subjected to a second round of transfection using MAFB targeting sgRNA, followed by PCR and sequencing analysis of the obtained colonies. Three MAF / MAFB DKO (MAF-DKO) iPSC clones (clones 1, 2, 3) were isolated. The genomic target regions and edited MAF and MAFB loci are shown in Fig.10 middle.

[0518] Example 10

[0519] Directed differentiation of iPSCs into macrophages

[0520] Directed differentiation of iPSCs into macrophages was based on a previously published protocol (Buchrieser 2017). Embryoid bodies (EBs) were formed by seeding single cell suspensions of wild-type or MAF-DKO iPSCs at a density of 12,500 cells / well into ultra-low attachment U-bottom 96-well plates (Nunclon Sphera, Thermo Fisher, #174925) and resuspending in EB medium consisting of StemFlex medium (Thermo Fisher, #A3349401) supplemented with 50 ng / ml BMP-4 (R&D Systems, #314-BP), 20 ng / ml SCF (R&D systems, 255-SC), 50 ng / ml VEGF (Peprotech, AF-100-20A) and 10 μM Y-27632. The 96-well plates were centrifuged at 100 g for 3 minutes to collect cells at the bottom and placed at 37°C, 5% CO2 for 4 days. After 1 and 2 days, replace half of the EB medium with freshly prepared EB medium.

[0521] Wild-type and MAF-DKO EBs were indistinguishable in size or morphology.

[0522] After 4 days, EBs were manually selected, resuspended in EB differentiation medium consisting of X-VIVO 15 (Lonza, #BE02-060F) supplemented with 2 mM GlutaMAX (Thermo Fisher, #35050038), 0.055 mM 2-mercaptoethanol (Sigma-Aldrich, #M6250), 100 ng / ml human M-CSF (ThermoFisher, #PHC9504), 25 ng / ml human IL-3 (R&D systems, #203-IL), and seeded into ultra-low attachment 6-well tissue culture plates (8 EB / well) or 90 mm tissue culture dishes (24 EB / dish; Nunclon Sphera, Thermo Fisher, #174932 and #174945). Two-thirds of the medium was replaced with fresh differentiation medium every 5 days. Monocytes / macrophages were generated from EBs starting approximately 15 days after EB seeding, and suspension cells were harvested, counted, and used for immunophenotyping by flow cytometry or EdU incorporation assay.

[0523] For further experiments, cells harvested from the supernatant of EB cultures were replated for terminal macrophage differentiation in RPMI supplemented with 10% FBS (PAA-GE Healthcare, A15-101), 100 units / ml penicillin, 100 ug / ml streptomycin (Thermo Fisher, #15140122), 2 mM GlutaMAX (Thermo Fisher, #35050038), 1 mM sodium pyruvate (Thermo Fisher, #11360-039), 50 ng / ml M-CSF (Thermo Fisher, #PHC9504) and 50 ng / ml GM-CSF (Peprotech, #300-03), and these cells were seeded into ultra-low attachment 12-well tissue culture plates (Nunclon Sphera, Thermo Fisher #174931, #174932); 37°C, 5% CO2. Cells were counted manually using a Neubauer hemacytometer or automatically using a CASY cell counter (OMNI Life Science).

[0524] Depletion of MAF and MAFB had no effect on myeloid differentiation capacity, and similar to wild-type EBs, MAF-DKO EBs began to release monocytes / macrophages into EB differentiation medium approximately 15 days after EB plating. MAF-DKO suspension cells were viable, and after plating in differentiation medium containing 50 ng / ml M-CSF and GM-CSF, both wild-type and MAF-DKO macrophages phagocytosed beads, produced ROS, and stained positive for lysosomal and cathepsin activity, indicative of a mature macrophage phenotype.

[0525] Embodiment 11

[0526] The MAF-DKO macrophages and wt macrophages derived from the iPS cells obtained from EB differentiation culture (substantially as described in Example 11) were harvested by collecting suspension cells on the 20th day after EB inoculation. 500000 cells per well were re-plated in 6-well plates (3ml culture medium per well), then kept for 5 days, to carry out final differentiation (substantially as described in Example 11 in the presence of M-CSF and GM-CSF; Partial culture medium was replaced with fresh culture medium every other day). On the 5th day, cells were collected and re-plated in the complete culture medium (including M-CSF and GM-CSF, as described in Example 11) of Nunclon 12-well plates with 100000 cells / well, and two more days (2ml culture medium per well) were kept. On the 7th day after harvesting suspension cells, culture medium was replaced with fresh complete culture medium (including M-CSF and GM-CSF, being 50ng / ml). Cells were then harvested 2 hours after media change - 10,000 DAPI-negative, CD45-positive, C11b-positive cells were sorted directly into LRT plus lysis buffer and RNA was extracted using the RNeasy micro kit (Quiagen, catalog number 74034). RNA isolated from 10,000 cells was then used to analyze differences in gene expression patterns by RNAseq (as described in detail in Picelli et al. (2013) Nature Methods 10:1096-1098), with a sequencing depth of 38 million fragments per library. Fragments were aligned to the human reference (hg38) using GSNAP (v2020-12-16; [Thomas D. et al. (2005) Bioinformatics 21:1859-1875], [Thomas D. et al. (2010) Bioinformatics 26:873-881]), and splice sites were detected using Ensembl gene annotation 98 ([Howe et al. (2021) NAR 49 (1):884–891]). Uniquely aligned fragments were counted using featureCounts (2.0.1; [Liao et al. (2014) “featureCounts: an efficient general purpose program for assigning sequence reads to genomic features.”]) and the same Ensembl annotation. At the same time, RNA-SeQC (1.1.8; [DeLuca et al. (2012) Bioinformatics 28.11:1530-1532.]) was used to perform quality control on the sequenced libraries, which included the exon, intron and intergenic distribution and rRNA ratio of the reads in each library.Normalization of raw fragment counts based on library size and testing for differential expression between the two conditions DKO 2h and WT 2h were performed using DESeq2 (v1.24.0; [Love et al. (2014) Genome Biology, 15, 550]) and IHW (1.12.0; [Ignatiadis et al. (2016) Nature Methods. doi: 10.1038 / nmeth.3885; and Ignatiadis N, Huber W (2017). “Covariate-powered weighted multiple testing with false discovery rate control.” arXiv. doi:arXiv:1701.05179]), packages in R (3.6.3; [R Core Team (2020). R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. URL https: / / www.R-project.org / ]). Genes with adjusted p-values ​​(padj) < 0.05 and / or log2 fold changes > 0.58 or < −0.58 were considered differentially expressed.

