New application of anti-cancer virus

Abstract

The present invention relates to a novel use of an anti-cancer virus, and relates to an intravenous injection composition for repeated administration comprising an anti-cancer virus as an active ingredient, said virus: the expression of thymidine kinase (TK) gene is suppressed; and inserted into a gene encoding complement regulatory protein CD55 and granulocyte-macrophage colony stimulating factor (GM-CSF). The present invention relates to an intravenous injection composition for repeated administration, and more specifically, to an intravenous injection composition for repeated administration comprising, as an active ingredient, an anti-cancer virus in which the expression of a thymidine kinase (TK) gene is suppressed; the present invention relates to a viral membrane protein comprising a complement regulatory protein CD55 and a gene encoding a granulocyte-macrophage colony stimulating factor (GM-CSF), and is inserted with the following genes: a gene encoding the CD55 fused to the transmembrane domain region of the viral membrane protein to enable the complement regulatory protein CD55 to be expressed on the intracellular mature virion (IMV) membrane, and a gene encoding a granulocyte-macrophage colony stimulating factor (GM-CSF). When the composition of the present invention is administered into the body, a neutralization reaction of an antibody to a virus can be avoided by CD55 expressed in a virus IMV membrane by fusion with the virus membrane protein H3, thereby enabling repeated intravenous administration of an anti-cancer virus, thereby preventing a decrease in anti-cancer efficacy caused by a neutralizing antibody, and maximizing the anti-cancer effect.

Description

[Technical field]

[0001] The present invention relates to a new use of anticancer viruses, and to a composition for repeated intravenous administration, which contains an anticancer virus as an active ingredient, wherein the expression of the thymidine kinase (TK) gene of the virus is suppressed, and genes encoding complement regulatory protein CD55 and granulocyte-macrophage colony stimulating factor (GM-CSF) are inserted. Specifically, it relates to a composition for repeated intravenous administration, which contains an anticancer virus as an active ingredient, wherein the expression of the thymidine kinase (TK) gene of the virus is suppressed, and the following genes are inserted: a gene encoding CD55 fused to the transmembrane domain region of the viral membrane protein so that the complement regulatory protein CD55 can be expressed on the membrane of the mature virion (IMV) in the cell, and a gene encoding granulocyte-macrophage colony stimulating factor (GM-CSF). [Background technology]

[0002] Cancer is a leading cause of death worldwide, and because it imposes a huge burden on individuals and society, the importance of developing innovative anticancer therapeutics is increasing, and various approaches are being attempted based on developments in molecular biology.

[0003] As an anticancer therapeutic agent that has attracted much attention in recent years, oncolytic virus is a virus that can replicate and is contagious. It is a virus used for cancer treatment by inserting specific genes that genetically target abnormal parts in tumor cells into wild-type or attenuated viruses. Such genetically engineered anticancer viruses spread through tissues as cells lyse after viral replication, and the spread of the virus occurs selectively in cancer cells and the blood vessels around them. A representative anticancer virus is Amgen's lmlygic (talimogene laherparepvec), which was approved by the U.S. Food and Drug Administration (FDA) in October 2015 for the treatment of melanoma.

[0004] On the other hand, intravenous injection of drugs is a simple method of quickly delivering drugs that cannot be administered orally to the whole body, and because it is easy to administer, it is one of the most preferred forms of administration. In addition, because intravenous injection allows the drug to reach the tumor through blood vessels, the drug is evenly distributed in the tumor, so the efficacy of the drug can be evenly distributed throughout the tumor. However, since anticancer viral drugs are rapidly eliminated by the human immune system (such as the complement system and neutralizing antibodies) when injected intravenously, only a small amount of anticancer viruses reach the tumor, which has the limitation that the efficacy will be reduced. Therefore, in order to increase the probability of the virus reaching the tumor, anticancer viral drugs are usually injected directly into the target tumor instead of intravenous injection.

[0005] Intratumoral injection is generally effective in accessible superficial cancers such as melanoma, breast cancer, and head and neck cancer. However, its disadvantages are that it is difficult to inject an effective dose into all tumor tissues in cases where there are multiple tumors in a single organ, deep solid cancers occurring in inaccessible locations, and cancers that have metastasized to multiple organs. In addition, because intratumoral injection is highly invasive, it is not as easy to use as a repeated treatment method as intravenous injection.

[0006] Despite the advantages of intravenous injection, the reason why anticancer viruses are difficult to administer in the form of intravenous injection is that foreign substances (i.e., viruses) injected into the blood are gradually eliminated by the body's defense mechanism, thereby reducing the activity of the anticancer virus. In other words, when the virus moves along the blood vessels in the body, it activates the complement system present in the blood, and the activated complement directly neutralizes the virus or promotes the phytotoxicity of macrophages, thereby clearing the virus.

[0007] In addition, if an anticancer virus is injected into the body for treatment, the acquired immune response will form neutralizing antibodies against the virus. The more repeated the injection, the stronger and larger the antibodies will be. The formed neutralizing antibodies bind to the surface antigens of the virus, hindering viral infection. When injected repeatedly, the anticancer efficacy of the virus will gradually decrease and eventually lose its anticancer efficacy. Therefore, in order to enable intravenous and repeated injections of anticancer viruses, research and development is needed to avoid neutralization reactions caused by antibodies. [Summary of the invention]

[0008] [Technical problem to be solved by the invention]

[0009] The purpose of the present invention relates to a new use of anticancer viruses, and to a composition for intravenous injection for repeated administration, which contains an anticancer virus as an active ingredient, wherein the expression of the thymidine kinase (TK) gene of the virus is suppressed; and genes encoding complement regulatory protein CD55 and granulocyte-macrophage colony-stimulating factor (GM-CSF) are inserted. Specifically, it relates to a composition for intravenous injection for repeated administration, which contains an anticancer virus as an active ingredient, wherein the expression of the thymidine kinase (TK) gene of the virus is suppressed; and the following genes are inserted: a gene encoding CD55 fused to the transmembrane domain region of the viral membrane protein so that the complement regulatory protein CD55 can be expressed on the membrane of the mature virion (IMV) in the cell, and a gene encoding granulocyte-macrophage colony-stimulating factor (GM-CSF).

[0010] The technical tasks to be accomplished according to the technical ideas of the present invention disclosed herein are not limited to the tasks of solving the above-mentioned problems, and other unmentioned tasks can be clearly understood by ordinary technicians from the following description.

[0011] [Technical solution to the problem]

[0012] The specific description is as follows. On the one hand, each description and embodiment disclosed in this application can be mutually applicable to other descriptions and embodiments. In other words, all combinations of various elements disclosed in this application belong to the scope of this application. In addition, it cannot be said that the scope of this application is limited by the specific description described below.

[0013] As one means to achieve the above-mentioned object, the present invention provides a composition for intravenous injection for repeated administration (or multiple administrations), the composition comprising an anticancer virus as an active ingredient, wherein: the expression of the thymidine kinase (TK) gene is suppressed; and genes encoding the complement regulatory protein CD55 and granulocyte-macrophage colony stimulating factor (GM-CSF) are inserted.

[0014] More specifically, the present invention provides a composition for intravenous injection for repeated administration, comprising an anticancer virus as an active ingredient, wherein: the expression of the thymidine kinase (TK) gene is suppressed; and the following genes are inserted: a gene encoding CD55 fused to the transmembrane domain region of the viral membrane protein so that the complement regulatory protein CD55 can be expressed on the membrane of mature virions (IMV) in the cell, and a gene encoding granulocyte-macrophage colony stimulating factor (GM-CSF).

[0015] In the present invention, when the anticancer virus is intravenously injected, complement regulatory proteins, such as CD55 having the highest complement regulatory activity, are expressed in the IMV membrane to protect the anticancer virus from the attack of complement, thereby avoiding the attack of complement. In particular, the present inventors have made research efforts to develop an anticancer virus that can be repeatedly administered intravenously, and have discovered and demonstrated that the above-mentioned anticancer virus avoids the neutralization reaction of viral antibodies to the anticancer virus, thereby completing the present invention.

