Preparation method and application of recombinant adenovirus capable of spontaneously generating virus-like particles

Abstract

The invention discloses a preparation method and application of recombinant adenovirus capable of spontaneously generating virus-like particles, and relates to the technical field of biology. The preparation method of the recombinant adenovirus comprises the following steps: connecting a virus membrane protein gene with a budding promoting EARP gene to construct a recombinant exogenous virus membrane protein gene; inserting the recombinant exogenous virus membrane protein gene into an E3 region of an adenovirus skeleton plasmid to obtain a recombinant skeleton plasmid; inserting the recombinant exogenous virus membrane protein gene into an E1 region of an adenovirus shuttle plasmid to obtain a recombinant shuttle plasmid; and co-transfecting the recombinant skeleton plasmid and the recombinant shuttle plasmid to a host cell to obtain the recombinant adenovirus capable of spontaneously generating virus-like particles (VLP). The recombinant adenovirus constructed by the preparation method can spontaneously assemble the VLP containing the virus outer membrane protein in the in-vivo and in-vitro infection process, so that the immunogenicity of the vaccine can be greatly improved, the VLP production process is simplified, and the production cost of the vaccine is reduced.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for preparing a recombinant adenovirus capable of spontaneously generating virus-like particles and its application. Background Art

[0002] The continuous emergence of new infectious diseases has led to an urgent need for safe and efficient new vaccines. In recent decades, with the rapid development of genetic engineering, molecular cellular immunology, structural biology, bioinformatics, computational biology, nanotechnology, synthetic biology and other fields, new vaccine platforms such as mRNA, synthetic DNA, recombinant viral vectors, and virus-like particles (VLPs) have been gradually established and matured, and have shined during the fight against the COVID-19 pandemic.

[0003] Virus-like particles (VLPs) technology provides an alternative platform for developing effective vaccines to prevent and control infectious diseases, and has developed in parallel with mRNA and viral vector vaccines. VLPs are mostly nanoparticles formed by self-assembly of one or more viral structural proteins in vitro, and do not contain genetic material, which greatly improves the safety of such vaccines. VLPs can effectively stimulate humoral and cellular immune responses because their antigenic structure and spatial distribution are highly similar to their origin viruses. In addition, their morphology and size are highly variable, ranging from 20 to 200 nanometers. This size range allows the body to freely discharge them into lymph nodes and be more easily taken up by antigen presenting cells (APCs), especially dendritic cells (DCs), and then antigens are processed and presented through major histocompatibility complex (MHC) class II molecules. Under the current technical background, only a few structural proteins of non-enveloped viruses (such as HPV L1 protein, HBV surface antigen HBsAg, and norovirus VP1) can spontaneously assemble into VLPs. In contrast, most enveloped viruses cannot spontaneously form VLPs using only a single viral structural protein. Among them, the formation of influenza virus VLP requires the co-expression of matrix protein M1 and surface glycoprotein HA (hemagglutinin) or NA (neuraminidase); the new coronavirus needs to co-express spike protein S, membrane protein M and envelope protein E to form a complete VLP; Zika virus prM and E protein co-expression can form VLP; rabies virus VLP formation requires glycoprotein G and matrix protein M co-expression. The co-expression of multiple structural proteins makes the formation process of VLP more complicated. In the prior art, VLP is mainly developed by cloning viral structural protein genes into expression vectors and then expressing these genes in vitro in systems such as bacteria, yeast, mammalian cells and insect cells; the above expression systems have their own advantages but are slightly insufficient in some aspects. Some key challenges associated with VLPs include low stability, downstream processing difficulties, poor batch-to-batch stability, high production costs and high sensitivity to storage environmental conditions. Large-scale production and purification of VLPs require different processes, such as density gradients and even chromatography, to produce the final formulation product. These complex processes are costly and time-consuming. This also makes VLPs difficult to produce on an industrial scale and requires multiple quality control measures.

[0004] Compared with the complex construction process, high cost, cumbersome and complicated production quality control steps and strict storage and transportation conditions of in vitro self-assembled VLPs, adenovirus vectors have significant advantages such as high virus yield, low production cost, simple purification steps, stable physical and chemical properties and easy storage and transportation.

[0005] With the in-depth research and continuous exploration of adenovirus biology and immunology, various types of adenovirus vector vaccines continue to emerge. In the prior art, adenovirus vector vaccines mainly integrate exogenous genes into the E1 or E3 region of the adenovirus genome through reverse genetic technology, and express exogenous genes in target cells after infecting cells to stimulate the body to produce an immune response or perform gene therapy. For viral membrane proteins, the prior art can only express complete membrane proteins on the surface of infected cell membranes. However, the anchoring position of membrane proteins is limited, and the expression of membrane protein antigens alone on the cell surface may limit the large-scale expression of exogenous genes in adenovirus vector vaccines. In addition, the prior art can only produce membrane proteins in situ (immunization / injection site), and antigens cannot be recognized and bound by immune cells away from the injection site. Therefore, the vector vaccines produced by the prior art cannot maximize the body's immune potential.

[0006] In the prior art, virus-like particle vaccines face many problems such as complex construction process, difficult in vitro expression, difficult purification, cumbersome process, high production cost, poor batch stability, and harsh storage conditions. In addition, adenovirus vectors can only express complete exogenous membrane proteins on the surface of infected cell membranes, which limits the maximum advantage of such vector vaccines. Based on the advantages and disadvantages of adenovirus vectors and VLPs, the present invention intends to develop a method for preparing recombinant adenovirus that spontaneously produces virus-like particles, so as to simplify the VLP construction process and production process, reduce the production cost of vaccines, and significantly improve the immunogenicity of vaccines. Summary of the invention

[0007] The purpose of the present invention is to provide a method for preparing a recombinant adenovirus that spontaneously produces virus-like particles and its application, so as to solve the problems existing in the above-mentioned prior art. The recombinant adenovirus constructed by the preparation method can spontaneously assemble to form a VLP structure containing a virus membrane protein during in vivo and in vitro infection by expressing only a single modified virus membrane protein, so as to simplify the VLP construction process and production process, reduce the production cost of the vaccine, and at the same time greatly improve the immunogenicity of the vaccine.

[0008] To achieve the above object, the present invention provides the following solutions:

[0009] The present invention provides a method for preparing a recombinant adenovirus that spontaneously produces virus-like particles, comprising the following steps:

[0010] The exogenous viral membrane protein gene is connected with the EARP gene to construct a recombinant exogenous viral membrane protein gene;

[0011] Inserting the recombinant exogenous viral membrane protein gene into the E3 region of the adenovirus backbone plasmid to obtain a recombinant backbone plasmid;

[0012] Inserting the recombinant exogenous viral membrane protein gene into the E1 region of the adenovirus shuttle plasmid to obtain a recombinant shuttle plasmid;

[0013] The recombinant adenovirus that spontaneously produces virus-like particles is prepared according to any one of the following methods (1) to (3):

[0014] (1) co-transfecting the recombinant backbone plasmid and the recombinant shuttle plasmid into a host cell;

[0015] (2) co-transfecting the recombinant backbone plasmid and the adenovirus shuttle plasmid into host cells;

[0016] (3) co-transfecting the adenovirus backbone plasmid and the recombinant shuttle plasmid into host cells;

[0017] The nucleotide sequence of the EARP gene is shown in SEQ ID NO.17.