[0527] The differences in gene expression patterns between MAF-DKO macrophages and wt-macrophages were striking, e.g. Fig.11 Visualization in the displayed volcano map.Compared with wt macrophages, the designated M1 markers were strongly upregulated in DKO-macrophages, as shown in the following table, while the designated M2 markers were strongly downregulated, even if M-CSF was present at a concentration of 50ng / ml in the final differentiation step.This shows that human MAF-DKO macrophages have substantially the same polarization phenotype as mouse MAF-DKO macrophages, and therefore anti-tumorigenicity is expected to be substantially the same as mouse MAF-DKO macrophages.

[0528]

[0529]

Claims

1. An allogeneic human myeloid cell for use as a therapeutic agent in a human patient, wherein the allogeneic myeloid cell comprises at least one MHC-II complex that is identical to any MHC-II complex of the human patient.

2. The allogeneic human myeloid cells according to claim 1, for use in treating cancer.

3. The allogeneic human myeloid cells for treating cancer according to claim 2, wherein the allogeneic myeloid cells comprise at least one protein complex selected from the group consisting of HLA-DR, HLA-DP and HLA-DQ, which is identical to any corresponding HLA complex of the human patient.

4. The allogeneic human myeloid cells for use in treating cancer according to claim 3, wherein the allogeneic myeloid cells comprise two protein complexes selected from the group, preferably wherein the allogeneic myeloid cells comprise three complexes selected from the group.

5. The allogeneic human myeloid cells for treating cancer according to claim 2 or 3, wherein the allogeneic myeloid cells comprise: at least one HLA-DR protein complex identical to any corresponding HLA-DR complex of the human patient and / or at least one HLA-DP protein complex identical to any corresponding HLA-DP complex of the human patient and / or at least one HLA-DQ protein complex identical to any corresponding HLA-DQ complex of the human patient.

6. The allogeneic human myeloid cells for treating cancer according to claim 2, wherein the allogeneic myeloid cells and the patient to be treated have at least one pair of common alleles, and the at least one pair of common alleles is selected from the group consisting of the following pairs: HLA-DRA / HLA-DRB1, HLA-DRA / HLA-DRB3, HLA-DRA / HLA-DRB4, HLA-DRA / HLA-DRB5, HLA-DPA1 / HLA-DPB1 and HLA-DQA1 / HLA-DQB1.

7. The allogeneic human myeloid cells for use in treating cancer according to claim 6, wherein the allogeneic myeloid cells and the patient to be treated have two, three, four, five or even all six pairs of common alleles.

8. The allogeneic human myeloid cells for use in treating cancer according to claim 6 or 7, further comprising one or more of the features according to any one of claims 1 to 5.

9. The allogeneic human myeloid cell for use in treating cancer according to any one of claims 2 to 8, wherein the allogeneic human myeloid cell is resistant to M-CSF-induced M2 polarization.

10. The allogeneic human myeloid cells for use in treating cancer according to any one of claims 2 to 9, wherein the allogeneic human myeloid cells are genetically modified.

11. The allogeneic human myeloid cells for use in treating cancer according to claim 10, wherein the genetic modification is the introduction of a gene encoding a surface protein, such as a gene encoding a chimeric antigen receptor. 12 . The allogeneic human myeloid cell for use in treating cancer according to claim 2 , wherein the allogeneic human myeloid cell is derived from an iPS cell.

13. A collection of allogeneic human myeloid cells for use in cancer treatment according to any one of claims 2 to 12, wherein the collection of allogeneic human myeloid cells is capable of recruiting T cells and / or NK cells to tumors in vivo.

14. The collection of allogeneic human myeloid cells for use in cancer treatment according to claim 13, wherein the number of allogeneic human myeloid cells is at least 10,000,000.

15. The allogeneic myeloid cell for use according to any one of claims 1 to 12 or the collection of allogeneic myeloid cells for use in cancer treatment according to claim 13 or 14, wherein the allogeneic myeloid cell is a macrophage.

Images