[0016] The term "anti-cancer virus (oncolytic vaccinia virus)" may be referred to as "oncolytic virus", which includes "recombinant virus" modified by deleting all or part of endogenous genes and introducing exogenous genes. Such anti-cancer viruses may be: vaccinia virus, adenovirus, herpes simplex virus, retrovirus, reovirus, Newcastle disease virus, coxsackie virus, enterovirus or herpes virus, etc.

[0017] The present invention includes, for example, that the vaccinia virus can be Western Reserve (WR), NYVAC (New York vaccinia virus), Wyeth, LC16m8, Lister, Copenhagen, Tian Tan, USSR, TashKent, Evans, IHD-J (International Health Department-J) or IHD-W (International Health Department-White) strain.

[0018] The term "thymidine kinase (TK)" in the present invention is an enzyme involved in nucleotide biosynthesis. Thymidine kinase encoded by the TK gene can bind the phosphate at the γ position of ATP to thymidine to form nucleotides that constitute viral DNA. TK may be a sequence such as GenBank: AAR17937.1 or AY313847.1, but is not limited thereto. Specifically, TK or its gene may be composed of the amino acid sequence of GenBank: AAR17937.1 or the nucleotide sequence of GenBank: AY313847.1, but is not limited thereto. In addition, TK or its gene may have an identity of about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or more than 99% with the amino acid sequence of GenBank: AAR17937.1 or the nucleotide sequence of GenBank: AY313847.1.

[0019] The term "granulocyte-macrophage colony stimulating factor (GM-CSF)" in the present invention is a protein that plays a key role in the generation, differentiation and activation of various immune cells (including granulocytes, macrophages and platelet cells). It is a cytokine in a series of drugs known as hematopoiesis (blood forming agent), also known as sargramostim. GM-CSF is produced by many different cell types (e.g., activated T cells, B cells, macrophages, mast cells, endothelial cells and fibroblasts) in response to cytokines or immune and inflammatory stimuli. In addition to granulocyte-macrophage progenitor cells, GM-CSF is also a growth factor for erythrocytes, megakaryocytes and eosinophil progenitor cells. For mature hematopoietic cells, GM-CSF is a vitality factor for granulocytes, monocytes / macrophages and eosinophils, and activates their functions as an effective factor. It is reported that GM-CSF also has a functional effect on non-hematopoietic cells. This can induce human endothelial cell migration and proliferation.

[0020] GM-CSF may be, but is not limited to, the sequence of GenBank: M10663.1 or GenBank: X02333.1. Specifically, the GM-CSF gene may consist of or be part of the nucleotide sequence of GenBank: M10663.1 or GenBank: X02333.1, and the GM-CSF gene may have about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more identity with the sequence of GenBank: M10663.1 or GenBank: X02333.1. In addition, GM-CSF may consist of or be part of the amino acid sequence of SEQ ID NO: 3 or 8, and may consist of or be part of the nucleotide sequence of SEQ ID NO: 4 or 9.

[0021] The term "complement regulatory protein" in the present invention refers to a protein that accurately regulates the complement activation pathway in vivo. It is divided into a serum type (water-soluble) regulatory protein group and a membrane-bound regulatory protein group. The serum type includes: C4b binding protein, H factor, SGP120, alanine (P), etc., while the membrane-bound type includes: CRI (CD35), CR2 (CD21), CR3 (CD11b / CD18), CR4 (CD11c / CD18), DAF (CD55), membrane cofactor protein (MCP, CD46) and CD59. Among them, only P acts in the direction of enhancing complement activity, while the others act in the direction of reducing complement activity. The complement regulatory protein contained in the recombinant vaccinia virus of the present invention may be: CD35, CD21, CD18, CD55, CD46 or CD59, in particular CD55, but is not limited thereto. Specifically, the gene of CD55 may consist of the nucleotide sequence of Genbank: NM_000574.3, or may be a part of the sequence, and the gene of CD55 may have about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more identity with the nucleotide sequence of NCBI reference sequence: NM_000574.3. More specifically, CD55 may consist of the amino acid sequence of SEQ ID NO: 1 or the nucleotide sequence of SEQ ID NO: 2.

[0022] The term "transmembrane domain" in the present invention, also called a transmembrane region or a transmembrane region, refers to a region that penetrates and passes through the lipid bilayer of a membrane protein.

[0023] Specifically, the membrane protein of vaccinia virus can be D8L, A16L, F9L, G9R, H3L, L1R, A9L, A13L, A21L, A28L, E10R, G3L, H2R, I2L, J5L, L5R or O3L, and can include all or part of the membrane protein sequence, as shown in Table 1 below.

[0024]

Table 1

[0025]

[0026]

[0027]

[0028] At this time, the transmembrane domain of the complement regulatory protein and the anticancer virus protein can be designed to contain all or part of the gene through gene manipulation. Specifically, in the anticancer virus, the transmembrane domain of the vaccinia virus membrane protein can be composed of the amino acid sequence of SEQ ID NO: 10 or the nucleotide sequence of SEQ ID NO: 11, but is not limited thereto.

[0029] The gene expression inhibition or gene inactivation mentioned in the present invention means that the gene is not expressed due to the deletion of part or all of the gene or the insertion of a foreign gene into the gene, or only part of the gene is expressed, so that the activity of the protein encoded by the gene does not appear. The method of deleting a gene or inserting a foreign gene can be carried out by a method well known in the conventional technical field. For example, it can be carried out by the method of inserting a foreign gene disclosed in Methods described in Molecular Cloning, A Laboratory Manual, Second Edition, by J. Sambrook, EF Fritsch and T. Maniatis (2003), Cold Spring Harbor Laboratory Press, Virology Methods Manual, edited by Brian WJ Mahy and Hiliar O Kangro (1996) Academic Press and Expression of genes by Vaccinia virus vectors. Current Protocols in Molecular Biology, published by John Wiley and Son (1998), Chapter 16. Specifically, the expression of the thymidine kinase gene can be inhibited by inserting a foreign gene into part or all of the thymidine kinase J2R region. More specifically, in one embodiment of the present invention, using T-Blunt TM The foreign gene is inserted using the PCR cloning kit (Solgent, Korea, catalog number SOT01-K020). The GM-CSF and complement regulatory proteins contained in the anticancer virus of the present invention are expressed under the control of the following promoters: late-early VACV p7.5 promoter, vaccinia synthetic early-late promoter (pSEL), vaccinia synthetic late promoter (pSL), vaccinia modified H5 (mH5) promoter, vaccinia short synthetic early-late pS promoter, pLate promoter, pC11R promoter, pF11L promoter, psFJ1-10 synthetic early promoter, pHyb synthetic early promoter, any natural vaccinia early promoter or late-early optimized (LEO) promoter, but not limited thereto. For example, GM-CSF can be expressed under the control of the pSEL promoter, and the complement regulatory protein or CD55 is expressed under the control of the pLate promoter. More specifically, GM-CSF is expressed under the control of the pSEL promoter of SEQ ID NO:5 or the p7.5 promoter of SEQ ID NO:7, and the complement regulatory protein may be expressed under the control of the pLate promoter of SEQ ID NO:6.

[0030] The anticancer virus of the present invention may further include genes that can increase the therapeutic efficacy of cancer. There is no limitation on such genes, but they may include, for example, anticancer therapeutic genes, various immunomodulatory factors, and extracellular matrix degrading enzymes such as intratumoral fibers, and may also include, for example, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, IL-13, IL-14, IL-15, IL-17, IL-18, IL-21, IL-23, IL-24, interferon-α, interferon-β, interferon-γ, CCL3, CCL5, CXCR4, CXCL9, CXCL10, CXCL11, interleukin superagonists (interleukin superagonist; IL-2 superagonist, IL-15 superagonist), TGF-β blocker, TLR-2 agonist, TLR-3 agonist, TLR-7 agonist, STAT-3 inhibitor, PTENα, p53, p63, p73, adenosine deaminase-2, cancer-specific antigen, cancer-associated antigen, hyaluronidase, collagenase, protease, etc., but not limited to these.

