SiRNA lipid nanoparticles for targeted therapy of chloasma as well as preparation method and application of siRNA lipid nanoparticles

Abstract

The invention provides siRNA lipid nanoparticles for targeted therapy of chloasma as well as a preparation method and application of the siRNA lipid nanoparticles, and belongs to the technical field of biological medicines. The invention provides LNP-siRNAs for treating chloasma. The LNP-siRNAs for treating chloasma comprise siRNAs of key molecules for targeted inhibition of melanin formation. According to the invention, an effective siRNA sequence is screened out and verified in cells, then siRNAs with an obvious inhibition effect are packaged into LNP-siRNAs, the packaging quality of the LNP-siRNAs is evaluated, and the LNP-siRNAs are applied to cells and animals to evaluate the inhibition effect of the LNP-siRNAs on melanin. The packaged LNP-siRNAs are used for melanocytes and animal skin, can effectively inhibit the formation of melanin, and can be used for screening and preparing potential medicines for clinically treating chloasma.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and specifically relates to a siRNA lipid nanoparticle for targeted treatment of chloasma, and a preparation method and application thereof. Background Art

[0002] Chloasma is a common facial skin pigmentation disease, which is more common in women and seriously affects the beauty of the skin. Genetics, ultraviolet damage, hormones and drug effects are important factors in the occurrence and development of chloasma. The core mechanism of chloasma formation is the excessive deposition of melanin produced by melanocytes in skin tissue. The mechanism leading to excessive melanin deposition is relatively complex, involving deep regulatory mechanisms between multiple cells and molecules, such as increased melanocyte activity leading to excessive melanin production, melanin transport disorders, inflammation and oxidative stress. The formation mechanism of chloasma involves the participation of multiple cells, including epidermal melanocytes, keratinocytes, dermal fibroblasts, vascular endothelial cells, etc. Among them, melanocytes are effector cells that secrete melanin and cause chloasma pigment deposition.

[0003] Melanogenesis involves complex intercellular and intracellular molecular signal transduction processes. Usually, keratinocytes are stimulated by external stimuli, mainly ultraviolet radiation, which triggers a series of intracellular signal transductions, increases the expression of pro-opiomelanocortin (POMC), and cleaves more functional peptides α-MSH and secretes them outside the cells. α-MSH binds to the melanocortin receptor 1 (MC1R) on the surface of melanocytes, activating a series of signal cascades cAMP-PKA-CREB-MITF in melanocytes. MITF is an upstream transcription factor of direct effector molecules of melanogenesis, such as tyrosinase (TYR), tyrosinase-related protein 1 (TYRP1), tyrosinase-related protein 2 (TYRP2), and premelanosome protein (PMEL), which promotes their expression, allowing melanocytes to produce melanin, which is secreted outside the cells and can also enter keratinocytes. Excessive formation of melanin is the most important link in the pathogenesis of chloasma. Inhibiting the formation of melanin can effectively treat chloasma.

[0004] Traditional drugs for treating chloasma mainly target melanocytes, inhibit the formation of melanin, increase the transport of melanin, or have antioxidant and anti-inflammatory effects. Classic oral drugs such as tranexamic acid can inhibit the activity of tyrosinase, thereby inhibiting the formation of melanin, but they need to be taken orally for a long time and have risks such as thrombosis and liver damage. Vitamin C and E can play an antioxidant role and may also affect the transport of melanin, so they are used as auxiliary drugs for the treatment of chloasma, but their efficacy is not certain. Topical drugs, such as hydroquinone, can well inhibit the activity of tyrosinase, thereby inhibiting the formation of melanin, but the drug is easy to enter the blood circulation, causing organ damage, and the effect is significantly weakened when the dosage is reduced for external use. Other topical drugs, such as retinoic acid and azelaic acid, can also play a certain therapeutic role on chloasma, but the effect is limited, requiring a combination of multiple drugs, and there are also some unpleasant side effects. In recent years, there have been many studies on chloasma drugs abroad, but they are all in the clinical trial stage, and their main starting point is to inhibit melanocytes from producing too much melanin.

