Method for creating and identifying octaploid Artemisia argyi germplasm

Abstract

The invention discloses a method for creating and identifying the germplasm of octoploid Artemisia vulgaris. According to the method, an allotetraploid wormwood variety with 34 chromosomes is used as a material, and the octaploid wormwood new germplasm APLs-9 is cultivated by using a method of low-temperature synchronization treatment, tissue culture colchicine doubling and terminal bud culture. During identification, a Chinese mugwort reference genome sequence is utilized to design a specific single-copy oligonucleotide probe library of a wormwood 1A chromosome, and fluorescence in situ hybridization analysis is carried out on the obtained APLs-9 and a contrast, so that octoploid wormwood with 68 APLs-9 chromosomes is proved. Phenotypic evaluation shows that the moxa length and the moxa content per unit leaf area of the octoploid wormwood new germplasm are both higher than those of a contrast Ls-9. The invention provides an effective method for creating and identifying octaploid Artemisia argyi, and lays a material foundation for increasing the yield of moxa and improving the quality of moxa.

Description

Technical Field

[0001] The invention relates to a method for creating and identifying wormwood germplasm, in particular to a method for creating and identifying octoploid wormwood germplasm. Background Art

[0002] Mugwort (Artemisia spp.) is a perennial herb belonging to the genus Artemisia of the Asteraceae family, and is widely distributed in many regions of my country. Mugwort plays an important role in traditional Chinese medicine, and its extracts such as mugwort wool and mugwort oil have been widely used in the pharmaceutical and health care products industries due to their excellent effects in removing dampness, stopping bleeding and anti-inflammatory. In recent years, with the expansion of market demand, the planting area and economic value of mugwort have continued to increase, especially in Nanyang, Henan Province, where an integrated industrial chain from planting to processing and sales has been formed. Mugwort wool is produced and processed from mugwort leaves, and improving the yield and quality of mugwort wool is of great significance to mugwort production. Despite this, mugwort germplasm innovation and breeding research are relatively lagging, which limits the further development of the mugwort planting industry.

[0003] Polyploid breeding uses chromosome doubling to increase the gene dosage of plants, improve the plant's biological yield and the content of secondary metabolites. This method has been proven to improve the stress resistance of plants, enhance the content of medicinal ingredients, and increase the growth rate of plants. In the study of mugwort, researchers have not been successful in soaking mugwort seeds and stem tips in colchicine, and there are no reports of octoploid mugwort. How to efficiently obtain octoploid mugwort and improve mugwort yield and mugwort quality is an urgent problem that researchers in this field need to solve.

[0004] In terms of chromosome research and identification, mugwort is a species with multiple chromosome base numbers, mainly x=8 and x=9, but different research results show that mugwort may have multiple ploidy levels. Cytogenetic and genomic studies have revealed that the "Qi Ai" planted in Qichun, Hubei is an allotetraploid plant with 34 chromosomes, consisting of 10 partial homologous groups, of which the first 7 partial homologous groups each have 4 sets of haploid chromosomes, but the last 3 partial homologous groups each have 2 chromosomes. Gene colinearity analysis found that the genes on the chromosome of the 10th partial homologous group corresponded one to one with the genes on chromosomes 8 and 9. It is speculated that this super-long chromosome 10 is the product of the end-to-end fusion of chromosomes 8 and 9 of the ancestor of the Artemisia genus. This chromosome fusion event ultimately led to a tetraploid mugwort chromosome base number of 17. However, the cytological research of mugwort is backward and lacks cytological markers, making its chromosome identification difficult. The completion of the mugwort genome sequencing in 2022 provides a good reference genome sequence for the development of mugwort cytological markers. The presence of single-copy sequences in the genome has unique advantages in determining the ploidy of species. Fluorescence in situ hybridization technology based on single-copy sequences can realize the visualization of species ploidy, but the heterozygosity of the mugwort genome is high, the quality of genome assembly is not high, and probe design is difficult. It has not yet been successfully applied in mugwort. Summary of the invention

[0005] In view of the shortcomings of the existing technology, the present invention provides a method for creating and identifying octoploid long-hair wormwood germplasm, and efficiently creates new octoploid long-hair wormwood germplasm by combining low-temperature synchronization, tissue culture doubling and terminal bud culture, which provides technical guarantee for increasing the yield of wormwood and improving the quality of wormwood.