[0031] The composition of the present invention can be administered in combination with a substance that promotes immune activity to improve the effectiveness of cancer treatment. For example, it can be used in combination with the following substances: anti-PD-1 (programmed cell death protein-1) antibody, anti-PD-L1 antibody, anti-CTLA-4 (cytotoxic T lymphocyte antigen-4) antibody, anti-LAG-3 (lymphocyte activation gene-3) antibody, anti-TIM-3 (T cell membrane protein-3) antibody, anti-TIGIT (T cell immune receptor with Ig and ITIM domains) antibody, anti-VISTA (V-domain immunoglobulin-containing T-cell activation inhibitor) antibody, IDO (indoleamine 2,3-dioxygenase) inhibitor, BLTA (B and T lymphocyte attenuator) inhibitor, B7-H3 inhibitor, B7-H4 inhibitor, B7-H3 inhibitor, galectin 9 (GAL9) inhibitor, KIR (killer cell immunoglobulin-like receptor) inhibitor, or CAR-T cells (chimeric antigen receptor T cells), CAR-NK cells (chimeric antigen receptor natural killer cells), or a combination of two or more of the listed ones, but not limited thereto.

[0032] Unlike other anticancer viruses that are mainly administered intratumorally, the anticancer virus of the present invention can be injected intravenously, so when used in combination with immune checkpoint inhibitors as intravenous preparations, it can be easily administered by a single route. In addition, even if it is repeatedly administered, the anticancer virus of the present invention will not produce drug resistance that reduces its efficacy due to neutralization reaction, so even if it is repeatedly administered in combination with other anticancer drugs, a certain drug combination synergistic effect can be maintained.

[0033] The composition of the present invention for the combined administration can be formulated for parenteral administration, but is not limited thereto. Specifically, parenteral administration may include intratumoral, intravenous, intra-arterial, hepatic arterial, intracerebral, intraperitoneal, intramuscular, intrasternal, subcutaneous or intranasal administration, such as intratumoral, intravenous, intra-arterial or intraperitoneal administration, more specifically, may include intravenous administration.

[0034] The anticancer virus of the present invention can inhibit the expression of serine protease inhibitor enzymes by further deleting part or all of the K2L region encoding the serine protease inhibitor enzyme (serine protease inhibitor-3, SPI-3). The K2 protein plays a role in inhibiting cell-to-cell fusion caused by vaccinia virus infection, and the deletion of the K2L gene leads to the formation of syncytia, thereby causing the infected cells, especially the infected cancer cells, to disappear rapidly.

[0035] In the present invention, the composition can preferably avoid the neutralization reaction caused by antibodies against the virus.

[0036] In the present invention, the composition can be preferably used for administration to a subject who maintains neutralizing antibodies against the anti-cancer virus of the present invention. Such a subject may have previously been administered the anti-cancer virus of the present invention, or may have been infected with smallpox virus or monkeypox virus belonging to the same family as the vaccinia virus of the present invention, or may be a subject who maintains neutralizing antibodies through vaccination.

[0037] The term "neutralizing antibody" in the present invention refers to an antibody that neutralizes the biological effects of infectious particles such as viruses when they invade the human body, thereby protecting cells. Neutralizing antibodies generally perform immune functions to protect cells by binding to pathogens that are toxic to the body and inhibiting their activity, but it shows the same effect on anticancer viruses injected for anticancer treatment, thereby reducing the anticancer efficacy caused by the anticancer virus. Therefore, there is a problem that when the anticancer virus is repeatedly injected, the number of injections is limited due to the formation of neutralizing antibodies against the virus.

[0038] The term "neutralization" in the present invention refers to the immune detection ability of specific antibodies that prevent viruses from invading target cells. The neutralization reaction of antibodies converts the virus from an infected state to a non-infected state, and enables the neutralizing antibodies (which play a role in encapsulating the antigenic protein part of the virus so that it cannot bind to the host's receptors) to bind to the virus, thereby preventing it from causing infection.

[0039] In the present invention, the avoidance of neutralization reaction may be due to the fusion of CD55 with the transmembrane domain of the vaccinia virus membrane protein H3 and its expression on the IMV membrane. Specifically, by expressing CD55 on the IMV membrane using the major antigen H3 of the vaccinia virus, the exposure of the major antigen of the virus can be limited and the neutralization reaction of the antibody to the virus can be avoided.

[0040] By avoiding the neutralization reaction caused by CD55, the anticancer virus can be repeatedly administered, and the anticancer efficacy can be significantly better than that of the control virus that does not express CD55. In addition, compared with the control virus, the anticancer virus with K2L deletion and CD55 expression can show significantly superior anticancer efficacy.

[0041] Specifically, in the case of the recombinant vaccinia virus expressing CD55 of the present invention, even if antibodies are formed by repeated intravenous administration of the virus, anti-cancer efficacy can be exhibited by avoiding the neutralization reaction of the antibody to the virus, and experiments have confirmed that even in the case of pre-injection of neutralizing antibodies against vaccinia virus or repeated intravenous administration of recombinant vaccinia virus after injection of vaccinia virus to induce antibody formation against the virus, anti-cancer efficacy can be exhibited without being affected by neutralizing antibodies.

[0042] The composition for repeated administration of the present invention can be provided as a pharmaceutical composition as one embodiment.

[0043] The specific dosage of the pharmaceutical composition of the present invention can be selected by those skilled in the art according to factors such as the preparation method, the patient's condition and weight, the patient's gender, age, disease severity, drug form, administration route and duration, excretion rate, reaction sensitivity, etc., and the dosage and frequency of administration do not limit the scope of the present invention in any way. Specifically, the pharmaceutical composition of the present invention may contain 105 ~ About 10 13 pfu (plaque forming unit) of anticancer virus, but not limited to this.

[0044] The pharmaceutical composition of the present invention can be administered at a single dose of 1×10 5 pfu (plaque forming unit) ~ 1×10 13 The dose of pfu is administered to the patient and can be 1×10 5 pfu (plaque forming unit)~1×10 13 A single dose or multiple doses (i.e. 1×10 8 pfu, 5×10 8 pfu, 1×10 9 pfu, etc.) doses are administered to patients.

[0045] Specifically, the following range can be applied per single application: 1×10 5 pfu, 1×10 6 pfu, 1×10 7 pfu, 1×10 8 pfu, 1×10 9 pfu, 1×10 10 pfu, 1×10 11 pfu, 1×10 13 pfu or 1×10 5 pfu~1×10 6 pfu, 1×10 6 pfu~1×10 7 pfu, 1×10 7 pfu~1×10 8 pfu, 1×10 8 pfu~1×10 9 pfu, 1×10 9 pfu~1×10 10 pfu, 1×10 10 pfu~1×10 11 pfu, 1×10 11 pfu~1×10 12 pfu or 1×10 12 pfu~1×10 13 pfu.

[0046] The pharmaceutical composition of the present invention can be administered once or repeatedly (or multiple times) (2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times or more).

[0047] When the pharmaceutical composition of the present invention is administered more than twice, it can be administered 2 to 28 days after the first administration or the previous administration. Specifically, it can be administered 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days or 28 days after the first administration or the previous administration, but is not limited thereto.

[0048] In the case of repeated administration of the pharmaceutical composition of the present invention, the administration interval may be daily interval, 2-day interval, 3-day interval, 4-day interval, 5-day interval, 6-day interval, 1-week interval, 2-week interval or 1-month interval injection, or may be administered at regular intervals of more than 1 day, or in combination of several intervals, but is not limited thereto.

