Microorganism, microbial inoculant and application thereof
By screening a new strain of Candida albicans, CGMCC No. 30793, the problems of slow microbial growth and high nitrate content in salt-reduced fermented chili peppers were solved, achieving efficient fermentation and healthy-flavored food production, suitable for fermentation processes in food and feed.
Patent Information
- Application Number
- CN202411945514.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-26
- Publication Date
- 2026-07-03
- Estimated Expiration
- 2044-12-26
Smart Images

Figure BDA0005214228080000071 
Figure BDA0005214228080000081 
Figure HDA0005214228230000011
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial technology, specifically to microorganisms, microbial agents, and their applications. Background Technology
[0002] Traditional fermented chili peppers rely on microorganisms attached to the surface of the food raw materials for fermentation, and salt is usually added to reduce the water activity of the chili peppers, inhibit the growth of spoilage bacteria, extend the shelf life of the chili peppers, and improve the flavor. With the global advocacy for low-sodium diets, reduced-sodium fermentation is gaining increasing attention. Reduced-sodium fermented chili peppers typically contain 5-12% salt, but during the fermentation process, most yeasts still cannot avoid a decrease in viable bacteria count due to salt stress. Therefore, under natural fermentation conditions, microbial growth is slow, and the production cycle of fermented foods is long, making it difficult to meet the needs of large-scale production of reduced-sodium fermented foods.
[0003] Therefore, screening yeast strains with good salt and acid tolerance and good fermentation performance is of great significance for the development of low-salt fermented foods and their fermentation processes. Summary of the Invention
[0004] This invention aims to at least partially solve one of the technical problems existing in the prior art. To this end, this invention provides *Candida sp.*, microbial agents, and their applications. The new *Candida sp.* strain screened by this invention exhibits rapid growth, strong salt and acid tolerance, the ability to inhibit pathogenic bacteria growth, and a strong ability to metabolize nitrates. Food or feed production methods developed using this new strain and microbial agent demonstrate high salt tolerance, high fermentation efficiency, and a short production cycle. Fermented foods made using this new strain are rich in yeast, low in nitrates, and nutritionally healthy with a unique flavor.
[0005] In a first aspect, the present invention provides a microorganism. According to an embodiment of the present invention, the microorganism is *Candida sp.*, which was deposited on May 27, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 30793.
[0006] Preservation information:
[0007] Strain name: FVPHBJ24143
[0008] Classification and naming: Candida sp.
[0009] Deposit date: May 27, 2024
[0010] Preservation Institution: China General Microbiological Culture Collection Center, China Microbiological Culture Collection Committee
[0011] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China
[0012] Accession number: CGMCC No. 30793
[0013] The novel Candida sp. FVPHBJ24143 strain obtained by this invention exhibits rapid growth, strong salt and acid tolerance, and the ability to inhibit the growth of pathogens. It also demonstrates a strong ability to metabolize nitrates. Food or feed production methods developed using this novel strain and microbial agents exhibit high salt tolerance, high fermentation efficiency, and short production cycles. Fermented foods made using this novel strain are rich in yeast, low in nitrates, and are nutritious, healthy, and have a unique flavor.
[0014] In a second aspect, the present invention provides a microbial inoculant. According to embodiments of the invention, it includes the aforementioned microorganisms.
[0015] Those skilled in the art will understand that the characteristics and advantages described above for microorganisms also apply to this microbial agent, and will not be repeated here.
[0016] In a third aspect, the present invention provides a food additive or feed additive. According to embodiments of the present invention, it includes the aforementioned microorganisms. The food additive or feed additive according to embodiments of the present invention, during the preparation of food or feed, can be used to adjust the acidity of the food or feed, improve the flavor characteristics of the food, reduce the nitrate content in the product, improve product quality, adjust the yeast content in the food or feed, and can also effectively inhibit the growth of pathogenic bacteria such as Staphylococcus aureus and Escherichia coli, thereby improving product safety.
[0017] In a fourth aspect, the present invention provides a food or feed. According to embodiments of the present invention, the food comprises at least one of the aforementioned microorganisms, the aforementioned microbial agents, or the aforementioned food additives; the feed comprises at least one of the aforementioned microorganisms, the aforementioned microbial agents, or the aforementioned feed additives.