[0006] The Artemisia annua reference genome was used to screen for repetitive sequences, and a single-copy oligonucleotide probe library for a single chromosome of Artemisia annua was developed, which was effectively used to identify octoploid Artemisia annua.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is:

[0008] 1. A method for creating octoploid long-haired wormwood germplasm, combining low-temperature synchronization, tissue culture colchicine treatment and terminal bud culture methods to double chromosomes, the specific method is as follows:

[0009] (1) Using the allotetraploid Wan Ai local variety Ls-9 from Nanyang, Henan as the material, the stem segments of Ls-9 were collected, and tissue culture was carried out using a solid medium of stem segments in a 25°C light culture room with 16h / 8h light-dark alternation until plants with complete roots, stems and leaves were formed, and then the medium was used for subculture to obtain tissue culture seedlings of Artemisia argyi with good growth;

[0010] (2) The well-growing wormwood tissue culture seedlings were placed in a 4°C refrigerator for dark culture for 12 hours to perform low-temperature synchronization of cell division, and then the stem below the third leaf from the top was cut, and the stem segment containing the terminal bud was taken and placed in a solid culture medium containing colchicine for culture for 8-10 days. The tissue culture seedlings with yellow and curled leaves were selected, and their terminal buds were peeled and inoculated into the terminal bud solid culture medium until they were cultured into plants with complete roots, stems and leaves;

[0011] (3) Taking the Ls-9 material before colchicine treatment as the control, the leaves of the plants after colchicine treatment were taken, and the DNA fluorescence intensity of the peak cell count was detected by flow cytometry. The material whose DNA fluorescence intensity of the peak cell count after colchicine treatment was twice that of the control was selected, and the material was octoploid mugwort.

[0012] The components of the colchicine-containing solid culture medium in step (2) are MS, 0.01 g / L NAA, 30 g / L sucrose and 0.05% colchicine.

[0013] The components of the stem segment solid culture medium and the terminal bud solid culture medium in step (1) and step (2) are: MS, 0.01 g / L NAA and 30 g / L sucrose.

[0014] 2. The identification method of octoploid long-haired wormwood germplasm, the specific steps are as follows:

[0015] (1) The chromosome 1A sequence CM060676.1 in the reference genome sequence of Artemisia argyi ASM3068699v1 published on NCBI was extracted from Genbank: GCA_030686995.1, and a single copy oligonucleotide library of the chromosome was designed and named ACSCOL-1A;

[0016] (2) labeling the single copy oligonucleotide library in ACSCOL-1A with a probe to obtain an ACSCOL-1A probe library labeled with a fluorescent group;

[0017] (3) Using probe library ACSCOL-1A as the probe, the probe library fluorescence in situ hybridization technique was used to analyze the chromosomes of Ls-9 root tip cells at metaphase of mitosis before and after colchicine treatment, and the ploidy of Artemisia argyi was determined based on the number of chromosomes that produced signals.

[0018] The specific design method of the single copy oligonucleotide library in step (1) is as follows: using Chorus2 oligonucleotide probe design software to input the 1A chromosome sequence file, using ChorusNGSfilter to filter the repeated sequences, using ChorusNGSselect to select the single copy oligonucleotide sequence, and finally obtaining 22232 oligonucleotide sequences with a length of 45 nt, and adding homology arms at both ends of all oligonucleotide sequences: the F end is TGTTCCTTTGTTTGTTTGTTTG (SEQ ID NO: 1) and the R end is CTCCGAAAATCACCATTAGAT (SEQ ID NO: 2), to artificially synthesize the 1A single chromosome oligonucleotide library.