[0049] The pharmaceutical composition of the present invention can also be prepared in the form of a pharmaceutical composition for treating or preventing cancer that includes a conventional suitable carrier, excipient or diluent for preparing the pharmaceutical composition, wherein the carrier may include a non-naturally occurring carrier. Specifically, the pharmaceutical composition can be prepared and used in the form of oral preparations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories and sterile injections according to a common method. In the present invention, as the carrier, excipient and diluent that can be included in the pharmaceutical composition, can be enumerated: lactose, glucose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum arabic, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talcum powder, magnesium stearate and mineral oil. In the case of preparation, commonly used fillers, extenders, adhesives, humectants, disintegrants, surfactants and other diluents or excipients can be used for preparation. Oral solid preparations include: tablets, pills, powders, granules, capsules, etc., and such solid preparations are prepared by mixing at least one excipient (e.g., starch, calcium carbonate, sucrose or lactose, gelatin). In addition to simple excipients, lubricants such as magnesium phenylpropionate and talcum powder are also used. As oral liquid preparations, in addition to water and liquid paraffin, which are commonly used simple diluents in suspensions, internal liquid preparations, emulsions, syrups, etc., a variety of excipients such as humectants, sweeteners, aromatics, preservatives, etc. can also be included. Preparations for parenteral administration include: sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations and suppositories. As non-aqueous solvents and suspensions, propylene glycol, polyethylene glycol, vegetable oils (e.g., olive oil) and injectable esters (e.g., ethyl oleate) can be used. As the base of the suppository, Witepsol, polyethylene glycol, Tween 61, cocoa butter, laurel butter, glycerin gelatin and the like can be used.

[0050] Specific formulations of pharmaceutical compositions are known in the art, and reference may be made, for example, to Remington's Pharmaceutical Sciences (19th ed., 1995), which references are to be considered part of this specification.

[0051] The pharmaceutical composition of the present invention can be administered to mammals such as mice, dogs, cats, cattle, horses, pigs, humans, etc., preferably humans, through various routes. For example, the composition for repeated intravenous administration of the present invention has resistance to the complement system of the human body, avoids the neutralization reaction of antibodies to viruses during intravenous injection, and as repeated administration becomes possible, a stable anticancer activity is maintained, and sufficient therapeutic effects can be shown even with intravenous administration.

[0052] In the present invention, in particular, the anti-cancer virus of the present invention can be applied to a composition for repeated administration (for multiple administrations, for example, more than 2 times, more than 3 times, etc.), and can avoid the neutralization reaction of antibodies to the virus formed in response to the immune response, making repeated intravenous injections possible, thereby being able to show effective efficacy in deep-seated cancer or metastatic cancer occurring in inaccessible areas.

[0053] The term "cancer (or tumor)" in the present invention does not distinguish between primary cancer and metastatic cancer, but includes all cancers. Cancer may include cancer that may be solid cancer or blood cancer, and the solid cancer may be any one selected from the following: lung cancer, colorectal cancer, prostate cancer, thyroid cancer, breast cancer, brain cancer, head and neck cancer, esophageal cancer, skin cancer, thymus cancer, stomach cancer, colon cancer, liver cancer, ovarian cancer, uterine cancer, bladder cancer, rectal cancer, gallbladder cancer, bile duct cancer, pancreatic cancer, kidney cancer, osteosarcoma, sarcoma, chondrosarcoma and a combination thereof, but not limited thereto. The blood cancer may be any one selected from the following: lymphoma, leukemia, multiple myeloma and a combination thereof, but not limited thereto.

[0054] The term "metastatic cancer" in the present invention refers to cancer caused by cancer cells leaving the primary organ and metastasizing to another organ and proliferating. Metastatic cancer may include but is not limited to the growth of cancerous tissue in the primary cancer and directly invading surrounding organs, as well as long-distance metastasis along blood vessels or lymphatic vessels to other distant organs.

[0055] The present invention also relates to a method for treating cancer, comprising: intravenously administering the anticancer virus of the present invention to a patient who has previously been administered the anticancer virus of the present invention. These anticancer viruses can be administered to the patient in the form of the above-mentioned intravenous injection composition.

[0056] The present invention also relates to the use of intravenously administering the anticancer virus of the present invention to a patient who has previously been administered the anticancer virus of the present invention. These anticancer viruses can be administered to the patient in the form of the above-mentioned intravenous injection composition.

[0057] In the present invention, "a patient who has been previously administered the anti-cancer virus of the present invention" includes patients who have been administered 1, 2, 3, 4, 5, 6, 7 or more times, and refers to a subject having neutralizing antibodies against the anti-cancer virus of the present invention.

[0058] The present invention also relates to a composition for administering the anti-cancer virus of the present invention to a cancer patient who has been infected with vaccinia virus or a poxvirus of the same series (e.g., smallpox virus or monkeypox virus) or has been vaccinated with a vaccine for preventing infection with the virus, based on the excellent neutralizing antibody avoidance ability.

[0059] Specifically, when infected with a virus or vaccinated, neutralizing antibodies against the virus will be obtained through active immunization. When the human body is exposed to the virus again, the formed neutralizing antibodies bind to the viral antigens and inhibit reinfection. When a cancer patient has been infected with a virus or vaccinated, or has been administered an anti-cancer virus for therapeutic purposes, neutralizing antibodies against the anti-cancer virus will be formed, resulting in a continuous decrease in anti-cancer efficacy upon repeated administration, and eventually losing the anti-cancer efficacy. Since the anti-cancer vaccinia virus of the present invention avoids the neutralization reaction caused by viral antibodies, even for cancer patients who have been infected with poxviruses such as smallpox or monkeypox virus, vaccinated with vaccines to prevent infection by the virus, or previously administered an anti-cancer virus, repeated intravenous injections can be performed without a decrease in anti-cancer efficacy.

[0060] The composition comprises the contents of the composition for intravenous administration for repeated administration mentioned previously in the specification.

[0061] In addition, the present invention relates to a method or use for treating cancer, comprising the step of administering the anti-cancer virus of the present invention to a subject who has been infected with vaccinia virus or a poxvirus of the same series (eg, smallpox virus or monkeypox virus) or vaccinated.

[0062] As one embodiment to achieve the above-mentioned purpose, the present invention provides a method for preventing or treating cancer, which comprises administering to an individual a composition for repeated intravenous administration, which comprises an anticancer virus as an active ingredient, wherein: the expression of the thymidine kinase (TK) gene is suppressed; and the following genes are inserted: a gene encoding CD55 fused to the transmembrane domain region of the viral membrane protein so that the complement regulatory protein CD55 can be expressed on the membrane of mature virions (IMVs) in the cell, and a gene encoding granulocyte-macrophage colony stimulating factor (GM-CSF).

[0063] The term "composition" in the present invention is as described above.

[0064] The individual may be a mammal, specifically, a human, a cow, a sheep, a goat, a horse, a pig, a dog, a cat, a rabbit, a rat, a mouse, a fish, a bird, etc., but not limited thereto. In addition, the individual may be a subject who has been infected with vaccinia virus or a poxvirus of the same series (e.g., smallpox virus or monkeypox virus) or vaccinated, but not limited thereto.

[0065] In the present invention, the cancer treatment method includes a treatment method by combined administration with known anticancer agents and anticancer therapies.

[0066] As another embodiment to achieve the above object, the present invention provides use of a composition comprising the anti-cancer virus for preventing or treating cancer.

[0067] [Effects of the invention]

[0068] When the composition of the present invention is administered into the body, the neutralization reaction of antibodies to the virus can be avoided due to the expression of CD55, thereby making repeated intravenous administration of anti-cancer viruses possible, thereby preventing the reduction of anti-cancer efficacy caused by neutralizing antibodies and maximizing the anti-cancer effect.

Brief Description of the Figures

[0070] Figure 1 It is a schematic diagram of the recombinant vaccinia virus SJ-607 in which the J2R gene is deleted and human CD55 fused with human GM-CSF and the transmembrane domain is introduced.

[0071] Figure 2 Schematic diagram of the recombinant vaccinia virus mSJ-612 lacking the K2L and J2R genes and expressing mouse GM-CSF.

[0072] Figure 3 Schematic representation of mSJ-650, a recombinant vaccinia virus lacking the K2L and J2R genes and expressing human CD55 fused to mouse GM-CSF and the transmembrane domain.

[0073] Figure 4 The results are as follows: the neutralizing antibody titer was confirmed over time when the recombinant vaccinia virus SJ-607 of the present invention was intravenously administered to BALB / c mice.