[0018] Those skilled in the art will understand that the features and advantages described above for microorganisms, microbial agents, food additives or feed additives also apply to this food or feed, and will not be repeated here.
[0019] In a fifth aspect, the present invention provides for the use of the aforementioned microorganisms, the aforementioned microbial agents, the aforementioned food additives or feed additives in the preparation of food or feed.
[0020] Those skilled in the art will understand that the features and advantages described above for microorganisms, microbial agents, food additives or feed additives also apply to this use, and will not be repeated here.
[0021] In a sixth aspect, the present invention provides a method for preparing food or feed. According to embodiments of the invention, the method includes: fermenting at least one of the aforementioned microorganisms, the aforementioned microbial agents, or the aforementioned food additives or feed additives with food raw materials or feed raw materials to obtain the food or feed. The preparation method according to embodiments of the present invention exhibits high salt tolerance, high fermentation efficiency, short production cycle, and high application value.
[0022] In a seventh aspect, the present invention provides a method for inhibiting the growth of pathogenic bacteria in vitro. According to embodiments of the present invention, the aforementioned microorganisms, the aforementioned microbial agents, or the aforementioned food additives or feed additives are co-cultured with a sample containing pathogenic bacteria. According to the method of the embodiments of the present invention, *Candida* FVPHBJ24143 has the effect of inhibiting the growth of *Staphylococcus aureus* and *Escherichia coli*, and can be used to inhibit the growth of pathogenic bacteria in vitro. Attached Figure Description
[0023] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the description of the embodiments taken in conjunction with the following drawings, in which:
[0024] Figure 1 The morphological identification results of Candida albicans CGMCC No. 30793 in Example 2 of this invention;
[0025] Figure 2 The growth curve of Candida albicans CGMCC No. 30793 in Example 3 of this invention;
[0026] Figure 3 The absorbance (OD) values of *Candida albicans* CGMCC No. 30793 before and after cultivation in different pH media in Example 3 of this invention are shown. 600 The results of the investigation;
[0027] Figure 4 The results of investigating the viable cell count of Candida albicans CGMCC No. 30793 in culture media with different pH values in Example 3 of this invention;
[0028] Figure 5 The absorbance (OD) values of *Candida albicans* CGMCC No. 30793 before and after cultivation in culture media containing different salt concentrations in Example 3 of this invention are shown. 600 The results of the investigation;
[0029] Figure 6The results of investigating the viable count of Candida albicans CGMCC No. 30793 in culture media containing different salt concentrations in Example 3 of this invention;
[0030] Figure 7 This is the viable cell count during the preparation of fermented vegetables using Candida albicans CGMCC No. 30793 vegetable starter in Example 4 of the present invention.
[0031] Figure 8 This is the result of investigating the inhibitory effect of Candida albicans CGMCC No. 30793 on the growth of Escherichia coli during vegetable fermentation in Example 5 of the present invention;
[0032] Figure 9 This is the result of the investigation on the growth inhibition of Staphylococcus aureus by Candida albicans CGMCC No. 30793 during vegetable fermentation in Example 5 of the present invention;
[0033] Figure 10 The results of the investigation on the ability of Candida albicans CGMCC No. 30793 to metabolize nitrates in Example 6 of the present invention are shown. Detailed Implementation
[0034] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.
[0035] The endpoints and any values of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of the various ranges, the endpoint values of the various ranges and individual point values, and individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.
[0036] In this document, the terms “comprising” or “including” are open-ended expressions, meaning that they include the contents specified in this invention, but do not exclude other aspects.
[0037] In this document, the terms “optionally,” “optionally,” or “optionally” generally refer to an event or condition that may, but may not, occur, and the description includes both cases in which the event or condition occurs and cases in which the event or condition does not occur.
[0038] Terms and Definitions
[0039] In this article, the term "YPD medium" refers to yeast culture medium containing yeast extract, peptone, and glucose. Based on the content of the solidifying agent (usually agarose), it is divided into two types: YPD solid medium and YPD liquid medium.
[0040] In this article, the term "Candida" refers to a yeast belonging to the phylum Ascomycota, class Blastomycetes, order Cryptococccates, family Cryptococcaceae, and genus Candida. Its colonies are creamy, smooth, milky white, and have pseudohyphae.