[0019] Specific labeling method of the chromosome 1A single copy oligonucleotide library in step (2):

[0020] The PCR reaction solution included: 25 μL HiFi HotStart Ready Mix, 1.5 μL artificially synthesized biotin-modified F primer TGTTCCTTTGTTTGTTTGTTTG (SEQ ID NO: 1), 1.5 μL artificially synthesized biotin-modified R primer ATCTAATGGTGATTTTCGGAG (SEQ ID NO: 3), 2 μL 1A oligonucleotide library, and 20 μL ddH2O;

[0021] The PCR reaction system was as follows: (a) pre-denaturation at 95°C for 3 min; (b) denaturation at 98°C for 20 s, annealing at 50°C for 15 s, extension at 72°C for 30 s, and step (b) was cycled 5 times; (c) denaturation at 98°C for 20 s, annealing at 52°C for 15 s, extension at 72°C for 30 s, and step (c) was cycled 15 times; the PCR product was then purified using the GeneJET PCR Purification Kit according to the instructions to obtain a biotin-modified double-stranded ACSCOL-1A probe library.

[0022] The identification method of step (3) is:

[0023] (a) preparing a hybridization solution, which includes: 7.5 μl of analytical grade deionized formamide, 1.5 μl of 20×SSC buffer, 2 μl of 50% (wt%) dextran sulfate solution, 2 μl of ACSCOL-1A probe library, and 2 μl of ddH2O; denaturing the hybridization solution at 90°C for 6 min, and then placing it in anhydrous ethanol at -20°C for 10-15 min for use;

[0024] (b) The mitotic metaphase chromosomes of Ls-9 cells before and after colchicine treatment were prepared and denatured in 70% formamide solution at 75°C for 70 seconds, then dehydrated in 70%, 95%, and 100% (v / v) alcohol at -20°C for 5 minutes each, and then dried by air;

[0025] (c) dropping the hybridization solution obtained in step (a) onto the glass slide obtained in step (b) and hybridizing at 37°C for 36-48h; then washing with 2×SSC buffer at 42°C for 3-5 times, adding 50μl 1×TNB and 1μl anti-biotin fluorescein to each glass slide, and incubating in a dark box at 37°C for 50min; then washing the glass slide with 1×TNT buffer at room temperature for 3-5 times; adding 0.5μg / ml DAPI solution to each glass slide for staining for 3-4min, rinsing with DAPI buffer for 4-5 times, dropping 6μl anti-fluorescence quenching sealing agent, covering with a coverslip, and photographing under a fluorescence microscope to obtain images;

[0026] (d) Determine whether the material to be identified is octoploid mugwort based on the number of chromosomes with fluorescent signals.

[0027] Beneficial effects of the present invention

[0028] The applicant used chromosome doubling technology to create a new octoploid Wan Ai germplasm APLs-9 and provided a method for identifying the ploidy of the germplasm. The length of the moxa in this germplasm is longer than that of the local Wan Ai variety Ls-9.

[0029] (1) The method for creating octoploid long-haired mugwort germplasm of the present invention utilizes low-temperature treatment to reduce the cell division rate of mugwort, and then transfers the mugwort to a culture medium containing colchicine at a suitable temperature to synchronize its cell division, block the chromosome division process, achieve chromosome doubling, and successfully obtain octoploid mugwort, providing an effective chromosome doubling method for polyploid breeding of mugwort.

[0030] (2) Based on the reference genome of mugwort, the present invention developed a single-copy oligonucleotide probe library of a single chromosome of mugwort, and used the probe library for fluorescence in situ hybridization karyotype analysis to effectively identify octoploid mugwort. The long-hair and high-hair content characteristics of octoploid mugwort APLs-9 were comprehensively evaluated, laying a material foundation for increasing the yield and improving the quality of mugwort. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 Comparison of DNA fluorescence intensity at the peak of Ls-9 and APLs-9 cell counts detected by flow cytometry.

[0032] Figure 2 Results of fluorescence in situ hybridization analysis of metaphase chromosomes in root tip cells of Ls-9 and APLs-9.

[0033] Figure 3 The pollen fertility of the octoploid long-haired wormwood APLs-9 of the present invention is compared with that of the Wan wormwood local variety Ls-9.

[0034] Figure 4 The front and back sides of the leaves of the octoploid long-haired wormwood APLs-9 of the present invention and the Wan wormwood local variety Ls-9 are compared.