[0005] As early as decades ago, there were preliminary explorations on the use of nucleic acids in the human body. However, since nucleases are widely present in body tissues, nucleic acids (DNA and RNA) are easily and quickly decomposed whether they are administered in the digestive tract, circulatory system or localized in tissues. In addition, nucleic acids are usually negatively charged and hydrophilic, and naked nucleic acids may not be able to enter cells. Therefore, how to make nucleic acids be smoothly taken up by cells has been the focus of research for many years. Whether it is DNA or RNA, in order to play an effective role in human tissues, the first problem to be solved is to be successfully transported to target cells and to be smoothly taken up by cells after reaching the target cells. Some nucleic acid carriers have been used for the transportation of nucleic acids in the body, such as liposomes. Although liposome drugs have been used clinically, the nucleic acids carried by liposomes are present on the outer surface of liposomes, and many studies have confirmed that they are also easily degraded. In recent years, nucleic acids encapsulated by lipid nanoparticles (LNPs) have shown good nucleic acid protection and are easily taken up by cells through endocytosis. Summary of the invention

[0006] The present invention provides a siRNA lipid nanoparticle (LNP) for targeted treatment of chloasma, and a preparation method and application thereof. The LNP-siRNAs can effectively inhibit the formation of melanin and can be used as a potential drug for clinical treatment of chloasma.

[0007] The invention provides LNP-siRNAs for treating chloasma, including siRNAs that target and inhibit key molecules for melanin formation.

[0008] In a preferred embodiment of the present invention, the key molecules for melanin formation include TYR, MC1R and MITF.

[0009] In a preferred embodiment of the present invention, the siRNAs include M-siTyr-1 and M-siTyr-2 designed to target mouse TYR, M-siMc1r-1 and M-siMc1r-2 designed to target mouse MC1R, and M-siMitf-1 and M-siMitf-2 designed to target mouse MITF;

[0010] The nucleotide sequence of the M-siTyr-1 is shown in SEQ ID No.1 to SEQ ID No.2;

[0011] The nucleotide sequence of the M-siTyr-2 is shown in SEQ ID No.3 to SEQ ID No.4;

[0012] The nucleotide sequence of the M-siMc1r-1 is shown in SEQ ID No.5 to SEQ ID No.6;

[0013] The nucleotide sequence of the M-siMc1r-2 is shown in SEQ ID No.7 to SEQ ID No.8;

[0014] The nucleotide sequence of the M-siMitf-1 is shown in SEQ ID No.9 to SEQ ID No.10;

[0015] The nucleotide sequence of the M-siMitf-2 is shown in SEQ ID No.11 to SEQ ID No.12;

[0016] The siRNAs include H-siTyr-1 and H-siTyr-2 designed to target human TYR, H-siMc1r-1 and H-siMc1r-2 designed to target human MC1R, and H-siMitf-1 and H-siMitf-2 designed to target human MITF;

[0017] The nucleotide sequence of H-siTyr-1 is shown in SEQ ID No.13 to SEQ ID No.14;

[0018] The nucleotide sequence of H-siTyr-2 is shown in SEQ ID No.15 to SEQ ID No.16;

[0019] The nucleotide sequence of H-siMC1R-1 is shown in SEQ ID No.17 to SEQ ID No.18;

[0020] The nucleotide sequence of H-siMc1r-2 is shown in SEQ ID No.19 to SEQ ID No.20;

[0021] The nucleotide sequence of H-siMITF-1 is shown in SEQ ID No.21 to SEQ ID No.22;

[0022] The nucleotide sequence of the H-siMitf-2 is shown in SEQ ID No.23 to SEQ ID No.24.

[0023] The present invention also provides a method for preparing the above-mentioned LNP-siRNAs, comprising the following steps: (1) dissolving lipids in anhydrous ethanol to prepare a lipid solution to obtain a lipid phase;

[0024] (2) dissolving the LNP-siRNAs in a citric acid buffer in sequence to obtain an aqueous phase;

[0025] (3) Mixing the lipid phase and the aqueous phase, such as using microfluidics technology to prepare the LNP-siRNAs.

[0026] In a preferred embodiment of the present invention, the concentration of the lipid solution in step (1) is 2.4 mM-24 mM.

[0027] In a preferred embodiment of the present invention, the lipids include DSPC, Cholesterol, DDAB and DMG-PEG2000, and the molar ratio of DSPC, Cholesterol, DDAB and DMG-PEG2000 is (10-16):(46.5-60):(28-40):(2-2.5).

[0028] In a preferred embodiment of the present invention, the mixing in step (3) includes connecting the lipid phase and the aqueous phase liquid to a staggered herringbone micromixer (SHM) dedicated to microfluidics, and using a syringe pump to quickly mix the lipid phase and the aqueous phase through the SHM, with injection parameters FRR = (2-10): 1, TFR = 3-6 mL / min.

[0029] In a preferred embodiment of the present invention, after SHM mixing, the mixed liquid is collected and filtered and dialyzed to remove ethanol.

[0030] The present invention also provides the use of the above LNP-siRNAs or the LNP-siRNAs prepared by the above preparation method in the preparation of drugs for the targeted treatment of chloasma.

[0031] The present invention also provides a drug for targeted treatment of chloasma, wherein the effective ingredients include the above-mentioned LNP-siRNAs or the LNP-siRNAs prepared by the above-mentioned preparation method.