[0041] In this paper, the term "NaNO3" refers to nitrate, which is added to the culture medium to test the strain's ability to metabolize nitrate.
[0042] In this article, the term "OD" 600 "This is a standard method for determining bacterial concentration. The number of bacteria is estimated by comparing the turbidity of the bacterial suspension with a standard curve."
[0043] This invention proposes a microorganism, a microbial agent, a food additive or feed additive and its uses, a method for preparing food or feed, and a method for inhibiting the growth of pathogenic bacteria in vitro, which will be described in detail below.
[0044] strains
[0045] This invention proposes a microorganism. According to an embodiment of the invention, the microorganism is Candida sp., which was deposited on May 27, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 30793.
[0046] According to an embodiment of the present invention, the 16S rDNA sequencing results of the microorganism are shown in SEQ ID NO:1.
[0047] The new strain of Candida albicans obtained by screening in this invention has a fast growth rate, strong salt and acid tolerance, can inhibit the growth of pathogens, and has a strong ability to metabolize nitrates. The production method of food or feed developed using the new strain and microbial agent of this invention has high salt tolerance, high fermentation efficiency, and short production cycle. Fermented foods made using this new strain are rich in yeast, low in nitrates, nutritious, healthy, and have a unique flavor.
[0048] In this article, the terms “Candida sp. FVPHBJ24143”, “Candida FVPHBJ24143”, and “Candida CGMCC No.30793” are synonymous.
[0049] Microbial agents
[0050] This invention proposes a microbial inoculant. According to embodiments of the invention, it includes the aforementioned microorganisms.
[0051] Those skilled in the art will understand that the characteristics and advantages described above for microorganisms also apply to this microbial agent, and will not be repeated here.
[0052] It should be noted that the microbial inoculant of the present invention may be a liquid microbial inoculant, including but not limited to fermentation products; or it may be a solid microbial inoculant, including but not limited to freeze-dried powder.
[0053] It should be noted that in the microbial inoculant of the present invention, the Candida albicans CGMCC No. 30793 exists in the form of live cells and / or non-live cells.
[0054] In this article, "living cell" refers to a cell that has the ability to metabolize, reproduce, or replicate.
[0055] For example, the living cells may be immobilized cells. In this document, "immobilized cells" refers to living cells fixed on a carrier, which can carry out life activities such as growth, development, reproduction, heredity, and metabolism within a certain spatial range.
[0056] In this document, "non-living cells" refers to cells that do not have the ability to metabolize, reproduce, and replicate, including but not limited to dried bacterial cells. For example, the microbial agent is a lyophilized powder.
[0057] In some specific embodiments, the Candida albicans CGMCC No. 30793 exists as live cells, dry cells, immobilized cells, or in any other form.
[0058] In some specific embodiments, the dried mycelium is obtained by freeze-drying the Candida albicans CGMCC No. 30793.
[0059] In some specific embodiments, the microbial agent may also contain strains acceptable for use in food and feed.
[0060] In some specific embodiments, the microbial agent further includes food-grade excipients or carriers, or animal feed-grade excipients or carriers.
[0061] In this article, "acceptable in food" refers to substances or compositions that are edible for human consumption, which may be adjusted according to the food requirements of different countries.
[0062] In this article, “acceptable adjuvants or carriers in animal feed” refers to substances or compositions that can be consumed by animals, and these can be adjusted according to the animal feed requirements of different countries.
[0063] Food additives or feed additives
[0064] This invention proposes a food additive or feed additive. According to embodiments of the invention, it includes the aforementioned microorganisms. The food additive or feed additive according to embodiments of the invention, during the preparation of food or feed, can be used to adjust the acidity of the food or feed, improve the flavor characteristics of the food, reduce the nitrate content in the product, improve product quality, adjust the yeast content in the food or feed, and effectively inhibit the growth of pathogenic bacteria such as Staphylococcus aureus and Escherichia coli, thereby improving product safety.
[0065] food or feed
[0066] This invention provides a food or feed. According to embodiments of the invention, the food includes at least one of the aforementioned microorganisms, the aforementioned microbial agents, or the aforementioned food additives; the feed includes at least one of the aforementioned microorganisms, the aforementioned microbial agents, or the aforementioned feed additives.
[0067] Those skilled in the art will understand that the features and advantages described above for microorganisms, microbial agents, food additives or feed additives also apply to this food or feed, and will not be repeated here.