[0074] Figure 5 The results are as follows: neutralizing antibody titers were confirmed over time when the control recombinant vaccinia virus JX-594 was intravenously administered to BALB / c mice.

[0075] Figure 6 The results are as follows: when the recombinant vaccinia virus SJ-607 of the present invention was intravenously administered to C57BL / 6 mice, the neutralizing antibody titer was confirmed over time.

[0076] Figure 7The results are as follows: neutralizing antibody titers were confirmed over time when the control recombinant vaccinia virus JX-594 was intravenously administered to C57BL / 6 mice.

[0077] Figure 8 These are the results of confirming the amount of antibodies produced against vaccinia virus JX-594 when JX-594 and SJ-607 were repeatedly intravenously administered to BALB / c mice.

[0078] Fig. 9 These are the results of confirming the amount of antibodies produced against the vaccinia virus SJ-607 when JX-594 and SJ-607 were repeatedly intravenously administered to BALB / c mice.

[0079] Fig.10 These are the results of measuring the neutralizing antibody titer against JX-594 or SJ-607 of antibodies against vaccinia virus present in the blood when JX-594 and SJ-607 were repeatedly intravenously administered to BALB / c mice.

[0080] Fig.11 These are the results of measuring the neutralizing antibody titer against JX-594 or SJ-607 of antibodies against vaccinia virus present in the blood when JX-594 and SJ-607 were repeatedly intravenously administered to C57BL / 6 mice.

[0081] Fig.12 These are the results of determining the tumor growth inhibitory efficacy when mSJ-650 expressing CD55 on the IMV membrane or mSJ-612 not expressing CD55 was repeatedly intravenously administered at low or high doses to a mouse breast cancer model.

[0082] Fig.13 The results are the results of measuring changes in body weight when mSJ-650 or mSJ-612 was repeatedly intravenously administered at low or high doses to a mouse breast cancer model.

[0083] Fig.14 The results are from repeated intravenous administration of mSJ-650 or mSJ-612 to a mouse breast cancer model, and the neutralizing antibody titers against mSJ-650 or mSJ-612 of antibodies against the virus formed in the blood were measured 3 weeks after the initial virus administration.

[0084] Fig.15 In order to harvest serum containing neutralizing antibodies against anti-cancer vaccinia virus, mSJ-650 was repeatedly administered intravenously to BALB / c mice, and the neutralizing antibody titers against mSJ-650 or mSJ-612 in the mouse blood were measured 4 weeks after the initial virus administration.

[0085] Fig.16The results are of measuring the tumor growth inhibitory efficacy in a mouse breast cancer model when serum containing neutralizing antibodies was administered to the tail vein of mice one day before virus administration, and mSJ-650 or mSJ-612 was repeatedly intravenously administered.

[0086] Fig.17 In a mouse breast cancer model, serum containing neutralizing antibodies was administered to the tail vein of mice one day before virus administration, and mSJ-650 or mSJ-612 was repeatedly administered intravenously, and the results were measured for changes in body weight.

[0087] Fig.18 The results are from a mouse breast cancer model in which the tumor growth inhibition efficacy was measured by repeated intravenous administration of mSJ-650 or mSJ-612 inducing the formation of neutralizing antibodies against vaccinia virus in individuals by pre-administering the virus.

[0088] Fig.19 The results are based on the results of measuring changes in body weight when mSJ-650 or mSJ-612 were repeatedly administered intravenously in a mouse breast cancer model, in which the virus was administered in advance to induce the formation of neutralizing antibodies against vaccinia virus in the individual.

[0089] Fig. 20 In a mouse breast cancer model, the virus was administered in advance to induce the formation of neutralizing antibodies against vaccinia virus in the individual, and mSJ-650 or mSJ-612 was repeatedly administered intravenously. The tumor size or weight was measured on the 21st day after tumor transplantation. [Specific implementation method]

[0090] Below, the constitution and effect of the present invention will be explained in more detail by examples. These examples are only used to illustrate the present invention and are not intended to limit its scope.

[0091] The present inventors prepared a vaccinia virus in which the expression of the thymidine kinase (TK) gene was suppressed, and a vector into which the following genes were inserted: a gene encoding a complement regulatory protein CD55 fused to the transmembrane domain region of a viral membrane protein so as to enable expression of CD55 on the membrane of intracellular mature virions (IMV) and a gene encoding a granulocyte-macrophage colony-stimulating factor (GM-CSF); a recombinant vaccinia virus in which the expression of the gene was induced was prepared by homologous recombination of the vector and the vaccinia virus, and when the recombinant vaccinia virus was administered in vivo, a neutralization reaction caused by the virus was avoided, thereby confirming that it could be administered repeatedly.

[0092] [Production Example 1: Production of recombinant vaccinia virus SJ-607 lacking the J2R gene and expressing human GM-CSF and human CD55]

[0093] like Figure 1As shown in FIG. 1 , a recombinant vaccinia virus was prepared by completely deleting the J2R region encoding thymidine kinase (TK) in the Wyeth strain of vaccinia virus and inserting genes encoding human CD55 (hCD55) and human GM-CSF (hGM-CSF) into the region. In addition, in order to express hCD55 on the IMV (intramural mature virus) membrane of the virus, the hCD55 gene except the GPI anchor region was fused with the transmembrane domain and the viral intraregion (C-terminal region) of the vaccinia virus membrane protein H3, and the promoter used for expression was pLate. The specific process is as follows.

[0094] [1.1. Preparation of plasmid vector for inducing expression of hGM-CSF and hCD55 genes]

[0095] To delete the J2R region of vaccinia virus, HiFi DNA Assembly Cloning Kit (NEWENGLAND BioLabs, Cat. No. M5520A) was used in T-blunt TM The J1R and J3R genes as the left and right flanking regions of the J2R region were cloned on a vector (Solgent). The corresponding positions of JX-594 (Pexastimogene Devacirepvec, Pexa-Vec, Pexa-Vec) were used as templates to PCR amplify the J1R and J3R DNA. The J1R is identical to the J1R (protein id = AAR17936.1) of the vaccinia virus Acambis2000 strain in the amino acid 1 to 154 region, but the double amino acid 118 is replaced from alanine to serine. J3R (protein id = AAR17938.1) is the amino acid 1 to 145 region. The shuttle vector was completed by cloning into the vector hGM-CSF (GenBank: M10663.1) expressed by the synthetic early-late promoter of vaccinia virus and the complement regulatory protein hCD55 gene (GenBank: NM_000574.3) expressed by the late promoter of vaccinia virus, as well as the transmembrane domain and the virion region of vaccinia virus H3L. The amino acid sequence and gene sequence of hCD55 and hGM-CSF used are shown in SEQ ID NOs: 1 to 4 in Table 2 below, respectively.

[0096]

Table 2

[0097]

[0098]

[0099] The transmembrane domain and the virion region of hGM-CSF and H3L were PCR amplified in JX-594, and hCD55 was cloned into the pCMV3 plasmid (Sinobio, catalog number: HG10101-UT) vector for PCR amplification. hGM-CSF (GenBank: M10663.1) is the region of amino acids 1 to 145, and is expressed using a synthetic early-late promoter (aaaaaattgaa attttattttttttttttgg aatataaata, SEQ ID NO: 5, pSEL, used for PCR amplification in Pexa-Vec). hCD55 (GenBank: NM_000574.3) is the region of amino acids 1 to 352 lacking the GPI anchor region, and the promoter used for expression is a synthetic late promoter (tttttttt ggcatataaa ta, SEQ ID NO: 6, pLate, commissioned by Macrogen). The 3′ end of the hCD55 gene was fused with the transmembrane domain and the viral body region of vaccinia virus H3L to express CD55 on the viral IMV membrane. The information and sequence of the transmembrane domain region of H3L used are shown in Tables 3 and 4.

[0100]

Table 3

[0101]

[0102]

Table 4

[0103]

[0104] [1.2. Production of SJ-607 recombinant vaccinia virus by homologous recombination]

[0105] SJ-607 recombinant vaccinia virus was produced by homologous recombination of wild-type vaccinia virus Wyeth strain with a previously prepared plasmid vector encoding hGM-CSF and hCD55 genes.