[0032] Beneficial effects: The present invention provides a LNP-siRNAs for treating chloasma, including siRNAs that target and inhibit key molecules of melanin formation. In the embodiments of the present invention, a series of siRNAs that target and inhibit key molecules in the process of melanin formation, tyrosinase (TYR), melanocortin1 receptor 1 (MC1R) on the surface of melanocytes, and melanocyte inducing transcription factor (MITF) are designed, and effective siRNA sequences are screened out and verified in cells, and then these siRNAs with obvious inhibitory effects are packaged into LNP-siRNAs, the packaging quality of LNP-siRNAs is evaluated, and LNP-siRNAs are used in cells and animals to evaluate their inhibitory effects on melanin. The present invention screened a series of highly effective siRNAs for inhibiting melanin formation against three molecular targets (TYR, MC1R and MITF), packaged them into LNP-siRNAs and used them in melanocytes and animal skin, and found that they can effectively inhibit the formation of melanin. The screened and produced LNP-siRNAs are potential drugs for the clinical treatment of chloasma. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 A complete strategy diagram of the solution designed in the embodiment of the present invention;

[0034] Figure 2 This is the result of the validation of the effect of siRNA, a key molecule for melanin formation in mice. In the figure, NC is the control siRNA, and * indicates P<0.05;

[0035] Figure 3 This is the result of the validation of the effect of siRNA, a key molecule in the pathogenesis of melasma in human skin melanocytes. In the figure, NC is the control siRNA, and * indicates P<0.05;

[0036] Figure 4 This is an example of the DLS detection result of LNP (LNP-M-siTyr-1);

[0037] Figure 5 This is an example of the Cryo-TEM test result of LNP (LNP-M-siTyr-1);

[0038] Figure 6 The figure shows the uptake result of LNP by mouse melanoma cells B16-F1, where Ctrl: negative control; Exo: exosomes; LNP: lipid nanoparticles (LNP-M-siTyr-1);

[0039] Figure 7This is a graph showing the inhibitory effect of LNP-siRNAs on the expression of key genes for chloasma formation in mouse melanocytes, in which A: TYR; B: MC1R; C: MITF; LNP-C is a negative control, which is LNP made using the siRNA negative control sequence; * indicates P < 0.05;

[0040] Figure 8 This is a graph showing the inhibitory effect of LNP-siRNAs on the expression of key genes for chloasma formation in primary melanocytes of human skin, in which A: TYR; B: MC1R; C: MITF; LNP-C is a negative control, which is LNP made using the siRNA negative control sequence; * indicates P < 0.05;

[0041] Fig. 9 This is a graph showing the inhibitory effect of LNP-siRNA on the expression of melanin-related genes in mouse skin, A: TYR; B: MC1R; C: MITF; * indicates P < 0.05;

[0042] Fig.10 The results of the dose-dependent inhibition of target gene expression in mouse skin by LNP-siRNAs are shown in the figure. In the figure, * indicates P<0.05. DETAILED DESCRIPTION

[0043] The invention provides LNP-siRNAs for treating chloasma, including siRNAs that target and inhibit key molecules for melanin formation.

[0044] The key molecules for melanin formation described in the present invention include tyrosinase (TYR), melanocortin 1 receptor (MC1R) and melanocyte inducing transcription factor (MITF). Among them, TYR of mouse (Mus musculus), Gene ID: 22173; MC1R, Gene ID: 17199; MITF, Gene ID: 17342; TYR of human (Homo sapiens), Gene ID: 7299; MC1R, Gene ID: 4157; MITF, Gene ID: 4286.

[0045] In a preferred embodiment of the present invention, the siRNAs include M-siTyr-1 and M-siTyr-2 designed to target mouse TYR, M-siMc1r-1 and M-siMc1r-2 designed to target mouse MC1R, and M-siMitf-1 and M-siMitf-2 designed to target mouse MITF;

[0046] The nucleotide sequence of the M-siTyr-1 is shown in SEQ ID No.1 to SEQ ID No.2;

[0047] The nucleotide sequence of the M-siTyr-2 is shown in SEQ ID No.3 to SEQ ID No.4;

[0048] The nucleotide sequence of the M-siMc1r-1 is shown in SEQ ID No.5 to SEQ ID No.6;

[0049] The nucleotide sequence of the M-siMc1r-2 is shown in SEQ ID No.7 to SEQ ID No.8;

[0050] The nucleotide sequence of the M-siMitf-1 is shown in SEQ ID No.9 to SEQ ID No.10;

[0051] The nucleotide sequence of the M-siMitf-2 is shown in SEQ ID No.11 to SEQ ID No.12.