[0068] According to embodiments of the present invention, the product further includes food- or feed-acceptable excipients or carriers. This results in food or feed products that are nutritious, healthy, and have a unique flavor.
[0069] In some specific embodiments, the aforementioned microorganisms, microbial agents, or food additives are added to or inoculated into food or feed.
[0070] For example, the food includes, but is not limited to: fermented chili peppers, fermented cabbage, fermented cucumbers, and fermented radishes.
[0071] use
[0072] This invention proposes the use of the aforementioned microorganisms, the aforementioned microbial agents, and the aforementioned food additives or feed additives in the preparation of food or feed.
[0073] Those skilled in the art will understand that the features and advantages described above for microorganisms, microbial agents, food additives or feed additives also apply to this use, and will not be repeated here.
[0074] Methods for preparing food or feed
[0075] This invention proposes a method for preparing food or feed. According to embodiments of the invention, the method includes: fermenting at least one of the aforementioned microorganisms, the aforementioned microbial agents, or the aforementioned food additives or feed additives with food raw materials or feed raw materials to obtain the food or feed. The preparation method according to embodiments of the invention exhibits high salt tolerance, high fermentation efficiency, short production cycle, and high application value.
[0076] According to an embodiment of the present invention, before fermentation, the food raw material or feed raw material is mixed with sodium chloride. Based on the mass of the food raw material or feed raw material, the amount of sodium chloride added is 5-25 wt%, preferably 5-20 wt%.
[0077] According to an embodiment of the present invention, the pH of the fermentation treatment is 2.5 to 6.5, preferably 3 to 6, and more preferably 4 to 6.
[0078] Further optimization of the amount of sodium chloride added and pH treatment conditions during fermentation is needed to obtain higher quality food or feed products.
[0079] Methods to inhibit the growth of pathogens in vitro
[0080] This invention proposes a method for inhibiting the growth of pathogenic bacteria in vitro. According to embodiments of the invention, the aforementioned microorganisms, the aforementioned microbial agents, or the aforementioned food additives or feed additives are co-cultured with a sample containing pathogenic bacteria. According to the method of this invention, *Candida* FVPHBJ24143 has the effect of inhibiting the growth of *Staphylococcus aureus* and *Escherichia coli*, and can be used to inhibit the growth of pathogenic bacteria in vitro.
[0081] According to an embodiment of the present invention, the pathogenic bacteria include at least one of Staphylococcus aureus and Escherichia coli.
[0082] The method according to embodiments of the present invention can effectively inhibit the growth of the aforementioned pathogens.
[0083] Unless otherwise specified, the YPD solid culture medium used in the embodiments of the present invention has the following formulation: 20g peptone, 10g yeast extract, 20g glucose, 10g agar, and 1L distilled water.
[0084] Unless otherwise specified, the YPD liquid culture medium used in the embodiments of the present invention is formulated as follows: 20g peptone, 10g yeast extract, 20g glucose, and 1L distilled water.
[0085] Unless otherwise specified, the formulations of the enrichment medium (EM) and nitrate medium (NM) used in the embodiments of the present invention are shown in Table 1. After preparation, the pH of the medium was adjusted to 7.0–7.3. The formulations of the added trace elements are shown in Table 2.
[0086] Table 1. Composition of enrichment medium (EM) and nitrate medium (NM)
[0087]
[0088]
[0089] Table 2 Trace Element Composition Table
[0090] Element Content (g / L) Element Content (g / L) FeCl3·6H2O 1.50 ZnSO4·7H2O 0.12 H3BO3 0.15 KI 0.18 CuSO4·5H2O 0.03 MnCl2·4H2O 0.12 Na2MoO4·2H2O 0.06 CoCl2·6H2O 0.15 Disodium EDTA 10.00 NaHCO3 3.00
[0091] The present invention will be explained below with reference to embodiments. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.
[0092] Example 1: Obtaining Candida albicans CGMCC No. 30793
[0093] The Candida albicans of this invention, CGMCC No. 30793, was isolated from naturally fermented chili sauce from Hebei Province.