[0018] Exogenous viral membrane proteins include, but are not limited to, membrane proteins of enveloped viruses including Orthomyxoviridae, Flaviviridae, Retroviridae, Filoviridae, Rhabdoviridae, Herpesviridae, Coronaviridae, Paramyxoviridae, etc.

[0019] Adenoviral vectors include, but are not limited to, human adenovirus type 5.

[0020] Furthermore, the adenovirus backbone plasmid is a pBHGcre / loxp plasmid.

[0021] Furthermore, the adenovirus shuttle plasmid is a pDC315 plasmid.

[0022] Furthermore, the nucleotide sequence of the recombinant exogenous viral membrane protein gene is shown in any one of SEQ ID NO.29-31.

[0023] The present invention also provides a recombinant adenovirus that spontaneously produces virus-like particles, and the preparation method of the recombinant adenovirus comprises the following steps:

[0024] The exogenous viral membrane protein gene is connected with the EARP gene to construct a recombinant exogenous viral membrane protein gene;

[0025] Inserting the recombinant exogenous viral membrane protein gene into the E3 region of the adenovirus backbone plasmid to obtain a recombinant backbone plasmid;

[0026] Inserting the recombinant exogenous viral membrane protein gene into the E1 region of the adenovirus shuttle plasmid to obtain a recombinant shuttle plasmid;

[0027] The recombinant adenovirus that spontaneously produces virus-like particles is prepared according to any one of the following methods (1) to (3):

[0028] (1) co-transfecting the recombinant backbone plasmid and the recombinant shuttle plasmid into a host cell;

[0029] (2) co-transfecting the recombinant backbone plasmid and the adenovirus shuttle plasmid into host cells;

[0030] (3) co-transfecting the adenovirus backbone plasmid and the recombinant shuttle plasmid into host cells;

[0031] The nucleotide sequence of the EARP gene is shown in SEQ ID NO.17.

[0032] Furthermore, the nucleotide sequence of the recombinant exogenous viral membrane protein gene is shown in any one of SEQ ID NO.29-31.

[0033] Furthermore, the adenovirus backbone plasmid is a pBHGcre / loxp plasmid; and the adenovirus shuttle plasmid is a pDC315 plasmid.

[0034] The present invention also provides the use of the above-mentioned recombinant adenovirus in preparing a recombinant adenovirus vaccine.

[0035] The present invention also provides a recombinant adenovirus vaccine, comprising the above-mentioned recombinant adenovirus.

[0036] Furthermore, the recombinant adenovirus vaccine also includes pharmaceutically acceptable excipients.

[0037] The present invention discloses the following technical effects:

[0038] The present invention transforms the exogenous viral membrane protein gene by means of synthetic biology and inserts it into the E1 and E3 regions of adenovirus type 5. The recombinant adenovirus constructed by this method can spontaneously assemble the VLP structure of the inserted viral outer membrane protein during in vivo and in vitro infection.

[0039] The present invention combines the respective advantages of VLP and adenovirus vector platforms, while avoiding the disadvantages of both in the production and immunization processes, thereby greatly improving the immunogenicity of the vaccine, simplifying the VLP production process, reducing the production cost of the vaccine, and providing a theoretical basis and practical experience for the subsequent development of other types of vector vaccines that can produce virus-like particles in vivo and in vitro. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0041] Figure 1 Schematic diagram of recombinant adenovirus construction and VLP production before and after transformation;

[0042] Figure 2 is the growth curve of the recombinant adenovirus before and after transformation; A is Ad5-HA PR8 and Ad5-HA PR8 -VLP growth curve; B is Ad5-S JN.1 and Ad5-S JN.1 -VLP growth curve; C is Ad5-GP Zaire and Ad5-GP Zaire -VLP growth curve; D is the growth curve of Ad5-RVDG and Ad5-RVDG-VLP;

[0043] Figure 3 The results of the detection of exogenous gene expression of recombinant adenovirus in HEK293 cells; A and B are the Western Blot detection results and expression statistics of HA protein, respectively; C and D are the Western Blot detection results and expression statistics of Spike protein, respectively; E and F are the Western Blot detection results and expression statistics of GP protein, respectively; G and H are the Western Blot detection results and expression statistics of RVG protein, respectively;

[0044] Figure 4 Schematic diagram of the stratification of recombinant adenovirus and VLP after ultracentrifugation;

[0045] Figure 5 Transmission electron microscopy observation of virus-like particles;

[0046] Figure 6 Ad5-HA PR8 -The results of the hemagglutination activity assay of the ultrapurified product of the supernatant of VLP infected cells;

[0047] Figure 7 Ad5-HA PR8 Ad5-HA PR8 -VLP detection results of HA expression in cell lines of different species; A and B are the Western Blot detection results and expression statistics of HA on MDCK, respectively; C and D are the Western Blot detection results and expression statistics of HA on BSR, respectively; E and F are the Western Blot detection results and expression statistics of HA on CRFK, respectively;

[0048] Figure 8 Ad5-HA PR8 Ad5-HA PR8-Statistical graph of HA protein concentration in bronchoalveolar lavage fluid after VLP nasal instillation;

[0049] Fig. 9 The results are a comparison of the immunogenicity of VLP and soluble viral envelope protein; A is a comparison of the hemagglutination inhibition titer of influenza virus in mouse serum after immunization with HA-VLP and soluble HA-His protein; B is a comparison of the 50% pseudovirus neutralization titer of mice against the parental strain JN.1 after immunization with S-VLP and soluble S protein; C is a comparison of the 50% pseudovirus neutralization titer of mice against the Ebola Zaire strain after GP-VLP and GP immunization; D is a comparison of the neutralizing antibody titer against the rabies virus CVS-11 strain after RVG-VLP and RVG immunization;

[0050] Fig.10 Ad5-HA PR8 Ad5-HA PR8 -VLP immunogenicity and challenge protection evaluation results; A is muscle immunization Ad5-HA PR8 Ad5-HA PR8 -Comparison of hemagglutination inhibition titer of influenza virus in mouse serum after VLP; B is intranasal immunization with Ad5-HA PR8 Ad5-HA PR8 -VLP mouse serum influenza virus hemagglutination inhibition titer comparison results; C is the weight change record results of each group after influenza virus PR8 challenge 174 days after immunization; D is the statistical results of mouse survival rate after influenza virus PR8 challenge 174 days after immunization;

[0051] Fig.11 Ad5-S JN.1 Ad5-S JN.1 -VLP, Ad5-GP Zaire Ad5-GP Zaire -VLP, Ad5-RVDG and Ad5-RVDG-VLP immunogenicity comparison in mouse models; AD and JN.1 Ad5-S JN.1 -VLP immunization 14d and 84d after 50% pseudovirus neutralization titer comparison of JN.1 (Omicron), WA1 / D614G, BA.2.86 (Omicron) and B.1.617.2 (Delta) strains; E is the results of mice immunized with Ad5-GP Zaire Ad5-GP Zaire-VLP 7d and 84d after 50% pseudovirus neutralization titer against Ebola Zaire strain; F is the comparison of neutralizing antibody titer against rabies virus CVS-11 strain one year after mice were immunized with Ad5-RVDG and Ad5-RVDG-VLP; Fig.12 The results of protection against virus infection after immunization with Ad5-RVDG and Ad5-RVDG-VLP; A is the result of intracranial injection of 50×LD 360 days after immunization with Ad5-RVDG and Ad5-RVDG-VLP. 50 (median lethal dose) of rabies virus standard challenge strain CVS-24; B is the result of body weight change after Ad5-RVDG and Ad5-RVDG-VLP immunization at 360 days, intracranial injection of 50×LD 50 Statistical results of mouse survival rate after challenge with standard rabies virus strain CVS-24;