[0106] The wild-type Wyeth strain is prepared by inserting the J2R region gene of the Western Reserve (WR) strain of vaccinia virus (ATCC, catalog number: VR-1354) into the inert J2R region (TK region) of JX-594 (Pexastimogene Devacirepvec, Pexa-Vec). The J2R region gene of the Western Reserve (WR) strain (protein id = YP_232976.1) is the region of amino acids 1 to 178. The J2R region gene of the Western Reserve (WR) strain is PCR amplified, and the PCR product is homologously recombined with JX-594 to complete the wild-type Wyeth.

[0107] To recombinant SJ-607, 143B osteosarcoma cells (Creative Bioarray) were infected with the wild-type Wyeth strain and transfected with a plasmid vector expressing hGM-CSF and hCD55. To screen for recombinant virus SJ-607 plaques lacking the TK domain, cell lysates of 143B osteosarcoma cells infected with vaccinia virus and transfected with a plasmid vector were treated with the TK deficiency screening agent 5-bromo-2′-deoxyuridine (BrdU) and cultured. The selected recombinant virus plaques were subcultured twice again in 143B cells to obtain purified monoclonal SJ-607. The nucleotide sequence of the recombination site of SJ-607 was confirmed by sequencing.

[0108] Finally, the structure of SJ-607 manufactured in the manufacturing example is as follows Figure 1 shown.

[0109] [Production Example 2: Production of recombinant vaccinia virus mSJ-612 lacking K2L gene and J2R gene and expressing mouse GM-CSF]

[0110] like Figure 2 As shown, mouse GM-CSF (mGM-CSF) was inserted into the J2R region encoding thymidine kinase of the Wyeth strain of vaccinia virus to inactivate the expression of TK, and the K2L region encoding the serine protease inhibitor enzyme (serine protease inhibitor-3, SPI-3) was deleted to produce a recombinant vaccinia virus. The promoter used for the expression of mGM-CSF was the vaccinia virus promoter p7.5 (ccgtgcaata aattagaata tattttctac ttttacgaga aattattt tgtatttattatttatgggt gaaaaactta ctataaaaag cgggtgggtt tgga, SEQ ID NO: 7). The specific process is as follows.

[0111] 【2.1. Preparation of plasmid vector lacking K2L gene】

[0112] In order to delete the K2L region of vaccinia virus, the K1L, K3L and even K4L genes, which are the left and right flanking regions of the K2L region, were cloned into the T-blunt TMVector. Using the corresponding position of JX-594 (Pexastimogene Devacirepvec, Pexa-Vec) as a template, PCR amplification of K1L, K3L and even K4L DNA was performed. The K1L is identical to the amino acid 1-94 region of K1L (protein id = AAR17875.1) of the vaccinia virus Acambis2000 strain. K3L (protein id = AAR17877.1) is identical to the amino acid 1-88 region, and K4L (protein id = AAR17878.1) is identical to the amino acid 382-424 region.

[0113] [2.2. Production of mSJ-612 recombinant vaccinia virus by homologous recombination]

[0114] The mSJ-612 recombinant vaccinia virus was produced by homologous recombination of a Wyeth strain of vaccinia virus (provided by Gennerex) in which the expression of TK was inactivated by inserting mGM-CSF (GenBank: X02333.1) into the J2R region and a plasmid vector lacking the K2L region produced previously. The amino acid sequence and gene sequence of the mouse GM-CSF used are shown in SEQ ID NOs: 8 and 9 in Table 5 below, respectively.

[0115]

Table 5

[0116]

[0117] To recombinant mSJ-612, U-2OS osteosarcoma cells (ATCC) were infected with a virus in which mGM-CSF was inserted into the J2R region to inactivate the expression of TK, and a plasmid vector lacking the K2L region was transfected. Then, a recombinant virus mSJ-v612 lacking the K2L region was produced using a common method. The nucleotide sequence of the recombination site was confirmed by sequencing.

[0118] [Production Example 3: Production of recombinant vaccinia virus mSJ-650 lacking K2L gene and J2R gene and expressing mouse GM-CSF and human CD55]

[0119] The recombinant vaccinia virus mSJ-v650 is prepared by first deleting the K2L region encoding the Wyeth strain vaccinia virus serine protease inhibitor enzyme (SPI-3), and then inserting mGM-CSF and hCD55 into the J2R region encoding thymidine kinase (TK). Figure 3 ). In order to express hCD55 on the IMV membrane of the virus, the hCD55 gene except the GPI anchor region was fused with the transmembrane domain and the viral endogenous region of the vaccinia virus membrane protein H3. The promoter used for expression was pLate. The specific process is as follows.

[0120] 【3.1. Plasmid vector lacking K2L gene】

[0121] The plasmid vector used in the production of the recombinant virus in Production Example 2 was used.

[0122] 【3.2. Preparation of plasmid vector lacking J2R gene and encoding mouse GM-CSF and human CD55 gene expression】

[0123] A plasmid vector encoding mGM-CSF and hCD55 gene was prepared in the same manner as that used in the plasmid vector used to prepare the recombinant vaccinia virus in Preparation Example 1, except that mGM-CSF (GenBank: X02333.1) expressed by the vaccinia virus p7.5 promoter was used.

[0124] [3.3. Production of mSJ-650 recombinant vaccinia virus by homologous recombination]

[0125] The mSJ-650 recombinant vaccinia virus was produced by homologous recombination of the wild-type vaccinia virus Wyeth strain and a previously prepared plasmid vector lacking the K2L region, and then by homologous recombination of a plasmid vector encoding the mGM-CSF and hCD55 genes and deleting the J2R gene.

[0126] First, a recombinant vaccinia virus lacking the K2L region was produced by using the wild-type vaccinia virus Wyeth strain produced in Production Example 1 and the plasmid vector lacking the K2L region produced in Production Example 2, by the same method as in Production Example 2. Subsequently, the recombinant vaccinia virus lacking the K2L region was further lacked in the J2R gene, and homologously recombined with a plasmid vector encoding the mGM-CSF and hCD55 genes, to produce a recombinant vaccinia virus mSJ-650 lacking the K2L gene and the J2R gene and expressing mGM-CSF and hCD55 by the same method as in Production Example 1. The nucleotide sequence of the recombination site of mSJ-650 was confirmed by sequencing.

[0127] [Example 1: Confirmation of the formation of neutralizing antibodies after administration of SJ-607 to mice]

[0128] The recombinant vaccinia virus SJ-607 prepared in Preparation Example 1 was intravenously administered to the tail of BALB / c mice or C57BL / 6 mice (5×10 6pfu, single or 3 times at 1 week intervals). JX-594 (Pexa-vec) in which TK was inert and expressed hGM-CSF and Lac-Z was used as a control virus. Blood samples were collected from the orbital vein of the mice immediately before virus administration, and then blood samples were collected at 1 week intervals for 5 weeks (before virus administration, 7, 14, 21, 28 and 35 days after virus administration). The collected blood samples were placed at room temperature for 60 minutes and then centrifuged at 4°C to separate the serum. The separated serum was heat-treated at 56°C for 30 minutes to inertize the complement in the serum, and then it was determined whether neutralizing antibodies against JX-594 or SJ-607 were formed. The heat-treated serum was diluted 10 to 316, 228 times in cell culture medium and incubated with JX-594 or SJ-607 for 2 hours to allow the neutralizing antibodies against the anti-cancer vaccinia virus in the serum to neutralize the virus. U-2OS human osteosarcoma cells seeded in 96-well plates were infected with serum and diluted JX-594 or SJ-607 and incubated at 37°C for 3 days to observe the cell death effect. The survival rate of U-2OS cells 3 days after virus infection was evaluated by measuring the absorbance at 450 nm after treatment with Cell Counting Kit 8 (Dojindo). Neutralizing antibody titer (titer 50 ) was determined as the maximum dilution factor at which the viability of U-2OS cells was above 50%.