[0052] The siRNAs shown in SEQ ID No. 1 to SEQ ID No. 12 of the present invention are designed to target mouse genes, and the siRNAs shown in SEQ ID No. 13 to SEQ ID No. 24 are designed to target human genes. The sequences are as follows, and M: mouse, H: human, mus: this sequence is only used for mice, and mus+homo: this sequence is common to both mice and humans:

[0053] M-siTyr-1(mus):

[0054] SEQ ID No.1: CACCCAUGUUUAAUGAUAUUU;

[0055] SEQ ID No.2: AAUUCAUUAAACAUGGGUGUU;

[0056] M-siTyr-2(mus)

[0057] SEQ ID No.3: GGCAACUUCAUGGGUUUCAUU;

[0058] SEQ ID No.4:UGAAACCCAUGAAGUUGCCUU;

[0059] M-siMc1r-1(mus)

[0060] SEQ ID No. 5: CGCCCAUGUAUUACUUCAUUU;

[0061] SEQ ID No. 6: AUGAAGUAAUAACAUGGGCGUU;

[0062] M-siMc1r-2(mouse+human)

[0063] SEQ ID No. 7: GCAUCUUCAAGAACUUCAAUU;

[0064] SEQ ID No.8: UUGAAGUUCUUGAAGAUGCUU;

[0065] M-siMitf-1(mouse)

[0066] SEQ ID No.9: GCCUUGCAAAUGGCAAAUAUU;

[0067] SEQ ID No.10: UAUUUGCCAUUUGCAAGGCUU;

[0068] M-siMitf-2(mouse+human)

[0069] SEQ ID No. 11: GUACCUUUCUACCACUUUAUU;

[0070] SEQ ID No. 12: UAAAGUGGUAGAAAGGUACUU;

[0071] H-siTyr-1(Human)

[0072] SEQ ID No.13:CACCCAUGUUUAACGACAUUU;

[0073] SEQ ID No. 14: AUGUCGUUAAACAUGGGGUGUU;

[0074] H-siTyr-2(Human)

[0075] SEQ ID No. 15: GGCAACUUCAUGGGAUUCAUU;

[0076] SEQ ID No. 16: UGAAUCCCAUGAAGUUGCCUU;

[0077] H-siMC1R-1(Human)

[0078] SEQ ID No.17: CACCCAUGUACUGCUUCAUUU;

[0079] SEQ ID No.18:AUGAAGCAGUACAUGGGUGUU;

[0080] H-siMc1r-2(mus+homo)

[0081] SEQ ID No.19: GCAUCUUCAAGAACUUCAAUU;

[0082] SEQ ID No.20: UUGAAGUUCUUGAAGAUGCUU;

[0083] H-siMITF-1(Homo)

[0084] SEQ ID No.21: GCUUUGCAAAUGGCAAAUAUU;

[0085] SEQ ID No.22: UAUUUGCCAUUUGCAAAGCUU;

[0086] H-siMitf-2(mus+homo)

[0087] SEQ ID No.23: GUACCUUUCUACCACUUUAUU;

[0088] SEQ ID No. 24: UAAAGUGGUAGAAAGGUACUU.

[0089] The present invention also provides a method for preparing the above-mentioned LNP-siRNAs, comprising the following steps: (1) dissolving lipids in anhydrous ethanol to prepare a lipid solution to obtain a lipid phase;

[0090] (2) dissolving the LNP-siRNAs in a citric acid buffer in sequence to obtain an aqueous phase;

[0091] (3) Mixing the lipid phase and the aqueous phase, such as by using microfluidics technology to prepare the LNP-siRNAs.

[0092] In the present invention, when preparing the lipid phase, four lipids 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), Cholesterol, DDAB (C 38 H 80NBr) and DMG-PEG2000 are dissolved in anhydrous ethanol, fully dissolved and mixed to prepare a 2.4-24mM lipid solution. In one embodiment of the present invention, the molar ratio of DSPC, Cholesterol, DDAB and DMG-PEG2000 can be (10-16): (46.5-60): (28-40): (2-2.5), such as 10:60:28:2 or 16:46.5:35:2.5 or 10:48:40:2.

[0093] In the present invention, the designed siRNA is dissolved in a citrate buffer (100 mM, pH 6) to prepare an aqueous phase. For example, 15 mg of the above-mentioned mouse siRNA (M-siTyr-1, M-siTyr-2, M-siMc1r-1, M-siMc1r-2, M-siMitf-1, M-siMitf-2) and control siRNA (NC) are taken and dissolved in a citrate buffer.