[0052] Fig.13 The results of dynamic detection of exogenous gene expression in vivo after immunization with recombinant adenovirus by different immunization methods; A is the result of dynamic monitoring of exogenous gene expression in vivo after hind limb muscle injection; B is the result of dynamic monitoring of exogenous gene expression in vivo after nasal drop immunization;

[0053] Fig.14 The graphs show the comparison of the immunogenicity of Ad5-RVDG and Ad5-RVDG-VLP in cat (A) and dog (B) models. DETAILED DESCRIPTION

[0054] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0055] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0056] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0057] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to the skilled artisan. The present invention description and examples are exemplary only.

[0058] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0059] The present invention uses synthetic biology to fuse 47 residues from the cytoplasmic tail of mouse Fcγ receptor FcRII with the active motif of human CEP55 protein that can recruit ESCRT pathway and ALIX protein by adding 2×GGGS flexible linker. The fusion protein is named EARP (ESCRT and ALIX recruit proteins, EARP), which replaces the intracellular domain of influenza virus (A / Puerto Rico / 8 / 1934) hemagglutinin protein (HA), and the HA gene before and after the transformation is inserted into the E1 and E3 regions of the adenovirus vector to rescue two recombinant adenoviruses (Ad5-HA PR8 and Ad5-HA PR8 -VLP), verified the expression of virus-like particle structure (HA-VLP) loaded with HA protein in vivo and in vitro, and verified the purified HA-VLP, Ad5-HA in mice PR8 and Ad5-HA PR8 -VLP immunogenicity. At the same time, in order to verify the versatility of this technology, the present invention also constructed recombinant adenoviruses expressing the spike protein (S) of the novel coronavirus JN.1 before and after modification (named: Ad5-S JN.1 and Ad5-S JN.1 -VLP), Ebola virus Zaire GP protein before and after expression modification (named as: Ad5-GP Zaire and Ad5-GP Zaire-VLP) and the recombinant adenovirus of the rabies virus vaccine strain SAD-L16 glycoprotein before and after modification (named: Ad5-RVDG and Ad5-RVDG-VLP, respectively), and verified the feasibility of the technology in various animal models such as mice, dogs, and cats. The technical solution involved in the present invention will be clearly disclosed in detail below:

[0060] Example 1

[0061] The present invention transforms four viral proteins, namely influenza virus HA protein, new coronavirus S protein, Ebola GP protein and rabies virus G protein, and takes influenza virus HA protein as an example to elaborate the transformation strategy in detail.

[0062] 1. Modification of viral envelope protein and rescue of recombinant adenovirus

[0063] 1.1 Amplification of gene fragments before viral envelope protein modification

[0064] The influenza virus (A / Puerto Rico / 8 / 1934, Gene ID: 956529) used in the present invention is preserved by this laboratory, and the templates used for subsequent gene amplification reactions are all derived from this virus cDNA; the S gene template of the SARS-COV-2 (JN.1) strain was purchased from Sino Biological Co., Ltd.; the EBOV GP gene is derived from the pCMV3-GP-C-Flag plasmid (Cat: VG40304-CF, Sino Biological Co., Ltd.); the rabies virus G gene (RVG) is derived from the SAD-L16 full genome plasmid preserved in this laboratory (the vaccine strain SAD-L16 and the SAD-L16 full genome plasmid have been disclosed in the document "Infectious rabies viruses from cloned cDNA").

[0065] Primers were designed for the above-mentioned viral envelope proteins, and homology arms to the pDC315 shuttle plasmid were added through the primers. The primer sequences are detailed in Table 1.

[0066] Table 1

[0067]

[0068]

[0069] After configuring the reaction system, the amplification conditions were set as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 58°C (annealing temperature selected according to primer Tm value) for 15 s, extension at 72°C for 90 s (extension time selected according to gene length), 35 cycles; final extension at 72°C for 5 min.

[0070] After the reaction was completed, the amplified gene fragments were recovered and named 315-HA, 315-S, 315-GP and 315-RVG, respectively. The nucleotide sequences are shown in SEQ ID NOs. 9-12, respectively.

[0071] 1.2 Gene fragment amplification after viral envelope protein modification

[0072] 1.2.1 Acquisition of EARP fusion gene

[0073] Primers were designed to amplify the cytoplasmic gene fragment of FcRII (Gene ID: 14130) protein from C57BL / 6 mouse spleen cells and fused it to the active motif of recruiting ESCRT and ALIX pathway in CEP55 (Gene ID: 55165) protein from human A549 (CCL-185, ATCC) cells. The fusion gene was named EARP.

[0074] The primer sequences used in the gene amplification process are as follows:

[0075] Mus-FcRII-B1-F: gctctcccaggaaaccctga (SEQ ID NO. 13);

[0076] Mus-FcRII-B1-R: agagccacctccgcctgaaccgcctccaccgtatgggctgatgcttgttg (SEQ ID NO. 14);

[0077] Homo-CEP55-F: ggttcaggcggaggtggctctttcaactcatcaataaataatatt (SEQ IDNO.15);

[0078] Homo-CEP55-R:TCAtgggagtgaatgagcagctgt (SEQ ID NO. 16).

[0079] The nucleotide sequence of the obtained fusion gene EARP is shown in SEQ ID NO.17.

[0080] 1.2.2 Fusion of viral envelope protein gene and EARP gene

[0081] Primers were designed to amplify the coding gene of HA protein (1-552aa) and EARP gene respectively:

[0082] PR8-HA 1-552aa -F:atgaaggcaaacctactggt(SEQ ID NO.18);

[0083] PR8-HA1-552aa -R: tcagggtttcctgggagagcccagaaactgattgccccca (SEQ ID NO. 19).

[0084] After configuring the reaction system, the amplification conditions were set: 95°C pre-denaturation for 5 min; 95°C denaturation for 15 s, 58°C annealing for 15 s, 72°C extension for 90 s, 35 cycles; 72°C final extension for 5 min. After the reaction, gel recovery was performed, and the recovered gene was named HA 1-552aa .

[0085] EARP-F: gctctcccaggaaaccctga (SEQ ID NO. 20);

[0086] EARP-R: ctatggggagtgaatgagcagc (SEQ ID NO. 21).

[0087] After configuring the reaction system, the amplification conditions were set: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 40 s, 35 cycles; final extension at 72°C for 2 min.

[0088] After the reaction is completed, the glue is recovered.

[0089] After the recovery, the concentration was measured, and 100 ng of both genes were added. The amplification conditions were set as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 15 s, 56°C annealing for 15 s, 72°C extension for 100 s, 6 cycles; 72°C final extension for 5 min. After the end, PR8-HA was added 1-552aa -F / EARP-R upstream and downstream primers 2 μL each. Amplification conditions were set as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 15 s, 56°C annealing for 15 s, 72°C extension for 100 s, 30 cycles; 72°C final extension for 5 min. The recovered fusion gene was named HA 1-552aa -EARP, the nucleotide sequence is shown in SEQ ID NO.22.