[0035] Figure 5 Comparison of the hair length between the octoploid long-hair mugwort APLs-9 of the present invention and the Wan mugwort local variety Ls-9. DETAILED DESCRIPTION

[0036] The following examples further illustrate the specific embodiments of the present invention, but do not limit the present invention in any way. Unless otherwise specified, the percentages in the text are all by weight, the methods used are all conventional methods, and the reagents used can be obtained through commercial channels.

[0037] Example 1. A method for creating octoploid long-haired wormwood germplasm.

[0038] (1) Using the allotetraploid Wan Ai local variety Ls-9 from Nanyang, Henan as the material, the stem segments of Ls-9 were collected, and the culture medium was a solid culture medium composed of MS, 0.01 g / L NAA and 30 g / L sucrose. Tissue culture was carried out in a 25°C light culture room with 16h / 8h light-dark alternation until plants with complete roots, stems and leaves were formed. The culture medium was then used for subculture to obtain 50 well-growing wormwood tissue culture seedlings;

[0039] (2) 30 well-growing wormwood tissue culture seedlings were placed in a 4°C refrigerator for dark culture for 12 h to perform low-temperature synchronization of cell division, and then the stem below the third leaf from the top was cut, and the stem segment containing the terminal bud was taken and placed in a solid culture medium composed of MS, 0.01 g / L NAA, 30 g / L sucrose and 0.05% colchicine for culture for 8-10 days.

[0040] Select 15 tissue culture seedlings with yellowing and curling leaves, peel off their terminal buds and inoculate them into a solid culture medium composed of MS, 0.01g / L NAA and 30g / L sucrose until they are cultured into plants with complete roots, stems and leaves;

[0041] (3) Using Ls-9 material before colchicine treatment as the control, take the leaves of the plants after colchicine treatment, and use flow cytometry to detect the DNA fluorescence intensity of the peak cell count. Select the material whose DNA fluorescence intensity of the peak cell count after colchicine treatment is twice that of the control. Figure 1 .

[0042] Figure 1a: DNA fluorescence intensity at the peak of Ls-9 cell count; Figure 1 b: DNA fluorescence intensity at the peak of APLs-9 cell count. The ordinate in the figure represents the cell count, and the abscissa represents the fluorescence intensity. It can be seen that the DNA fluorescence intensity peak of Ls-9 is at 11K, and the DNA fluorescence intensity peak of APLs-9 is at 22K. The DNA fluorescence intensity peak of APLs-9 is twice that of Ls-9, indicating that APLs-9 is octoploid.

[0043] Example 2. Identification of octoploid Artemisia selengensis germplasm

[0044] (1) Extract the chromosome 1A sequence "CM060676.1" from the reference genome sequence "Genbank: GCA_030686995.1" of Artemisia argyi ASM3068699v1 published on NCBI, input the chromosome 1A sequence file using Chorus2 oligonucleotide probe design software, filter the repetitive sequences using ChorusNGSfilter, and select the single copy oligonucleotide sequences using ChorusNGSselect. Finally, 22,232 oligonucleotide sequences with a length of 45 nt were obtained.

[0045] Homology arms were added to both ends of all oligonucleotide sequences: the F end was TGTTCCTTTGTTTGTTTGTTTG (SEQ ID NO: 1), and the R end was CTCCGAAAATCACCATTAGAT (SEQ ID NO: 2). The 1A single chromosome oligonucleotide library was artificially synthesized by Nanjing GenScript Biotechnology Co., Ltd. and named ACSCOL-1A.

[0046] (2) Probe labeling of the single copy oligonucleotide library in ACSCOL-1A was performed. First, a PCR reaction solution was prepared, including 25 μL HiFi HotStart Ready Mix, 1.5 μL artificially synthesized biotin-modified F primer TGTTCCTTTGTTTGTTTGTTTG (SEQ ID NO: 1), 1.5 μL artificially synthesized biotin-modified R primer ATCTAATGGTGAT TTTCGGAG (SEQ ID NO: 3), 2 μL 1A oligonucleotide library, and 20 μL ddH2O;

[0047] PCR reaction system: (a) pre-denaturation at 95°C for 3 min; (b) denaturation at 98°C for 20 s, annealing at 50°C for 15 s, extension at 72°C for 30 s, step (b) cycled 5 times; (c) denaturation at 98°C for 20 s, annealing at 52°C for 15 s, extension at 72°C for 30 s, step (c) cycled 15 times.