[0094] The process of collecting and isolating the strain: Naturally fermented chopped chili peppers were added to sterilized physiological saline, mixed well, diluted and spread on YPD solid medium. The culture was incubated at pH 6.0±0.2 and 30℃ for 24-48 hours. Single colonies of different sizes and morphologies were picked and streaked on fresh YPD solid medium plates. The culture was incubated at 30℃ for 24-48 hours. The streaking purification culture was repeated multiple times until the colonies in the plates had the same morphology. After microscopic examination showed no contamination, the strain was named FVPHBJ24143 and identified.
[0095] Obtaining bacterial culture: Pick a single colony with an inoculation loop and place it in YPD liquid medium, then incubate at 37°C until the bacterial culture reaches OD. 600 When the concentration is 1.0 to 1.5, the strain is preserved.
[0096] Preservation of bacterial strains: The above OD 600 After mixing the bacterial culture with a concentration of 1.0 to 1.5 with sterile 50% glycerol in a cryovial at a 1:1 ratio, store at -80°C.
[0097] Example 2: Identification of Candida albicans CGMCC No. 30793
[0098] After further confirming that the culture isolated and purified in Example 1 was a pure culture by streak and smear microscopy, morphological and physiological biochemical identification of the bacterial strain, PCR amplification and sequencing analysis of the 16S rDNA gene were performed.
[0099] 1. Morphological and physiological / biochemical identification
[0100] Refer to the "Handbook for Systematic Identification of Common Fungi" to identify the morphological characteristics and physiological and biochemical properties of the test strains.
[0101] Morphological identification results are as follows Figure 1 .
[0102] The identification results showed that strain FVPHBJ24143 exhibited the following colony morphology characteristics on YPD agar medium: creamy, smooth, milky white colonies with pseudohyphae. Figure 1 The final pH in YPD liquid medium was 3.0.
[0103] 2. PCR amplification and sequencing analysis of the 16S rDNA gene
[0104] The 16S rDNA sequence of strain FVPHBJ24143 was identified. PCR amplification conditions: pre-denaturation at 95℃ for 10 min, followed by 30 cycles: denaturation at 94℃ for 30 s, annealing at 56℃ for 30 s, extension at 72℃ for 1.5 min (1 kb / min), and final extension at 72℃ for 5 min; storage at 4℃. The obtained PCR products were detected by 1% agarose gel electrophoresis. The PCR reaction system is shown in Table 3.
[0105] Table 3 PCR reaction system
[0106] PCR reaction system composition Volume (μL) Primer 27F (10 μmol / L) 2 Primer 1492R (10 μmol / L) 2 2×Gold Star Best Mixed 25 DNA template 2 <![CDATA[ddH2O]]> 19 Total volume 50
[0107] The strain FVPHBJ24143 was sent to Sangon Biotech (Shanghai) Co., Ltd. for 16S rDNA sequencing. The obtained sequence was compared with GenBank, and a phylogenetic tree was constructed using MEGA11.0.13 to compare the sequence of the test strain with that of other strains in the same genus.
[0108] The results showed that the isolated strain FVPHBJ24143 belonged to the same branch as other strains of Candida, and had 99% homology with the 16S rDNA sequence of strain Unclassifed Saccharomycetales, [Candida] sp.
[0109] Based on the physiological and biochemical identification results, strain FVPHBJ24143 was further confirmed to be Candida albicans, with the sequence accession number CGMCC No.30793.
[0110] The final identification confirmed that the isolated strain FVPHBJ24143 was a Candida strain, named Candida FVPHBJ24143 (hereinafter referred to as "Candida CGMCC No. 30793"), and was deposited at the China General Microbiological Culture Collection Center on May 27, 2024, with the accession number CGMCC No. 30793.
[0111] The 16S rDNA sequencing results of Candida albicans CGMCC No. 30793 are shown in SEQ ID NO:1.
[0112] CTTCCGTAGGGGTGAACCTGCGGAAGGATCATTACTGAAAAACAAAAAACTTGTTTTTGTTTGAACAAACTTAACCAAACATTTTATTTTGCATTCTACGAATGAAATCTATAAAACTTTCAACAACGGATCTCTTGGTTCTCGCACCGATGAAGAACGCAGCGAAATGCGATACGTAGTATGACTTGCAGACGTGAAT CATCGAATCTTTGAACGCACCTTGCGCCCTGGTCATGCCAGGGCATGCCTGTTTGAGCGGAGTTCTTCTCAAACCTTACGGTTTTGGTTTTGAAGACTTAAATATAGCTGCTGTATAATTAAACTAATACAGATTCTATTCCCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAA(SEQ ID NO:1)
[0113] Example 3: Investigation of growth characteristics, acid production capacity, acid tolerance, and salt tolerance of Candida albicans CGMCC No. 30793
[0114] Examining the basic characteristics of strains, such as growth characteristics, acid production capacity, acid tolerance, and salt tolerance, helps to screen out microbial strains with specific application potential.