[0090] Similar to the above operation, the following primers were designed to amplify the target protein S 1-1232aa , GP 1-672aa and RVG 1-480aa The primer sequences are shown in Table 2.

[0091] Table 2

[0092]

[0093] The amplified genes were recovered and named S 1-1232aa Gene, GP 1-672aaGene and RVG 1-480aa The above gene was fused with the EARP gene by PCR and the recovered gene was named S 1-1232aa -EARP、GP 1-672aa -EARP and RVG 1-480aa -EARP, the nucleotide sequences are shown in SEQ ID NO.29-31 respectively.

[0094] HA 1-552aa -EARP, S 1-1232aa -EARP、GP 1-672aa -EARP and RVG 1-480aa -EARP gene was used as a template, 2 μL of upstream and downstream primers were added, and the homology arms of the pDC315 plasmid were introduced into the fusion gene through the primers and the Kozak sequence was introduced before the gene start codon. The primer sequences are shown in Table 3.

[0095] Table 3

[0096]

[0097] After configuring the reaction system, the amplification conditions were set: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 59°C for 15 s, extension at 72°C for 100 s, 35 cycles; final extension at 72°C for 5 min.

[0098] The amplified fragments were recovered and named 315-HA 1-552aa -EARP, 315-S 1-1232aa -EARP, 315-RVG 1-480aa -EARP and 315-GP 1-672aa -EARP.

[0099] 1.3 Construction of pDC315-exogenous gene plasmid

[0100] The adenovirus reverse genetics system mainly includes shuttle plasmid pDC315 and backbone plasmid pBHGcreloxp. The viral envelope protein genes before and after transformation are constructed into the shuttle plasmid pDC315.

[0101] According to the system shown in Table 4, the plasmid pDC315 (purchased from Microbix Biosystems Inc.) was double-digested with EcoR I / NheI, reacted in a 37° C. water bath for 30 min, and nucleic acid electrophoresis was performed to recover the vector fragment.

[0102] Table 4

[0103]

[0104] According to the instructions of ClonExpress II One Step Cloning Kit (C112-01), the target fragments (315-HA, 315-HA 1-552aa -EARP, 315-S, 315-S 1-1232aa -EARP, 315-RVG, 315-RVG 1-480aa -EARP, 315-GP and 315-GP 1-672aa -EARP) was connected with the restriction vector (the reaction system is shown in Table 5), and then transformed into XL-10 (Shanghai Maokang Biotechnology Co., Ltd.), placed on ice for 30 minutes, heat-shocked in a 42°C water bath for 90 seconds, plated, and selected for sequencing. The correct cloned strain was selected for expansion, and the plasmid was extracted using the omega endotoxin removal kit to obtain the shuttle plasmids pDC315-HA and pDC315-HA, respectively. 1-552aa -EARP, pDC315-S, pDC315-S 1-1232aa -EARP, pDC315-RVG, pDC315-RVG 1-480aa -EARP, pDC315-GP, and pDC315-GP 1-672aa -EARP, after measuring the concentration, store at 4℃ for future use.

[0105] Table 5

[0106]

[0107] 1.4 Construction of pBHGcre / loxP backbone plasmid

[0108] 1.4.1 Pac I digestion of pBHGcre / loxp backbone plasmid

[0109] The restriction enzyme reaction system was configured as shown in Table 6, and the backbone plasmid pBHGcre / loxp (purchased from Microbix Biosystems Inc.) was subjected to restriction enzyme reaction.

[0110] Table 6

[0111]

[0112]

[0113] Enzyme digestion reaction: 37℃ water bath for 30min. The reaction product was recovered using Omega CP recovery kit and then purified by NanoDrop TM One / One C micro-volume UV-Vis spectrophotometer was used to detect the concentration of recovered nucleic acids.

[0114] 1.4.2pDC315-viral envelope protein expression cassette gene amplification

[0115] pDC315-HA, pDC315-HA 1-552aa -EARP, pDC315-RVG, pDC315-RVG 1-480aa -EARP plasmid was used as a template, and the two ends of the expression cassette were amplified and the fragments were recovered by adding the Pac I site homology arms (30 bp) of the backbone plasmid.

[0116] E3PacI-F: cttggattacatcaagatcctctagttaatGAGTCATTAGGGACTTTCCAATG (SEQ IDNO.37);

[0117] E3PacI-R: atagatccccgggtactctagttaGATCCAGACATGATAAGATAC (SEQ ID NO. 38).

[0118] The expression cassette was cloned into the E3 region of the linearized backbone plasmid using the NEBuilder HiFi DNA Assembly Cloning Kit (E5520s).

[0119] Configure the recombinant system shown in Table 7:

[0120] Table 7

[0121]

[0122] After mixing the samples, put them into the PCR instrument at 50℃ for 1h.

[0123] The recombinant product was transformed into stable 3 competent state (Shanghai Angyu Biotechnology Co., Ltd., G6009-10), plated, and selected for sequencing. The correct cloned strain was selected for expansion, and the plasmid was extracted according to the instructions of the Omega Endotoxin Removal Kit. After measuring the concentration, it was stored at 4°C for future use.

[0124] According to the different exogenous genes introduced into the E3 region, the recombinant backbone plasmids were named pBHGcre / loxp-HA and pBHGcre / loxp-HA. 1-552aa -EARP, pBHGcre / loxp-RVG and pBHGcre / loxp-RVG 1-480aa -EARP.

[0125] 1.5 Rescue and identification of recombinant adenovirus

[0126] One day in advance, HEK293 cells (Hunan Fenghui Biotechnology Co., Ltd.) were seeded into 6-well plates and the cells were plated until the confluence reached 80%. The instructions are as shown in Table 8 for co-transfection of the backbone plasmid and the shuttle plasmid. Figure 1 shown.

[0127] Table 8

[0128]

[0129]

[0130] 6 hours after transfection, the 2% FBS maintenance medium was replaced. Depending on the cell status, full or half medium replacement was selected. On the eighth day after transfection, the supernatant was collected and inoculated into new HEK293 cells. The cells were blindly propagated for 10 generations and frozen and thawed three times. The titers of the 8 virus strains were measured.

[0131] 2. Study on the growth characteristics of recombinant adenovirus before and after transformation

[0132] To explore whether the exogenous gene modification affects the growth characteristics of the recombinant adenovirus, the above 8 recombinant adenoviruses (shown in Table 8) were inoculated into HEK293 cells in a 12-well plate at MOI = 0.1. After 1 h, the cells were washed twice with PBS, and 2% FBS was added to maintain the culture medium. The supernatant was collected at 12 h, 24 h, 48 h, 60 h, 72 h, 84 h, and 96 h after infection, and the growth curves of the 8 recombinant viruses were determined.

[0133] like Figure 2 As shown, there was no significant difference in the growth characteristics of the recombinant virus after modification compared with those before modification, proving that the insertion of the EARP gene would not affect the growth characteristics of the recombinant adenovirus.