[0048] The PCR product was purified using GeneJET PCR Purification Kit according to the instructions to obtain double-stranded probes for subsequent single chromosome painting experiments to obtain the ACSCOL-1A probe library labeled with a fluorescent group.

[0049] Using the oligonucleotide library ACSCOL-1A as a probe, fluorescence in situ hybridization was performed to analyze chromosomes in metaphase of mitosis of Ls-9 root tip cells before colchicine treatment and after colchicine treatment. The steps are as follows:

[0050] (a) preparing a hybridization solution, which includes: 7.5 μl of analytical grade deionized formamide, 1.5 μl of 20×SSC buffer, 2 μl of 50% (wt%) dextran sulfate solution, 2 μl of ACSCOL-1A probe library, and 2 μl of ddH2O; denaturing the hybridization solution at 90° C. for 6 min, and then placing it in anhydrous ethanol at −20° C. for 10-15 min;

[0051] (b) The mitotic metaphase chromosome preparations of Ls-9 cells before colchicine treatment and after colchicine treatment were placed in 70% formamide solution for denaturation at 75°C for 70 seconds, and then dehydrated in 70%, 95%, and 100% (v / v) alcohol at -20°C for 5 minutes each, and then dried by air;

[0052] (c) Drop the hybridization solution onto the glass slide of step (b) and hybridize at 37°C for 36-48h; then wash 3-5 times with 2×SSC buffer at 42°C, add 50μl 1×TNB and 1μl Anti-Biotin (Rockland) to each glass slide, and incubate in a dark box at 37°C for 50min; then wash the glass slide 3-5 times with 1×TNT buffer at room temperature; add 0.5μg / ml DAPI solution to each glass slide for staining for 3-4min, rinse with DAPI buffer 4-5 times, drop 6μl anti-fluorescence quenching sealing agent, cover with a coverslip, and obtain images with a fluorescence microscope. Results are shown in Figure 2 .

[0053] Figure 2 a, 2b are: the detection results of fluorescence in situ hybridization analysis of Ls-9 and APLs-9 chromosomes respectively using the biotin-labeled ACSCOL-1A probe library.

[0054] It can be seen that the chromosome number of the allotetraploid mugwort Ls-9 is 34, and the chromosome number of APLs-9 is 68. There are 4 green signal chromosomes in the cells of tetraploid Ls-9, and 8 green signal chromosomes in the cells of APLs-9, indicating that the obtained APLs-9 is octoploid mugwort.

[0055] Example 3: Evaluation of octoploid wormwood germplasm

[0056] (1) Pollen fertility

[0057] During the flowering period of the long-haired wormwood, crush the anthers with tweezers and place them on a glass slide. Add 1-2 drops of acetic acid magenta solution, cover with a cover slip, and use a dissecting needle to knock the cover slip a few times to disperse the pollen grains. Observe 10 flowers under a microscope, with 3 fields of view for each flower. Fertile pollen grains are large and red, while sterile pollen grains are small and light pink. Count the fertile and sterile pollen grains and calculate the pollen fertility. Figure 3 .

[0058] The results showed that the pollen fertility of Ls-9 was 95.68%±1.36%, and the pollen fertility of APLs-9 was 55.23%±8.27%. The fertility of octoploid mugwort APLs-9 was significantly lower than that of tetraploid mugwort Ls-9 (see Table 1).

[0059] Pollen fertility (%) = number of fertile pollen grains / (number of fertile pollen grains + number of sterile pollen grains) × 100%.

[0060] (2) Phenotypic data

[0061] Comparing the leaves of Ls-9 and APLs-9 plants at the harvest time, and observing the plant and leaf phenotypes, it can be seen that the front and back of the APLs-9 leaves are obviously whiter than those of Ls-9, and the moxa content is higher (see Figure 4 ).