[0094] The present invention adopts microfluidic technology to prepare the LNP-siRNAs. In the specific operation, the lipid phase and the aqueous phase are connected to a staggered herringbone micromixer (SHM) dedicated to microfluidics, and the lipid phase and the aqueous phase are quickly mixed through the SHM using a syringe pump, and the injection parameters FRR=5:1, TFR=6mL / min. The obtained mixed liquid is collected, filtered through a 22μm PES filter, and then placed in a MWCO 12-14kDa dialyzer for dialyzing to remove ethanol, thereby obtaining the prepared LNP-siRNAs.

[0095] The present invention uses dynamic light scattering (DLS) and cryogenic transmission electron microscopy (Cryo-TEM) to determine whether the quality of the prepared LNP-siRNAs meets the quality standards. The particle size of the LNP-siRNAs prepared by the method of the embodiment of the present invention is 67.73nm on average, and the PDI (Polydispersity index) is 0.078; the Cryo-TEM test results show that the liquid to be tested contains a large number of vesicles with a diameter of about 50 to 90nm, indicating that the prepared LNP-siRNAs have good production quality.

[0096] The present invention also provides the use of the above LNP-siRNAs or the LNP-siRNAs prepared by the above preparation method in the preparation of drugs for the targeted treatment of chloasma.

[0097] In the examples of the present invention, a series of highly effective siRNAs that target and inhibit melanin formation were screened for three molecular targets (TYR, MC1R and MITF). After being packaged into LNP-siRNAs, they were used in melanocytes and animal skin. It was found that they can effectively inhibit the formation of melanin and can be used as a potential drug for the clinical treatment of chloasma.

[0098] The present invention also provides a drug for targeted treatment of chloasma, wherein the effective ingredients include the above-mentioned LNP-siRNAs or the LNP-siRNAs prepared by the above-mentioned preparation method.

[0099] The medicine of the present invention also includes pharmaceutically acceptable excipients, and the composition and type of the excipients are not particularly limited and can be prepared using conventional methods in the art.

[0100] To further illustrate the present invention, the following detailed description is given of a siRNA lipid nanoparticle for targeted treatment of chloasma provided by the present invention, as well as its preparation method and application, in conjunction with the examples. However, they should not be construed as limiting the scope of protection of the present invention.

[0101] according to Figure 1 The process shown is designed to implement the present invention:

[0102] Example 1

[0103] 1. Design of siRNAs targeting key melanin molecules TYR, MC1R and MITF

[0104] The mRNA sequences of human and mouse TYR, MC1R and MITF were searched on the NCBI website. After homology comparison analysis and in accordance with the siRNA design principles, candidate siRNA sequences were selected from the human-mouse common sequences or sequences with high similarity, with 5 pairs for each molecule.

[0105] 2. Validation of its effectiveness in mouse and human melanocytes

[0106] The siRNAs of three molecules of human and mouse TYR, MC1R and MITF were artificially synthesized, with 5 pairs of siRNAs for each molecule, and then transfected into human and mouse melanocytes using liposomes. Human melanocytes were primary cells, and mouse experimental cells were B16-F1 cell lines.

[0107] 3. Then, samples were collected at 36 and 48 hours respectively, and the expression of TYR, MC1R and MITF was detected by qRT-PCR. The results showed that the siRNAs shown in Table 1 had different inhibitory effects on their target molecules in the above two species, three molecules, five pairs of siRNAs per molecule, and a total of 30 pairs of siRNAs. The present invention selects two pairs of siRNAs with better interference effects and lower off-target effects for each target molecule.

[0108] 4. The above-mentioned M-siTyr-1, M-siTyr-2, M-siMc1r-1, M-siMc1r-2, M-siMitf-1 and M-siMitf-2 were transfected into mouse B16-F1 cells respectively, and samples were collected at 36 and 48 hours, and cell RNA was extracted and reverse transcribed into cDNA. The expression of TYR, MC1R and MITF was detected by qRT-PCR. The results are shown in Figure 2 As shown, M-siTyr-1, M-siTyr-2, M-siMc1r-1, M-siMc1r-2, M-siMitf-1 and M-siMitf-2 can effectively inhibit the expression of relevant target gene mRNA after transfection into B16-F1 cells.

[0109] Mouse qRT-PCR Primers:

[0110] Tyr:

[0111] Upstream primer (SEQ ID No. 25): 5′-ATCCTTCTTCTCCTCCTG-3′;

[0112] Downstream primer (SEQ ID No. 26): 5′-CGTAATAGTGGTCCCTCA-3′;

[0113] Mc1r:

[0114] Upstream primer (SEQ ID No. 27): 5′-TAGGGCTGGTGAGTCTGG-3′;

[0115] Downstream primer (SEQ ID No. 28): 5′-GAAGTAATACATGGGCGAGT-3′;

[0116] Mitf:

[0117] Upstream primer (SEQ ID No. 29): 5′-AGCAACGAGCTAAGGACC-3′;

[0118] Downstream primer (SEQ ID No. 30): 5′-GGATGGGATAAGGGAAAGT-3′;

[0119] Reference gene: mouse GAPDH

[0120] Upstream primer (SEQ ID No. 31): 5′-TCAACGGCACAGTCAAGG-3′;

[0121] Downstream primer (SEQ ID No. 32): 5'-GATGTTAGTGGGGTCTCGC-3'.