[0134] 3. Western Blot Verification of Recombinant Adenovirus Exogenous Gene Expression

[0135] Eight recombinant adenovirus strains (shown in Table 8) were inoculated into HEK293 cells at an MOI of 0.1. After 48 hours of infection, 500 μL of cell supernatant was collected, and the infected cell protein sample was extracted at the same time. After adjusting the protein concentration, Loading Buffer was added and boiled in boiling water for 10 minutes. The expression of viral envelope protein in cells and supernatant was detected by Western Blot.

[0136] The results are as follows Figure 3 As shown, Ad5-HA PR8 -VLP, Ad5-S JN.1-VLP and Ad5-RVDG-VLP after HEK293 infection with viral envelope proteins (HA-VLP, S-VLP and RVG-VLP) can be detected in the cell culture supernatant, and the envelope protein expression detected in the cell lysate was 2 times, 1.8 times and 1.58 times lower than that of Ad5-HAPR8, Ad5-S JN.1 and Ad5-RVDG infection groups, respectively. In addition, although the expression of GP was detected in the supernatant of cells infected with Ad5-GP and Ad5-GP-VLP, the expression of GP in the Ad5-GP-VLP infection group was significantly higher than that in the Ad5-GP infection group.

[0137] In summary, all eight recombinant adenovirus strains can express exogenous viral envelope proteins, and more exogenous viral proteins can be detected in the cell infection supernatant after the modification of the recombinant adenovirus.

[0138] Example 2

[0139] Purification and identification of virus-like particles in the supernatant of cells infected with the modified recombinant adenovirus:

[0140] 1. Amplification of recombinant adenovirus and purification of virus-like particles in the supernatant

[0141] The four recombinant adenoviruses (Ad5-S JN.1 -VLP, Ad5-RVDG-VLP, Ad5-HA PR8 -VLP and Ad5-GP Zaire -VLP) were inoculated into suspended 293 cells (Zhuhai Kairui Biotechnology Co., Ltd.), and the virus solution was collected after 72 hours. After freezing and thawing once, the virus solution was centrifuged at 4°C, 6000r / min for 30 minutes, and the supernatant was discarded and the cell pellet was discarded. The supernatant was added to a 38.5mL ultracentrifuge tube (Cat: 75000471, Thermofisher), and 3mL of 20% sucrose cushion was added to the bottom of the ultracentrifuge tube. Set the centrifugation parameters: 4°C, 25000r / min, and centrifuge for 2 hours. Discard the supernatant and add 6mL of DMEM to dissolve the precipitate overnight. The next day, the dissolved precipitate was passed through 54%-40%-25%-15% OptiPrep TM Density gradient medium (Cat: D1556, Merck). Set the centrifugation parameters: 4°C, 30000r / min, and collect the virus-like particle layer (15%-25%) and the virus layer (40%-54%) after centrifugation for 3 hours. Figure 4 As shown, 40%-54% OptiPrep TM The virus layer is between 15%-25% OptiPrep TM There is a protein layer in between.

[0142] 2.2 Transmission electron microscopy observation results of virus-like particles

[0143] Negative staining samples of HA-VLP, S-VLP, GP-VLP and RVG-VLP were prepared according to the conventional method. Simply, 10 μL of the sample to be tested was pipetted onto a 300-mesh copper mesh, and after standing at room temperature for 5 minutes, the sample was carefully aspirated and 10 μL of phosphotungstic acid negative staining solution was added. After standing at room temperature for 2 minutes, the sample was rinsed in PBS three times to remove the excess staining solution. Subsequently, the sample was placed under a transmission electron microscope for observation. The results are shown in Figure 2. Figure 5 As shown, double-layer vesicle structures with diameters ranging from 90-120 nm were observed under electron microscopy.

[0144] 2.3 HA-VLP hemagglutination activity assay

[0145] Influenza virus HA protein can agglutinate chicken red blood cells. To explore whether the purified HA-VLP also has hemagglutination activity, 25 μL PBS was added to each well of a 96-well V-shaped plate, and the culture supernatant of 293 suspension (negative control), PR8 strain (positive control), Ad5-HA PR8 -Purified supernatant after VLP infection and Ad5-HA PR8 25 μL of the purified supernatant after infection was diluted two-fold using an 8-channel pipette. After the dilution was completed, 25 μL of 1% chicken red blood cells was added. After standing at room temperature for 30 minutes, the hemagglutination activity of each sample was determined.

[0146] The results are as follows Figure 6 As shown, uninfected and Ad5-HA PR8 The ultrapurified products from the supernatant of infected cells could not agglutinate chicken erythrocytes. PR8 -VLP and the positive control PR8 influenza virus can agglutinate chicken erythrocytes.

[0147] Example 3

[0148] Since the EARP sequence is obtained by fusion of different human and mouse genes, it can help the modified viral envelope protein to spontaneously assemble into virus-like particle structures in human HEK293 cells. However, it is not clear whether virus-like particles can be produced in cells of other species. Therefore, taking the influenza virus protein HA as an example, we verify whether the recombinant adenovirus before and after modification can produce HA-VLP in cell lines of different species:

[0149] Ad5-eGFP and Ad5-HA were added at MOI=5. PR8 Ad5-HA PR8-VLP were inoculated into MDCK (Stock No#CCL-34, ATCC), BSR (derived from BHK-21 cells), and CRFK (Stock No#CCL-94, ATCC), respectively, with 3 replicate wells in each group. After 48 hours, the cell supernatant and cell samples were collected, and the protein samples were prepared, and the HA protein expression was detected by Western blot.

[0150] The results are as follows Figure 7 As shown, Ad5-HA PR8 -HA expression can be detected in the supernatant of MDCK, BSR, and CRFK cells infected with VLP, and the expression of HA in cell lysates is reduced. PR8 The expression of HA protein was not detected in the supernatant of infected MDCK, BSR and CRFK cells. This example demonstrates that the modified recombinant adenovirus can also produce virus-like particles in canine, feline and mouse cell lines.

[0151] Example 4

[0152] Influenza virus is a respiratory pathogen, and recombinant adenovirus vectors have also been shown to be immunized by nasal drops. To verify whether the modified recombinant adenovirus can produce VLPs in vivo, we used influenza virus protein HA as an example to verify Ad5-HA PR8 -Can HA-VLP expression be detected in bronchoalveolar lavage fluid after intranasal immunization with VLP strains?

[0153] Six-week-old female ICR mice were inoculated intranasally for 10 7 TCID 50 / 40μLAd5-eGFP, Ad5-HA PR8 Ad5-HA PR8 -VLP, 5 mice per group, 72h after immunization, the mice were euthanized, the neck of the mice was aseptically dissected to expose the trachea, a transverse cut was made in the larynx with scissors, an 8-gauge straight gavage needle was inserted, the gavage needle was fixed with suture knots, and 500μL sterile PBS was injected with a 1mL syringe. After gently squeezing the lungs for 15s, the alveolar lavage fluid was drawn out, and the above steps were repeated. The lavage fluid was centrifuged at 4℃, 12000r / min for 10min, and the supernatant was collected. The HA protein content in the alveolar lavage fluid was determined by ELISA kit (Cat: KIT11684, Sino Biological).