[0115] In this embodiment, the experimental strain was prepared as follows: Candida albicans CGMCC No.30793 was streaked on YPD agar plates for 24–48 h, and single colonies were picked and grown in YPD liquid medium for 16–20 h to activate the strain.
[0116] 1. Investigation of the growth characteristics and acid production capacity of the strain
[0117] The activated strain was inoculated into YPD liquid medium at a 1% inoculum and incubated statically at 30°C. The absorbance was measured at 600 nm every 1 hour until the stationary phase. A growth curve was plotted with the incubation time on the x-axis and the corresponding absorbance value on the y-axis. Figure 2 ).
[0118] The results showed that: (1) During the first 24 hours of culture, Candida albicans CGMCC No.30793 was in the growth adaptation period and its growth and metabolism were slow; after 24 hours, it entered the logarithmic growth phase. (2) The pH of the bacterial culture when it reached the stationary phase was basically maintained below 4.0.
[0119] 2. Investigation of the acid resistance characteristics of the strain
[0120] The activated bacterial strain was inoculated at a rate of 1% into YPD liquid medium with different pH values (pH values investigated were 5.0, 4.5, 4.0, 3.5, 3.0, and 2.5), and incubated statically at 30°C for 24 hours. The absorbance (OD) of the activated bacterial strain at 600 nm was measured before and after incubation in different pH mediums. 600 ()( Figure 3 The number of viable yeast cells before and after culturing activated strains was determined using a culturable microbial assay. Figure 4 ).
[0121] The results showed that *Candida albicans* CGMCC No. 30793 exhibited high acid tolerance. Growth was good at YPD liquid medium with a pH of 4–5; even when the pH dropped to 3.0, it maintained a high survival rate, with the viable cell count remaining at 102. 6 CFU / g or higher.
[0122] 3. Investigation of the salt tolerance characteristics of the strain
[0123] The activated strain was inoculated at a rate of 1% into YPD liquid medium containing different NaCl concentrations (0%, 4%, 8%, 10%, 15%, 20%, and 25%), and incubated statically at 3°C for 24 hours. The absorbance (OD) values of the activated strain before and after incubation were measured in mediums with different salt concentrations. 600 ()( Figure 5 Simultaneously, the number of viable yeast cells before and after culturing the activated strain was determined using a culturable microbial assay. Figure 6 ).
[0124] The results showed that *Candida albicans* CGMCC No. 30793 could still grow in YPD liquid medium with a salt concentration greater than 20%; and in YPD liquid medium with a salt concentration of 25%, the viable cell count was maintained at 102. 6 CFU / g or higher.
[0125] 4. Comparative study of the salt tolerance characteristics of Candida albicans CGMCC No. 30793 and known Candida albicans.
[0126] The inventors collected and organized data on the salt tolerance of Candida albicans known in existing patents, as detailed in Table 4.
[0127] Table 4 shows the salt tolerance of Candida albicans in the patent.
[0128] Patent number Salt tolerance (%) years CN202110674420.8 5-15 2021 CN202010578543.7 10-12 2020 CN201811617006.8 ≤5 2018 CN201611248784.5 1-5 2016
[0129] The results showed that the salt tolerance of Candida albicans CGMCC No.30793 in this invention was 20%, which is higher than that of known Candida albicans involved in currently published patents.
[0130] Example 4: Application of Candida albicans CGMCC No. 30793 in the preparation of fermented vegetable foods
[0131] The metabolic activities of certain microorganisms can increase the nutritional value and flavor of fermented foods and extend their shelf life.