[0122] 5. The above H-siTyr-1, H-siTyr-2, H-siMc1r-1, H-siMc1r-2, H-siMitf-1 and H-siMitf-2 were transfected into primary human skin melanocytes, and samples were collected at 36 and 48 hours. Cell RNA was extracted and reverse transcribed into cDNA. The expression of TYR, MC1R and MITF was detected by qRT-PCR. The results are as follows: Figure 3 As shown, H-siTyr-1, H-siTyr-2, H-siMc1r-1, H-siMc1r-2, H-siMitf-1 and H-siMitf-2 can effectively inhibit the expression of relevant target gene mRNA after transfection into primary human skin melanocytes.

[0123] Human qRT-PCR Primers:

[0124] Tyr:

[0125] Upstream primer (SEQ ID No. 33): 5′-GCGGTGGGAACAAGAAAT-3′;

[0126] Downstream primer (SEQ ID No. 34): 5′-AGAATGATGCTGGGCTGA-3′;

[0127] Mc1r:

[0128] Upstream primer (SEQ ID No. 35): 5′-CTTCTGGGCTCCCTCAACT-3′;

[0129] Downstream primer (SEQ ID No. 36): 5′-CGCGTTCTCCACCAAGCT-3′;

[0130] Mitf:

[0131] Upstream primer (SEQ ID No. 37): 5′-CCAACGGCAGCAGGTAAA-3′;

[0132] Downstream primer (SEQ ID No. 38): 5′-CCAGGCTGGTTTGGACAT-3′;

[0133] Internal reference gene: human GAPDH:

[0134] Upstream primer (SEQ ID No. 39): 5′-GACCTGACCTGCCGTCTA-3′;

[0135] Downstream primer (SEQ ID No. 40): 5'-AGGAGTGGGTGTCGCTGT-3'.

[0136] Example 2

[0137] Preparation of LNP-siRNAs using microfluidics

[0138] 1) Preparation of lipid phase

[0139] Four lipids, DSPC, Cholesterol, DDAB and DMG-PEG2000, were added into anhydrous ethanol at a molar ratio of 10:48:40:2, fully dissolved and mixed to prepare a 24 mM lipid solution.

[0140] 2) Prepare the water phase

[0141] Prepare a citrate buffer (100 mM, pH 6). Take 15 mg each of the above mouse siRNAs (M-siTyr-1, M-siTyr-2, M-siMc1r-1, M-siMc1r-2, M-siMitf-1 and M-siMitf-2) and control siRNA (NC), and dissolve them in the citrate buffer.

[0142] 3) Microfluidic preparation of LNPs

[0143] The lipid phase and aqueous phase liquid are connected to a staggered herringbone micromixer (SHM) dedicated to microfluidics, and the lipid phase and aqueous phase are quickly mixed through the SHM using a syringe pump, with injection parameters FRR = 5:1, TFR = 6mL / min. The obtained mixed liquid is collected, filtered through a 22μm PES filter, and then placed in a MWCO 12-14kDa dialyzer for dialyzing to remove ethanol, which is the prepared LNP.

[0144] 4) LNP detection

[0145] The prepared LNPs need to be tested by dynamic light scattering (DLS) and cryogenic transmission electron microscopy (Cryo-TEM) to determine whether their quality meets the standards. The following shows the test results of M-siTyr-1, and the results of other LNPs are similar.

[0146] DLS test report Figure 4 As shown in Figure 2, the average LNP particle size is 67.73 nm and the PDI (Polydispersity index) is 0.078. The Cryo-TEM test results are as follows: Figure 5 As shown in the figure, a large number of vesicles with a diameter of about 50-90 nm were detected. These results suggest that the LNP production quality is good.

[0147] Example 3

[0148] Validation of the effects of LNP-siRNAs in mouse and human melanocytes

[0149] 1) Cellular uptake of LNP-siRNAs

[0150] Dii was used to stain LNPs and track cell uptake. Exosomes from bone marrow mesenchymal cells were used as positive control, and PBS (Ctrl) was used as negative control. Figure 6 As shown, compared with the control, both exosomes (Exo) and LNP prepared in Example 2 (LNP-M-siTyr-1) can be taken up by mouse melanoma cells B16-F1, indicating that the LNP-siRNAs of the present invention can successfully enter cells and exert their effects.