[0154] The experimental results are as follows Figure 8 As shown, Ad5-HA PR8 -The HA protein concentration in the bronchoalveolar lavage fluid of the VLP nasal drop group was as high as 290ng / mL, which was Ad5-HA PR8 The expression of HA was 34 times of that in the nasal drops group, and no HA expression was detected in the Ad5-eGFP nasal drops group.

[0155] This example demonstrates that the modified recombinant adenovirus can also spontaneously form VLPs in vivo.

[0156] Example 5

[0157] The immunogenicity of VLPs spontaneously produced by the modified recombinant adenovirus is much better than that of soluble proteins:

[0158] To verify the Ad5-HA PR8 -Whether the HA-VLP produced during the VLP amplification process is immunogenic, 6-week-old female ICR mice were immunized in the hind limb muscles with 10 μg / 100 μL of purified HA-VLP and soluble protein HA-His added with AS03 adjuvant (Cat. No#vac-as0310, InvivoGen), 10 mice in each group. Blood was collected from the orbital vein at designated time points after immunization, and the influenza virus hemagglutination inhibition titer was determined after the serum was collected. Fig. 9 As shown in A, at 4 days after immunization, two mice in the HA-VLP immunization group had hemagglutination inhibition titers reaching 2 3 , reaching its peak 14 days after immunization, with an average value of 2 9.5 , and it lasted for 174 days. At 14 days, the hemagglutination inhibition titer of the HA-His immune group was 2 6.5 , which is much lower than that of the HA-VLP immunization group, and it cannot inhibit the agglutination of influenza virus to red blood cells 35 days after immunization, and the antibody duration is short. The experimental results show that the immunogenicity of ultrapurified HA-VLP is much higher than that of soluble protein HA-His.

[0159] Similarly, to verify whether S-VLP, GP-VLP and RVG-VLP are immunogenic, 6-week-old female ICR mice were used to immunize the hind limb muscles with 10 μg / 100 μL purified VLPs and added with GEL02 adjuvant (MONTANIDE TM GEL 02, SEPPIC) S-VLP, GP-VLP and RVG-VLP with soluble protein S (Cat: 40589-V08H59, Sino Biological), GP (Cat: 40304-V08B1, Sino Biological) and RVG (Cat: 40997-VNAH3, Sino Biological). Blood was collected from the orbital vein 14 days and 84 days after immunization, and serum was collected to measure virus-specific neutralizing antibodies.

[0160] SARS-COV-2 pseudovirus neutralization experiment proves ( Fig. 9 B), 50% pseudovirus neutralization titer (pVNT) at 14d and 84d after S-VLP immunization 50) were 728 and 595, respectively, which were 5.1 times and 6.6 times that of the soluble S protein immunization group.

[0161] Ebola virus pseudovirus neutralization experiment proves ( Fig. 9 Middle C), pVNT at 14 and 84 days after GP-VLP immunization 50 They were 799 and 552 respectively, which were 9.1 times and 13.3 times that of the soluble GP protein immunization group.

[0162] The rabies virus fluorescent antibody neutralization test (FAVN) showed that Fig. 9 D), 14 days after immunization with soluble protein RVG, only 3 mice had neutralizing antibody values ​​exceeding 0.5 IU / mL (virus protection value), and 84 days after immunization, 90% of the immunized mice had antibodies below 0.5 IU / mL; 14 days after immunization, the neutralizing antibody values ​​of the RVG-VLP immunization group were much higher than 0.5 IU / mL, with an average of 19.23 IU / mL, which decreased slightly 84 days after immunization, with an average of 16.55 IU / mL.

[0163] In summary, this example confirms that the virus-like particles spontaneously formed by cells infected in vitro by the modified recombinant adenovirus can induce the body to produce neutralizing antibodies against viral protective antigens after immunizing mice, and the immunogenicity is far superior to the soluble protein expressed in vitro.

[0164] Example 6

[0165] Horizontal comparison of Ad5-HA PR8 Ad5-HA PR8 -VLP immunogenicity and challenge protection evaluation:

[0166] Six-week-old female ICR mice were injected intramuscularly with 10 7 TCID 50 / 100μLAd5-HA PR8 Ad5-HA PR8 -VLP, 10 in each group, compare the hemagglutination inhibition titers of the two groups of sera against influenza virus. Explore whether the production of HA-VLP enhances the immunogenicity of adenovirus vector vaccines.

[0167] At the same time, in order to verify the mucosal immune effect of the two recombinant adenoviruses before and after transformation, six-week-old female ICR mice were immunized with intranasal drops for 10 7 TCID 50 / 40μLAd5-HA and Ad5-HA PR8-VLP, 10 mice in each group, orbital venous blood was collected weekly, serum was separated, influenza virus hemagglutination inhibition titer was determined, and the immune effects of the two groups were compared.

[0168] In the muscle immunity model ( Fig.10 Middle A), Ad5-HA PR8 -4 days after VLP immunization, 40% of mice rapidly produced influenza virus neutralizing antibodies, with hemagglutination inhibition titer reaching 2 2 7 days after immunization, the average hemagglutination titer reached 2 8.9 , reaching a peak value 14 days after immunization 11.6 After 14 days, the hemagglutination inhibition titer showed a slow downward trend, and the titer was still as high as 2 at 174 days after immunization. 10.2 ; Ad5-HA PR8 4 days after immunization, all mice did not produce influenza virus neutralizing antibodies. 7 days after immunization, the antibody conversion rate reached 100%, and the average hemagglutination titer was 2 7.5 , reaching a peak value 14 days after immunization 10.5 After 14 days, the hemagglutination inhibition titer also showed a slow downward trend, reaching 2 on day 174 after immunization. 8.6 174 days after immunization, nasal drip challenge for 10 4 PFU PR8 strain was continuously monitored for 12 days for changes in body weight and survival rate. Fig.10 As shown in C and D, Ad5-HA PR8 -VLP and Ad5-HA PR8 In the immunized group, the body weight of mice decreased significantly within 4 days after challenge, but Ad5-HA PR8 -VLP decreased more slowly, and the time required to restore the original body weight was shorter (11 days). In addition, the mortality rate of mice in the blank immunization group after challenge was 100%, while Ad5-HA PR8 -VLP immunization group all survived after challenge, while Ad5-HA PR8 The survival rate of the immunized group after challenge was 90%. PR8 -VLP can stimulate the body to produce neutralizing antibodies in the early stage of immunization, that is, 4 days after immunization. The highest hemagglutination inhibition titer is Ad5-HA PR8 2.14 times of the immune group, and Ad5-HA PR8 -VLP has more advantages in long-term immune protection.