[0062] The moxa content and moxa length of Ls-9 and APLs-9 were further measured.

[0063] Determination of moxa content per unit weight: Take the same mass of Ls-9 and APLs-9 leaves, dry them in a 60°C oven, crush them with a high-speed multifunctional grinder for 3 minutes, filter out impurities with a pharmacopoeia sieve with an aperture of 0.85 mm, and weigh the moxa with a balance to obtain the moxa content per unit weight. The results showed that the moxa content of Ls-9 was 0.68±0.10g / g, and the moxa content of APLs-9 was 0.66±0.11g / g, and the difference between the two was not significant (see Table 1).

[0064] Determination of moxa content per unit area: Take Ls-9 and APLs-9 leaves of the same leaf area, dry them in a 60℃ oven, crush them with a high-speed multifunctional grinder for 3 minutes, filter out impurities with a pharmacopoeia sieve with an aperture of 0.85mm, and weigh the moxa with a balance to obtain the moxa content per unit leaf area. The results showed that the moxa content of Ls-9 was 1.03±0.02mg / cm 2 The moxa content of APLs-9 was 1.25±0.03mg / cm 2, the content of APLs-9 was significantly higher than that of Ls-9 (see Table 1).

[0065] Determination of moxa length: Use tweezers to take moxa with a small amount of mesophyll cells from the leaves, place them on a slide with black tape, take pictures with a stereoscope, and then measure the moxa length with LAS V4.0 software. The results show that the moxa length of Ls-9 is 2.40±0.43mm, and the moxa length of APLs-9 is 4.23±0.57mm. The moxa length of APLs-9 is about 1.76 times that of Ls-9 (see Figure 5 and Table 1).

[0066] It can be seen that the leaves of the octoploid mugwort APLs-9 of the present invention show higher mugwort content per unit leaf area and longer mugwort length compared with the Wan mugwort local variety Ls-9.

[0067] Table 1 Phenotypic data of octoploid long-haired wormwood germplasm APLs-9 and Wan wormwood local variety Ls-9

[0068]

[0069] Note: In the table, * indicates P<0.05, ** indicates P<0.01.

Claims

1. A method for creating octoploid long-haired wormwood germplasm, characterized in that: The chromosome doubling was carried out by combining low temperature synchronization, tissue culture colchicine treatment and terminal bud culture. The specific method is as follows: (1) Using the allotetraploid Wan Ai local variety Ls-9 from Nanyang, Henan as the material, the stem segments of Ls-9 were collected, and tissue culture was carried out using a solid medium of stem segments in a 25°C light culture room with 16h / 8h light-dark alternation until plants with complete roots, stems and leaves were formed, and then the medium was used for subculture to obtain tissue culture seedlings of Artemisia argyi with good growth; (2) The well-growing wormwood tissue culture seedlings were placed in a 4°C refrigerator for dark culture for 12 hours to perform low-temperature synchronization of cell division, and then the stem below the third leaf from the top was cut, and the stem segment containing the terminal bud was taken and placed in a solid culture medium containing colchicine for culture for 8-10 days. The tissue culture seedlings with yellow and curled leaves were selected, and their terminal buds were peeled and inoculated into the terminal bud solid culture medium until they were cultured into plants with complete roots, stems and leaves; (3) Taking the Ls-9 material before colchicine treatment as the control, the leaves of the plants after colchicine treatment were taken, and the DNA fluorescence intensity of the peak cell count was detected by flow cytometry. The material whose DNA fluorescence intensity of the peak cell count after colchicine treatment was twice that of the control was selected, and the material was octoploid mugwort.

2. The method according to claim 1, characterized in that: The components of the colchicine-containing solid culture medium in step (2) are MS, 0.01 g / L NAA, 30 g / L sucrose and 0.05% colchicine.

3. The method according to claim 1, characterized in that: The components of the stem segment solid culture medium and the terminal bud solid culture medium in step (1) and step (2) are: MS, 0.01 g / L NAA and 30 g / L sucrose.