[0129] The results showed that in BALB / c mice, when SJ-607 anti-cancer vaccinia virus was intravenously administered, no significant neutralization response to SJ-607 occurred during all observation periods after administration, either under the conditions of single administration or three administrations at 1-week intervals ( Figure 4 ).

[0130] On the other hand, when JX-594 anti-cancer vaccinia virus was administered intravenously, it was confirmed that neutralizing antibodies began to form 2 weeks after administration, and the maximum value was measured at the 4th week when administered once; when administered three times at intervals of 1 week, the maximum value was measured at the 3rd week, and the maximum value was maintained until the 5th week after administration (the last observation time point). In addition, compared with a single administration, the neutralization efficacy was improved by more than 10 times under the condition of 3 times at intervals of 1 week ( Figure 5 ).

[0131] Similarly, in C57BL / 6 mice, when SJ-607 anti-cancer vaccinia virus was administered intravenously, no significant neutralization response to SJ-607 occurred until 35 days after administration, either in the case of a single administration or in the case of three administrations at 1-week intervals ( Figure 6 ).

[0132] On the other hand, it was confirmed that when JX-594 was administered intravenously to fight against vaccinia virus, neutralization efficacy was observed only in the fifth week of administration (the last observation time point) under the condition of single administration; when administered three times at intervals of one week, neutralization reaction to JX-594 began to appear from the second week of administration, and the maximum value was measured in the fourth week ( Figure 7 ).

[0133] [Example 2: Confirmation of whether antibodies against SJ-607 vaccinia virus are formed]

[0134] To determine whether antibodies against SJ-607 vaccinia virus were formed, 5 × 10 6 pfu, JX-594 anti-cancer vaccinia virus or SJ-607 anti-cancer vaccinia virus was administered 3 times at 1 week intervals. Blood samples were collected through the orbital vein of mice 3, 4 and 5 weeks after the initial administration of the virus, and the serum was separated by centrifugation at 4°C after standing at room temperature for 60 minutes. The separated serum was heat-treated at 56°C for 30 minutes to inert the complement in the serum. The antibodies against vaccinia virus present in the serum were quantified by enzyme-linked immunosorbent assay (ELISA). Transparent flat-bottomed immune 96-well plates were treated with vaccinia virus JX-594 or SJ-607 and incubated overnight at 4°C to coat the virus. The next day, the plate was blocked with 5% BSA, 0.05% Tween20 solution for 2 hours, and then the heat-treated serum diluted 10 to 100,000 times with PBS was placed at room temperature for 1 hour. To detect antibodies attached to vaccinia virus in the serum, an anti-mouse secondary antibody conjugated to HRP (Invitrogen, Catalog No. G21040) was reacted at room temperature for 30 minutes, treated with TMB substrate, and the activity of HRP was analyzed by absorbance at 450 nm.

[0135] As a result, antibodies against JX-594 vaccinia virus were produced to the same extent in mice repeatedly administered with JX-594 vaccinia virus and mice repeatedly administered with SJ-607 vaccinia virus ( Figure 8 ), antibodies against SJ-607 vaccinia virus were also produced to the same extent in mice repeatedly administered JX-594 and mice repeatedly administered SJ-607 ( Fig. 9 ). Therefore, it was confirmed that intravenous injection of anticancer vaccinia virus induced antibody formation against vaccinia virus at a similar level regardless of hCD55 expression on the IMV membrane.

[0136] [Example 3: Confirmation of the ability of SJ-607 to prevent neutralization of vaccinia virus antibodies]

[0137] To determine the ability of SJ-607 vaccinia virus to protect against neutralization of vaccinia virus antibodies, 5 × 106 pfu of JX-594 anticancer vaccinia virus or SJ-607 anticancer vaccinia virus were administered once or three times at 1-week intervals. Blood samples were collected from the orbital vein of mice 3 and 4 weeks after the initial administration of the virus, and the serum was separated by centrifugation at 4°C after standing at room temperature for 60 minutes. The separated serum was heat-treated at 56°C for 30 minutes to inert the complement in the serum. The neutralizing antibody titer assay was used to evaluate whether the vaccinia virus antibodies present in the blood of mice repeatedly administered intravenously with JX-594 neutralized JX-594 and SJ-607, and whether the vaccinia virus antibodies present in the blood of mice repeatedly administered intravenously with SJ-607 neutralized JX-594 and SJ-607. The heat-treated serum was diluted 10 to 316, 228 times with cell culture medium and incubated with JX-594 or SJ-607 for 2 hours to allow the neutralizing antibodies against the anticancer vaccinia virus in the serum to neutralize the virus. U-2OS human osteosarcoma cells seeded in 96-well plates were infected with serum and diluted JX-594 or SJ-607 and incubated at 37°C for 3 days to observe the cell death effect. The survival rate of U-2OS cells 3 days after virus infection was evaluated by measuring the absorbance at 450 nm after treatment with Cell Counting Kit 8 (Dojindo). The neutralizing antibody titer was determined as the maximum dilution factor at which the survival rate of U-2OS cells was above 50%.

[0138] The results showed that antibodies against vaccinia virus present in the blood of BALB / c mice injected with JX-594 vaccinia virus effectively neutralized JX-594, but no neutralization reaction against SJ-607 occurred to a similar extent as in the case of SJ-607 injection. On the other hand, antibodies against vaccinia virus present in the blood of mice injected with SJ-607 neutralized JX-594 vaccinia virus to a similar extent as in the case of JX-594 injection ( Fig.10 These results were also observed in C57BL / 6 mice ( Fig.11 ). Thus, antibodies against vaccinia virus are formed in mice injected with SJ-607 vaccinia virus, but unlike JX-594, SJ-607 vaccinia virus can avoid neutralization of vaccinia virus by antibodies.

[0139] [Example 4: Confirmation of anti-tumor efficacy by repeated intravenous administration in a breast cancer model]

[0140] 【4.1. Confirmation of tumor growth inhibition efficacy】

[0141] By dividing 2×10 5The mouse triple-negative breast cancer cell line EMT-6 was orthotopically transplanted into the mammary fat pad of pure BALB / c mice with complete immune function to establish a syngeneic orthotopic breast cancer model. 3 mSJ-612 (Manufacture Example 3) expressing CD55 on the virus IMV membrane or control virus mSJ-612 (Manufacture Example 2) not expressing CD55 was repeatedly intravenously administered to mice via the tail vein at intervals of 3 to 4 days twice a week to compare the tumor growth inhibitory effects of the viruses. mSJ-650 and mSJ-612 were administered at low concentrations (1×10 6 pfu) or high concentration (3×10 6 pfu) were administered intravenously.

[0142] On the 21st day after the initial administration of the virus, blood samples were collected through the orbital vein of the mice, and the serum was separated by standing at room temperature for 30 minutes and then centrifuged at room temperature for 5 minutes. The separated serum was heat-treated at 56°C for 30 minutes to inert the complement in the serum, and then whether neutralizing antibodies against mSJ-612 or mSJ-650 were formed. The heat-treated serum was diluted 10 to 316, 228 times with cell culture medium and then incubated with mSJ-612 or mSJ-650 for 2 hours to allow the neutralizing antibodies against anti-cancer vaccinia virus in the serum to neutralize the virus. U-2OS human osteosarcoma cells seeded on 96-well plates were infected with serum and diluted mSJ-612 or mSJ-650 and incubated at 37°C for 3 days to observe the cell death effect. After treatment with cell counting kit 8 (Dojindo), the survival rate of U-2OS cells 3 days after virus infection was evaluated by measuring the absorbance at 450nm. Neutralizing antibody titer was determined as the maximum dilution at which the U-2OS cell viability was above 50%

[0143] The results showed that both mSJ-612 and mSJ-650 showed significant tumor growth inhibition efficacy compared with the negative control (PBS). Specifically, repeated intravenous administration of mSJ-650 significantly inhibited tumor growth compared with repeated intravenous administration of mSJ-612 ( Fig.12 ). However, there was no significant difference in the weight changes of mice in all experimental groups ( Fig.13 ).