[0169] In the intranasal immunization model ( Fig.10 In B), regardless of Ad5-HA PR8 -VLP or Ad5-HA PR8 In the immunization group, Ad5-HA could not stimulate the body to produce influenza virus-specific neutralizing antibodies in the early stage of immunization (4d, 7d). PR8-The antibody conversion rate of the VLP immunization group reached 100%, and the average hemagglutination inhibition titer reached 2 5.7 ; Ad5-HA PR8 The antibody conversion rate of the immunized group was 90%, and one mouse did not produce influenza virus-specific neutralizing antibodies after immunization. PR8 -VLP and Ad5-HA PR8 The hemagglutination inhibition titer of the immunized group reached its peak at 28 days and 35 days after immunization, respectively. 9.3 and 2 6.2 After reaching the peak, the hemagglutination inhibition titer of each immunization group showed a slow downward trend. At 174 days after immunization, the titers were 2 7.8 and 2 4.9 174 days after immunization, nasal drip challenge for 10 4 PFU PR8 strain was continuously monitored for 12 days for changes in body weight and survival rate. Fig.10 As shown in C and D, Ad5-HA PR8 -VLP and Ad5-HA PR8 The weight of mice in the immunized group decreased significantly within 5 days after the challenge, but the weight loss was milder than that after intramuscular immunization. In addition, the mortality rate of mice in the blank immunized group after the challenge was 100%, and the Ad5-HA PR8 -VLP immunization group all survived after challenge, while Ad5-HA PR8 The survival rate of the immunized group after challenge was 80%. In general, in the intranasal immunization model, the production of influenza virus-specific neutralizing antibodies in the serum was more delayed and lower than that in the muscle immunization model; the challenge protection results showed that the weight loss of mice challenged with virus after intranasal immunization was more moderate than that after muscle immunization.

[0170] In summary, in the influenza virus model, the modified strain Ad5-HA PR8 -VLP is more resistant to the parent strain Ad5-HA PR8 It has better immunogenicity and is more advantageous in terms of long-lasting immune protection.

[0171] Example 7

[0172] Ad5-S JN.1 Ad5-S JN.1 -VLP, Ad5-GP Zaire Ad5-GP Zaire Comparison of immunogenicity of -VLP, Ad5-RVDG and Ad5-RVDG-VLP in mouse model:

[0173] Since the new coronavirus is a respiratory pathogen, nasal drops are used for immunization. Ebola and rabies viruses are immunized by intramuscular injection to compare their immunogenicity.

[0174] Six-week-old female ICR mice were immunized intranasally for 10 7 TCID 50 / 40μLAd5-S JN.1 Ad5-S JN.1 -VLP, 8 mice in each group, blood was collected from the orbital vein 14d and 84d after immunization, and the 50% pseudovirus neutralization titer after immunization was determined by pseudovirus neutralization test after serum collection.

[0175] Six-week-old female ICR mice were immunized by intramuscular injection of the hind limb for 10 7 TCID 50 / 100μL Ad5-GP Zaire Ad5-GP Zaire -VLP, 8 mice in each group, blood was collected from the orbital vein 7d and 84d after immunization, and the 50% pseudovirus neutralization titer after immunization was determined by pseudovirus neutralization test after serum collection.

[0176] Six-week-old female ICR mice were immunized by intramuscular injection of the hind limb for 10 7 TCID 50 / 100μL Ad5-RVDG and Ad5-RVDG-VLP, 10 mice in each group, orbital venous blood was collected at designated time points after immunization, and rabies virus neutralization antibodies were monitored by the fluorescent antibody virus neutralization test (FAVN) after serum was collected. The immune monitoring period was one year.

[0177] like Fig.11 As shown in A, the SARS-COV-2 pseudovirus neutralization experiment proved that Ad5-S JN.1 -50% pseudovirus neutralization titer (pVNT) of the parental strain JN.1 at 14 and 84 days after VLP immunization 50 ) were 3514 and 67537, respectively, for Ad5-S JN.1 2.2 and 2.7 times of the immunized group; Ad5-S JN.1 -VLP immunization 14d, 84d after immunization, the 50% pseudovirus neutralization titers against the original strain WA1 / D614G were 3652 and 20011, respectively, which was Ad5-S JN.1 The immunization group was 3.6 times and 2.3 times ( Fig.11 Middle B); Ad5-S JN.1 -VLP immunization 14d, 84d after the 50% pseudovirus neutralization titer of another Omicron variant BA.2.86 strain was 3602 and 33783, respectively, for Ad5-S JN.1The immunization group was 2.2 times and 1.5 times ( Fig.11 Middle C); Ad5-S JN.1 -VLP immunization 14d and 84d after immunization, the 50% pseudovirus neutralization titers against Delta B.1.617.2 strain were 2535 and 41023, respectively, which was Ad5-S JN.1 3.8 and 4.3 times of the immune group ( Fig.11 Middle D). Ad5-S JN.1 -VLP immunization produces higher titers of broad-spectrum neutralizing antibodies, and this phenomenon becomes more obvious as the immunization time increases.

[0178] In addition, the Ebola virus pseudovirus neutralization experiment proved that ( Fig.11 Middle E), Ad5-GP Zaire -7d after VLP immunization, 84dpVNT 50 2703 and 15622 respectively. Ad5-GP Zaire 7d and 84d after immunization 50 1141 and 6079 respectively, much lower than Ad5-GP Zaire -VLP immunization group.

[0179] like Fig.11 As shown in F, 4 days after Ad5-RVDG-VLP immunization, 50% of mice produced rabies-specific neutralizing antibodies, and the level was higher than 0.5 IU / mL; 7 days after immunization, the antibody conversion rate reached 100%, with an average of 11.13 IU / mL; 28 days after immunization, the neutralizing antibody reached a maximum of 56.31 IU / mL; during the one-year antibody monitoring period, the neutralizing antibody value showed a slow downward trend, and the neutralizing antibody value was 17.28 IU / mL one year after immunization, which was still much higher than the 0.5 IU / mL challenge protection antibody level. 4 days after Ad5-RVDG immunization, only one mouse had a neutralizing antibody value of 0.86 IU / mL, and also reached a maximum of 34.34 IU / mL 28 days after immunization, which was much lower than the Ad5-RVDG-VLP immunization group; one year after immunization, the neutralizing antibody value was 10.54 IU / mL.

[0180] To verify that the modified recombinant adenovirus still has advantages in virus protection, the present invention takes rabies virus as an example, and injects 50×LD 50 CVS-24 rabies virus standard strain was used to challenge the patient, and the weight change and survival rate were recorded at 21 days. Fig.12As shown, the body weight of the blank immunized group dropped sharply after the virus challenge, and all died 11 days after the virus challenge; the body weight of both the Ad5-RVDG and Ad5-RVDG-VLP immunized groups decreased after the virus challenge, but the weight loss in the Ad5-RVDG-VLP immunized group was more moderate, and the protection rate was as high as 100%, while one mouse in the Ad5-RVDG immunized group died 8 days after the virus challenge, and the protection rate was 90%.

[0181] In summary, adenovirus vaccines that can produce virus-like particles show better immunogenicity and have outstanding advantages in long-lasting immune protection and inducing the production of broad-spectrum neutralizing antibodies.

[0182] This example demonstrates the versatility of the present invention in modifying different viral envelope proteins and thereby improving their immunogenicity.

[0183] Example 8

[0184] Dynamic monitoring of exogenous gene expression in vivo after immunization with recombinant adenovirus in different ways:

[0185] Examples 6 and 7 demonstrate that the immune modified recombinant adenovirus vaccine can induce a stronger immune response in the body regardless of intranasal or intramuscular injection, which is presumably related to the continuous expression of VLP in the recombinant adenovirus. In this example, the expression of the Luci gene was detected at different time points by a small animal in vivo optical imaging system after immunization with a recombinant adenovirus (Ad5-Dluci) expressing the pattern antigen firefly luciferase (Luciferase, Luci) in different ways. Specifically:

[0186] Six-week-old female BALB / c mice were used, 3 in each group, and immunized for 10 7 TCID 50 Ad5-Dluci was injected intraperitoneally with 100 μL of 15 mg / mL D-luciferin potassium salt (cat: 40902ES02, YEASEN) at different time points, and the fluorescence signal was detected by the small animal in vivo optical imaging system.