4. A method for identifying octoploid long-haired wormwood germplasm, characterized in that: The specific steps are as follows: (1) The chromosome 1A sequence CM060676.1 in the reference genome sequence of Artemisia argyi ASM3068699v1 published on NCBI was extracted from Genbank: GCA_030686995.1, and a single copy oligonucleotide library of the chromosome was designed and named ACSCOL-1A; (2) labeling the single copy oligonucleotide library in ACSCOL-1A with a probe to obtain an ACSCOL-1A probe library labeled with a fluorescent group; (3) Using probe library ACSCOL-1A as the probe, the probe library fluorescence in situ hybridization technique was used to analyze the chromosomes of Ls-9 root tip cells at metaphase of mitosis before and after colchicine treatment, and the ploidy of Artemisia argyi was determined based on the number of chromosomes that produced signals.

5. The method for identifying octoploid long-haired wormwood germplasm according to claim 4, characterized in that: The specific design method of the single copy oligonucleotide library in step (1) is as follows: using Chorus2 oligonucleotide probe design software to input the 1A chromosome sequence file, using ChorusNGSfilter to filter the repeated sequences, using ChorusNGSselect to select the single copy oligonucleotide sequence, and finally obtaining 22232 oligonucleotide sequences with a length of 45 nt, and adding homology arms at both ends of all oligonucleotide sequences: the F end is TGTTCCTTTGTTTGTTTGTTTG and the R end is CTCCGAAAATCACCATTAGAT, to artificially synthesize the 1A single chromosome oligonucleotide library.

6. The method for identifying octoploid long-haired wormwood germplasm according to claim 4, characterized in that: Specific labeling method of the chromosome 1A single copy oligonucleotide library in step (2): The PCR reaction solution included: 25 μL HiFi HotStart Ready Mix, 1.5 μL artificial synthetic biotin-modified F primer TGTTCCTTTGTTTGTTTGTTTG, 1.5 μL artificial synthetic biotin-modified R primer ATCTAATGGTGA TTTTCGGAG, 2 μL 1A oligonucleotide library, 20 μL ddH2O; The PCR reaction system was as follows: (a) pre-denaturation at 95°C for 3 min; (b) denaturation at 98°C for 20 s, annealing at 50°C for 15 s, extension at 72°C for 30 s, and step (b) was cycled 5 times; (c) denaturation at 98°C for 20 s, annealing at 52°C for 15 s, extension at 72°C for 30 s, and step (c) was cycled 15 times; the PCR product was then purified using the GeneJET PCR Purification Kit according to the instructions to obtain a biotin-modified double-stranded ACSCOL-1A probe library.

7. The method for identifying octoploid long-haired wormwood germplasm according to claim 4, characterized in that: The identification method of step (3) is: (a) preparing a hybridization solution, which includes: 7.5 μl of analytical grade deionized formamide, 1.5 μl of 20×SSC buffer, 2 μl of 50% (wt%) dextran sulfate solution, 2 μl of ACSCOL-1A probe library, and 2 μl of ddH2O; denaturing the hybridization solution at 90°C for 6 min, and then placing it in anhydrous ethanol at -20°C for 10-15 min for use; (b) The mitotic metaphase chromosomes of Ls-9 cells before and after colchicine treatment were prepared and denatured in 70% formamide solution at 75°C for 70 seconds, then dehydrated in 70%, 95%, and 100% (v / v) alcohol at -20°C for 5 minutes each, and then dried by air; (c) dropping the hybridization solution obtained in step (a) onto the glass slide obtained in step (b) and hybridizing at 37°C for 36-48h; then washing with 2×SSC buffer at 42°C for 3-5 times, adding 50μl 1×TNB and 1μl anti-biotin fluorescein to each glass slide, and incubating in a dark box at 37°C for 50min; then washing the glass slide with 1×TNT buffer at room temperature for 3-5 times; adding 0.5μg / ml DAPI solution to each glass slide for staining for 3-4min, rinsing with DAPI buffer for 4-5 times, dropping 6μl anti-fluorescence quenching sealing agent, covering with a coverslip, and photographing under a fluorescence microscope to obtain images; (d) Determine whether the material to be identified is octoploid mugwort based on the number of chromosomes with fluorescent signals.

Images