[0151] 2) Inhibitory effect of LNP-siRNAs on target genes in melanocytes

[0152] LNP-M-siTyr-1, LNP-M-siTyr-2, LNP-M-siMc1r-1, LNP-M-siMc1r-2, LNP-M-siMitf-1 and LNP-M-siMitf-2 prepared in Example 2 were added to mouse B16-F1 cells at a dose of 6 μL (containing approximately 0.6 nmol of siRNAs). Samples were collected at 36 and 48 hours, cellular RNA was extracted, reverse transcribed into cDNA, and qRT-PCR was used to detect the expression of TYR, MC1R and MITF.

[0153] The results are as follows Figure 7 As shown, in mouse melanocytes B16-F1, LNP-M-siRNAs could effectively inhibit the expression of TYR, MC1R and MITF compared with the control LNP-C.

[0154] LNP-H-siTyr-1, LNP-H-siTyr-2, LNP-H-siMc1r-1, LNP-H-siMc1r-2, LNP-H-siMitf-1 and LNP-H-siMitf-2 were added to primary human skin melanocytes at a dose of 6 μL (containing approximately 0.6 nmol of siRNAs). Samples were collected at 36 and 48 hours, and cell RNA was extracted and reverse transcribed into cDNA. The expression of TYR, MC1R and MITF was detected by qRT-PCR.

[0155] The results are as follows Figure 8 As shown, in primary human skin melanocytes, LNP-H-siRNAs could effectively inhibit the expression of TYR, MC1R and MITF compared with the control LNP-C.

[0156] Example 4

[0157] Example 2 Application of the prepared LNP-siRNA in mouse skin

[0158] 1) Inhibitory effect of LNP-siRNA on key molecules of melanin formation in mouse skin

[0159] 54 C57BL / 6 mice were divided into 3 groups: TYR group, MC1R group and MITF group, with 18 mice in each group. Each group was further divided into before injection, 3 days after injection and 6 days after injection. Specific operation: Part of the skin on the back of the mouse was prepared, and a 34G, 2mm sharp needle was used for intradermal injection. The injection volume at each injection point was about 0.02mL, and the injection area of ​​each mouse was about 3.14cm 2 There were about 15 to 18 injection points in the injection area, and each mouse was injected with 0.3 to 0.4 mL of LNP-siRNAs (containing 30 to 40 nmol of siRNA) each time. The skin sample of the control group was taken before injection (day 0). The experimental group was injected once every 3 days. The sampling time was calculated after 3 consecutive injections. Skin samples were taken 3 days and 6 days after injection. The samples were ground with liquid nitrogen, lysed with TRIzol, and RNA was extracted and reverse transcribed into cDNA. The expression of the target molecule was detected by qRT-PCR.

[0160] The results are as follows Fig. 9 As shown, the candidate mouse 6 pairs of LNP-siRNAs (M-siTyr-1, M-siTyr-2, M-siMc1r-1, M-siMc1r-2, M-siMitf-1 and M-siMitf-2) can inhibit the expression of corresponding target molecules in skin tissue to varying degrees. Therefore, the LNP-siRNAs prepared by the LNP technology of the present invention can effectively inhibit the expression of key molecules for melanin formation in skin tissue, indicating that LNP-siRNAs may be used as candidate nucleic acid drugs for the treatment of chloasma.

[0161] 2) Dosage evaluation of LNP-siRNAs in mouse skin

[0162] Using the method shown in Example 2, LNPs with a concentration of about 2.2 mg / mL were prepared, and the siRNA loaded was about 1.6 mg / mL. The concentration of siRNA loaded in LNP-siRNA was about 0.1 nmol / μL. The injection area of ​​each mouse was about 3.14 cm 2 The amount of LNP-siRNA injected each time was 22μg, 110μg, 220μg and 440μg, and the corresponding loading siRNA amount was 1nmol, 5nmol, 10nmol and 20nmol. The injection was once every 3 days for 3 consecutive times. Skin samples were collected on the 3rd day after injection to detect the inhibitory effect on target gene expression.

[0163] The results are as follows Fig.10 As shown, LNP-M-siTyr-1 inhibited the expression of TYR gene in mouse skin at 20 nmol. Similarly, LNP-M-siMc1r-1 inhibited the expression of MC1R gene in mouse skin at 20 nmol, and LNP-M-siMitf-1 inhibited MITF at 10 nmol. The above inhibitory effects all showed a dose-dependent trend.