[0144] 【4.2. Confirmation of the ability to avoid neutralization reaction】

[0145] The mouse breast cancer EMT-6 tumor model was injected twice a week with 3×10 6pfu of anticancer virus were repeatedly intravenously administered, and the amount of neutralizing antibodies produced against mSJ-612 or mSJ-650 virus in the blood of mice was measured 21 days after the initial administration.

[0146] like Fig.14 As shown, a large amount of antibodies neutralizing mSJ-612 (average titer of 50 ≒5, 115.7), the neutralization capacity against mSJ-650 in the same sample was about 389.2 times lower than that of mSJ-612 (average potency 50 On the other hand, in mice to which CD55-expressing mSJ-650 was repeatedly administered, antibodies neutralizing mSJ-650 were formed to some extent in the blood (average titer 50 ≒25.7), but the neutralization capacity against mSJ-612 in the same sample was about 50.9 times lower (average titer 50 ≒1,308.9).

[0147] These results again indicate that vaccinia virus expressing CD55 is adequately challenged with antibodies against vaccinia virus, but virus expressing CD55 is able to avoid neutralization by these antibodies.

[0148] [Example 5: Confirmation of neutralizing antibody resistance of mSJ-650 anticancer virus upon repeated intravenous administration in a breast cancer model]

[0149] [5.1. Neutralizing antibody direct injection model]

[0150] To harvest serum containing neutralizing antibodies against anti-cancer vaccinia virus, 5 × 10 6 pfu anti-cancer vaccinia virus mSJ-650. Whole blood was collected from mice on the 28th day after the initial virus administration. The collected blood sample was allowed to stand at room temperature for 30 minutes, and then centrifuged at room temperature for 5 minutes to separate the serum. All the separated serum was mixed, aliquoted, and frozen at -80°C until use. The amount of neutralizing antibodies present in the serum was determined in the same manner as in Example 4.

[0151] The results showed that vaccinia virus antibodies present in the blood of mice could neutralize mSJ-612 (mSJ-650) at a level approximately 300 times higher. Fig.15 ).

[0152] On the other hand, in the mouse breast cancer model established in Example 4.1, when the tumor size reaches about 50-70 mm 3 3 × 10 6pfu were repeatedly intravenously administered with mSJ-650 expressing CD55 on the viral IMV membrane or control virus mSJ-612 not expressing CD55. In addition, to verify the ability to avoid the neutralization reaction of mSJ-650 anticancer virus, serum containing neutralizing antibodies harvested in advance was diluted with PBS and administered to the tail vein of mice 1 day before each administration of therapeutic anticancer virus, and the tumor growth inhibition efficacy was compared.

[0153] Results, such as Fig.16 As shown, in the case of administration of mSJ-650, regardless of whether serum containing antibodies against vaccinia virus was injected, significant tumor growth inhibition effect was shown compared with the negative control group (PBS) from the 9th day of tumor transplantation. On the other hand, it was confirmed that in the case of administration of mSJ-612, when serum containing antibodies against the virus was not injected, tumor growth inhibition effect was shown, but it was lower than the level of mSJ-650 administration, and when serum containing antibodies was injected, no tumor growth inhibition effect was shown at all. On the other hand, there was no significant difference in the weight change of mice in all experimental groups ( Fig.17 ).

[0154] [5.2. Model of neutralizing antibody formation induced by repeated virus injection]

[0155] Two weeks before tumor cell transplantation into immunocompetent BALB / c mice, 3 × 10 6 pfu of mSJ-650 virus were administered intravenously twice to induce the formation of antibodies against the virus. Two weeks after the initial virus administration, 2 × 10 5 A syngeneic orthotopic breast cancer model was established by orthotopic transplantation of a mouse triple-negative breast cancer cell line, EMT-6, into the mouse mammary fat pad. 3 3 × 10 6 pfu of mSJ-650 expressing CD55 or control virus mSJ-612 not expressing CD55 on the viral IMV membrane. Thus, the tumor growth inhibition efficacy of mSJ-650 anticancer virus or mSJ-612 virus was compared and evaluated in the group where the virus was administered before tumor transplantation to induce the formation of neutralizing antibodies against vaccinia virus in individuals and the group where the virus was not administered, and the ability to avoid the neutralization reaction of mSJ-650 anticancer virus was verified.

[0156] Results, such as Fig.18As shown, in the case of mSJ-650 administration, whether or not the virus was pre-administered, significant tumor growth inhibition efficacy was shown. On the other hand, in the case of mSJ-612 administration, when the virus was not pre-administered, tumor growth inhibition efficacy was shown, but it was lower than the level of mSJ-650 administration, and when the virus was pre-administered, no tumor growth inhibition efficacy was shown at all. On the other hand, there was no significant difference in the weight change of mice in all experimental groups ( Fig.19 ).

[0157] In addition, on the 21st day after EMT-6 mouse breast cancer cell transplantation, mice were killed, tumors were extracted and weighed. The results showed that compared with the negative control group (PBS) without virus injection, only in the group pre-injected with vaccinia virus and mSJ-612, tumor size did not show a difference, while in the remaining groups, tumor size was observed to be significantly reduced. Even when compared with the group not pre-injected with vaccinia virus and mSJ-612, the tumor size was significantly suppressed in the group pre-injected with vaccinia virus and mSJ-650. That is, regardless of whether the virus was pre-administered, the mSJ-650 group showed tumor growth inhibition efficacy, and proved that unlike the mSJ-612 group, the anti-cancer efficacy of the virus would not be reduced by neutralizing antibodies ( Fig. 20 ).

[0158] It can be understood from the above description that the technology to which the present invention belongs can be implemented in different specific forms without changing its technical ideas or basic features. In this regard, the above embodiments should be understood to be illustrative in all aspects, rather than restrictive. The scope of the present invention should be interpreted as including the meaning and scope of the patent claims described below and any changes or modifications derived from their equivalent concepts, rather than the above detailed description.

Claims

1. A composition for intravenous injection for repeated administration, comprising an anticancer virus as an active ingredient, wherein the anticancer virus: The expression of the thymidine kinase (TK) gene is inhibited; The following genes were inserted: A gene encoding CD55 which is fused to the transmembrane domain of a viral membrane protein so that the complement regulatory protein CD55 can be expressed on the membrane of an intracellular mature virion (IMV), and Gene encoding granulocyte-macrophage colony-stimulating factor (GM-CSF).

2. The composition for repeated intravenous administration according to claim 1, wherein The CD55 consists of the sequence of SEQ ID NO:

1.

3. The composition for repeated intravenous administration according to claim 1, wherein The membrane protein of the anticancer virus is: D8L, A16L, F9L, G9R, H3L, L1R, A9L, A13L, A21L, A28L, E10R, G3L, H2R, I2L, J5L, L5R or O3L.

4. The composition for repeated intravenous administration according to claim 1, wherein The anti-cancer virus is: vaccinia virus, adenovirus, herpes simplex virus, retrovirus, reovirus, Newcastle disease virus, coxsackie virus, enterovirus or herpes virus.

5. The composition for repeated intravenous administration according to claim 4, wherein The vaccinia virus is one of the following strains: Western Reserve (WR), NYVAC (New York vaccinia virus), Wyeth, LC16m8, Lister, Copenhagen, Tian Tan, USSR, TashKent, Evans, IHD-J (International Health Department-J) or IHD-W (International Health Department-White) strain.

6. The composition for repeated intravenous administration according to claim 1, wherein The composition is used to avoid the neutralization reaction of antibodies to the virus.

7. The composition for repeated intravenous administration according to claim 6, wherein The avoidance of the neutralization reaction is caused by the expression of CD55.

8. The composition for repeated intravenous administration according to claim 1, wherein The anticancer virus's serine protease inhibitor enzyme (SPI-3, Serine protease inhibitor-3) gene expression is inhibited.

9. A method for preventing or treating cancer, comprising administering the composition according to any one of claims 1 to 8 to an individual.

10. Use of the composition according to any one of claims 1 to 8 for preventing or treating cancer.

11. Use of the composition according to any one of claims 1 to 8 in the manufacture of a drug for preventing or treating cancer.

Images