[0187] like Fig.13 As shown in A, after intramuscular injection of Ad5-Dluci, Luci can be continuously expressed at the injection site for about 25 days. Fig.13 Middle B) Ad5-Dluci can continuously express Luci in the lungs for about 10 days.

[0188] Example 9

[0189] Comparison of immunogenicity of Ad5-RVDG and Ad5-RVDG-VLP in canine and cat models:

[0190] Based on the validation of Ad5-HAPR8 -VLP strain can produce HA-VLP in cell lines of different species" test results, that is, the modified viral protein can also self-assemble into virus-like particle structure in canine and feline cell lines and secrete into cell culture supernatant. At the same time, the experimental results show that the recombinant adenovirus that can produce VLP shows better immunogenicity in mouse model. In order to evaluate the potential and effect of the present invention in practical applications, and to verify whether the modified recombinant adenovirus rabies vaccine still has better immunogenicity in other species (dogs and cats), dogs and cats over 3 months old, 5 in each group, were immunized subcutaneously in the neck for 10 8 TCID 50 / mLAd5-RVDG and Ad5-RVDG-VLP. Blood was collected from radial vein every week, serum was separated, and rabies virus-specific neutralizing antibodies were determined.

[0191] like Fig.14 As shown in Figure A, in the cat model, rabies virus-specific neutralizing antibodies were detected in the Ad5-RVDG-VLP group 7 days after immunization, and all were higher than 0.5 IU / mL, reaching a peak of 31.2 IU / mL in the fourth week after immunization; in the Ad5-RVDG group, only one cat had neutralizing antibodies higher than 0.5 IU / mL in the first week after immunization, and also reached a peak of 12.2 IU / mL in the fourth week, which was much lower than the Ad5-RVDG-VLP immunization group. In short, in the cat model, Ad5-RVDG-VLP can stimulate the body's humoral immune response to rabies virus more quickly and induce the body to produce higher neutralizing antibodies.

[0192] like Fig.14 As shown in B, in the canine model, rabies virus-specific neutralizing antibodies were detected in all dogs in the Ad5-RVDG-VLP group 7 days after immunization, and were higher than 0.5 IU / mL, and reached a peak of 34.6 IU / mL in the third week after immunization; in the Ad5-RVDG group, two dogs had neutralizing antibodies higher than 0.5 IU / mL in the first week after immunization, and reached a peak of 16.15 IU / mL in the third week, which was much lower than that in the Ad5-RVDG-VLP immunization group.

[0193] In summary, compared with Ad5-RVDG, the modified recombinant adenovirus rabies vaccine Ad5-RVDG-VLP not only shows better immunogenicity in the mouse model, but also can induce the body to produce higher neutralizing antibodies more quickly in the dog and cat models.

[0194] The above 9 examples prove that the present invention has developed an endogenous VLP synthesis system based on recombinant adenovirus vectors to address the common problems of limited antigen presentation efficiency and insufficient immune activation system in existing vaccine technology platforms. This technology has achieved breakthroughs in: 1) using the efficient transduction characteristics of adenovirus vectors to achieve more efficient systemic delivery of antigens, simplifying the construction process and production process of traditional VLP vaccines; 2) using the characteristics of adenovirus that can express foreign genes in the body for a long time, VLPs can be continuously formed in the body; 3) its unique multivalent antigen presentation mode can increase the titer of neutralizing antibodies several times, significantly reduce the cost of vaccine production and use, and provide a breakthrough technical solution for the development of new vaccines; 4) using the characteristics of adenovirus's broad-spectrum infection, VLPs can be delivered through multiple routes such as intramuscular injection, nasal drops, and oral administration to stimulate a more efficient immune response.

[0195] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for preparing a recombinant adenovirus that spontaneously produces virus-like particles, characterized in that: The following steps are involved: The exogenous viral membrane protein gene is connected with the EARP gene to construct a recombinant exogenous viral membrane protein gene; Inserting the recombinant exogenous viral membrane protein gene into the E3 region of the adenovirus backbone plasmid to obtain a recombinant backbone plasmid; Inserting the recombinant exogenous viral membrane protein gene into the E1 region of the adenovirus shuttle plasmid to obtain a recombinant shuttle plasmid; The recombinant adenovirus that spontaneously produces virus-like particles is prepared according to any one of the following methods (1) to (3): (1) co-transfecting the recombinant backbone plasmid and the recombinant shuttle plasmid into a host cell; (2) co-transfecting the recombinant backbone plasmid and the adenovirus shuttle plasmid into host cells; (3) co-transfecting the adenovirus backbone plasmid and the recombinant shuttle plasmid into host cells; The nucleotide sequence of the EARP gene is shown in SEQ ID NO.

17.

2. The method for preparing a recombinant adenovirus according to claim 1, characterized in that: The adenovirus backbone plasmid is a pBHGcre / loxp plasmid.

3. The method for preparing a recombinant adenovirus according to claim 1, characterized in that: The adenovirus shuttle plasmid is pDC315 plasmid.

4. The method for preparing a recombinant adenovirus according to claim 1, characterized in that: The nucleotide sequence of the recombinant exogenous viral membrane protein gene is shown in any one of SEQ ID NOs. 29-31.

5. A recombinant adenovirus that spontaneously produces virus-like particles, characterized in that: The preparation method of the recombinant adenovirus comprises the following steps: The exogenous viral membrane protein gene is connected with the EARP gene to construct a recombinant exogenous viral membrane protein gene; Inserting the recombinant exogenous viral membrane protein gene into the E3 region of the adenovirus backbone plasmid to obtain a recombinant backbone plasmid; Inserting the recombinant exogenous viral membrane protein gene into the E1 region of the adenovirus shuttle plasmid to obtain a recombinant shuttle plasmid; The recombinant adenovirus that spontaneously produces virus-like particles is prepared according to any one of the following methods (1) to (3): (1) co-transfecting the recombinant backbone plasmid and the recombinant shuttle plasmid into a host cell; (2) co-transfecting the recombinant backbone plasmid and the adenovirus shuttle plasmid into host cells; (3) co-transfecting the adenovirus backbone plasmid and the recombinant shuttle plasmid into host cells; The nucleotide sequence of the EARP gene is shown in SEQ ID NO.

17.

6. The recombinant adenovirus according to claim 5, characterized in that The nucleotide sequence of the recombinant exogenous viral membrane protein gene is shown in any one of SEQ ID NOs. 29-31.

7. The recombinant adenovirus according to claim 5, characterized in that The adenovirus backbone plasmid is a pBHGcre / loxp plasmid; the adenovirus shuttle plasmid is a pDC315 plasmid.

8. Use of the recombinant adenovirus according to any one of claims 5 to 7 in the preparation of a recombinant adenovirus vaccine.

9. A recombinant adenovirus vaccine, characterized in that: The invention comprises the recombinant adenovirus according to any one of claims 5 to 7.

10. The recombinant adenovirus vaccine according to claim 9, characterized in that The recombinant adenovirus vaccine also includes pharmaceutically acceptable excipients.

Images