[0164] 3) Preliminary safety assessment of LNP-siRNAs injected into mouse skin

[0165] To preliminarily evaluate the safety of LNP-siRNAs (LNP-M-siTyr-1, LNP-M-siMc1r-1, and LNP-M-siMitf-1) injected into tissues, a single dose of 200 nmol (10 times the effective dose in mice) was intradermally injected into the skin of mice once every 3 days for 3 consecutive times. Blood was collected 3 days after the completion of the above treatment to test liver and kidney function.

[0166] The results are shown in Table 1. Compared with before injection, there was no significant difference in the levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), and creatinine (Cre) in the blood of the injected mice (P>0.05), indicating that the effective dose of LNP-siRNAs in vivo has good safety.

[0167] Table 1 Changes in body functions after LNP-siRNAs injection

[0168]

[0169] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A LNP-siRNAs for treating chloasma, characterized in that: Includes siRNAs that target key molecules that inhibit melanin formation.

2. The LNP-siRNAs according to claim 1, characterized in that The key molecules for melanin formation include TYR, MC1R and MITF.

3. The LNP-siRNAs according to claim 2, characterized in that The siRNAs include M-siTyr-1 and M-siTyr-2 designed to target mouse TYR, M-siMc1r-1 and M-siMc1r-2 designed to target mouse MC1R, and M-siMitf-1 and M-siMitf-2 designed to target mouse MITF; The nucleotide sequence of the M-siTyr-1 is shown in SEQ ID No.1 to SEQ ID No.2; The nucleotide sequence of the M-siTyr-2 is shown in SEQ ID No.3 to SEQ ID No.4; The nucleotide sequence of the M-siMc1r-1 is shown in SEQ ID No.5 to SEQ ID No.6; The nucleotide sequence of the M-siMc1r-2 is shown in SEQ ID No.7 to SEQ ID No.8; The nucleotide sequence of the M-siMitf-1 is shown in SEQ ID No.9 to SEQ ID No.10; The nucleotide sequence of the M-siMitf-2 is shown in SEQ ID No.11 to SEQ ID No.12; The siRNAs include H-siTyr-1 and H-siTyr-2 designed to target human TYR, H-siMc1r-1 and H-siMc1r-2 designed to target human MC1R, and H-siMitf-1 and H-siMitf-2 designed to target human MITF; The nucleotide sequence of H-siTyr-1 is shown in SEQ ID No.13 to SEQ ID No.14; The nucleotide sequence of H-siTyr-2 is shown in SEQ ID No.15 to SEQ ID No.16; The nucleotide sequence of H-siMC1R-1 is shown in SEQ ID No.17 to SEQ ID No.18; The nucleotide sequence of H-siMc1r-2 is shown in SEQ ID No.19 to SEQ ID No.20; The nucleotide sequence of H-siMITF-1 is shown in SEQ ID No.21 to SEQ ID No.22; The nucleotide sequence of the H-siMitf-2 is shown in SEQ ID No.23 to SEQ ID No.

24.

4. The method for preparing LNP-siRNAs according to any one of claims 1 to 3, characterized in that: The following steps are involved: (1) dissolving lipids in anhydrous ethanol to prepare a lipid solution to obtain a lipid phase; (2) dissolving the LNP-siRNAs in a citric acid buffer in sequence to obtain an aqueous phase; (3) Mixing the lipid phase and the aqueous phase to prepare the LNP-siRNAs.

5. The preparation method according to claim 4, characterized in that: The concentration of the lipid solution in step (1) is 2.4 mM to 24 mM.

6. The preparation method according to claim 5, characterized in that: The lipids include DSPC, Cholesterol, DDAB and DMG-PEG2000, and the molar ratio of DSPC, Cholesterol, DDAB and DMG-PEG2000 is (10-16):(46.5-60):(28-40):(2-2.5).

7. The preparation method according to claim 4, characterized in that: The mixing in step (3) includes connecting the lipid phase and the aqueous phase liquid to a staggered herringbone micromixer dedicated to microfluidics, and using a syringe pump to quickly mix the lipid phase and the aqueous phase through SHM, with injection parameters FRR=(2-10):1, TFR=3-6mL / min.

8. The preparation method according to claim 7, characterized in that: After SHM mixing, the mixed liquid is collected and filtered and dialyzed to remove ethanol.

9. Use of the LNP-siRNAs according to any one of claims 1 to 3 or the LNP-siRNAs prepared by the preparation method according to any one of claims 4 to 8 in the preparation of a drug for the targeted treatment of chloasma.

10. A drug for targeted treatment of chloasma, characterized in that: The active ingredients include the LNP-siRNAs described in any one of claims 1 to 3 or the LNP-siRNAs prepared by the preparation method described in any one of claims 4 to 8.

Images