[0132] In this embodiment, fermented vegetables were prepared using Candida albicans CGMCC No. 30793, and the specific method is as follows:
[0133] 1. Preparation of Candida albicans CGMCC No. 30793 starter culture
[0134] Candida albicans CGMCC No. 30793 was streaked on YPD agar plates for 24–48 h. Single colonies were picked and grown in YPD liquid medium for 16–20 h to activate the culture. The activated Candida albicans CGMCC No. 30793 was then inoculated into YPD liquid medium at a 1% inoculum and cultured for 16–20 h. The culture was then centrifuged, washed with sterile distilled water until no culture medium residue remained, and resuspended in sterile distilled water to achieve a cell density of 1 × 10⁻⁶ cells / mL. 10 ~1×10 11 CFU / mL indicates the fermentation agent of Candida albicans CGMCC No. 30793.
[0135] 2. Preparation of Fermented Vegetables
[0136] Take 50.0 kg of fresh vegetables, select, wash, and drain them. After crushing or leaving them whole, add 4.5–7.5 kg of salt and mix well. The salt content should be 8%–12% of the total fresh vegetable weight. Inoculate with 1% of the total vegetable weight of Candida albicans CGMCC No. 30793 starter culture. Ferment at room temperature in a sealed container for 30 days to obtain fermented vegetables made using Candida albicans CGMCC No. 30793 as the starter culture. The viable cell count during the entire fermentation process is examined, and the results are shown in […]. Figure 7 .
[0137] The results showed that the viable count of Candida albicans CGMCC No.30793 remained at 10 throughout the entire vegetable fermentation process. 5 CFU / mL or higher.
[0138] For example, vegetables suitable for fermentation using Candida albicans CGMCC No. 30793 include, but are not limited to: chili peppers, cabbage, cucumbers, radishes, etc.
[0139] Example 5: Investigation of the antibacterial properties of Candida albicans CGMCC No. 30793
[0140] Staphylococcus aureus is an important foodborne pathogen widely distributed in nature, including on human skin, in the respiratory tract, and in the digestive tract. Under suitable conditions, it can produce enterotoxins, causing food poisoning. In the food preparation industry, controlling the growth of Staphylococcus aureus and preventing its toxin production is crucial. In the food preparation field, Escherichia coli can serve as an indicator of fecal contamination, reflecting the sanitary condition of food or water. In this embodiment, the antibacterial properties of Candida albicans CGMCC No. 30793 against Escherichia coli and Staphylococcus aureus were investigated using the following method.
[0141] 1. Inhibits the growth of Escherichia coli
[0142] Add 200 μl of distilled water and 10 μl of Candida albicans CGMCC No. 30793 fermentation broth supernatant to wells A1-F1 of a 96-well plate, mix well, and add 100 μl of LB medium to each of the remaining wells. Aspirate 100 μl of the mixture from wells A1-F1 and add it to wells A2-F2, mix well. Then aspirate 100 μl of the mixture from wells A2-F2 and add it to wells A3-F3, mix well. Continue this process until wells A10-F10 are reached.
[0143] Take cultured *E. coli* and prepare a bacterial suspension with a concentration equivalent to 0.5 McFarland standard using sterile water. Dilute the suspension 1:1000 with LB medium and add 100 μL of the suspension to wells 1-10 and well 12 of each row, then mix well. Incubate at 37°C for 16-20 hours. Measure the OD value every hour until the bacterial density stabilizes and measurements are stopped.
[0144] The results showed that *Candida albicans* CGMCC No. 30793 could inhibit the growth of *Escherichia coli*. During the observation period of 12–24 hours, the concentration of *E. coli* in the experimental group was significantly lower than that in the control group. Figure 8 ).
[0145] 2. Inhibits the growth of Staphylococcus aureus
[0146] Add 200 μl of distilled water and 10 μl of fermentation broth supernatant to wells A1-F1 of a 96-well plate and mix well. Add 100 μl of LB medium to each of the remaining wells. Pipette 100 μl of the mixture from wells A1-F1 and add it to wells A2-F2, then mix well. Pipette 100 μl of the mixture from wells A2-F2 and add it to wells A3-F3, then mix well. Continue this process until wells A10-F10 are reached.
[0147] Take cultured Staphylococcus aureus and prepare a bacterial suspension with a concentration equivalent to 0.5 McFarland standard using sterile water. Dilute the suspension 1:1000 with LB medium and add 100 μL of the suspension to wells 1-10 and well 12 of each row, then mix well. Incubate at 37°C for 16-20 hours. Measure the OD value every hour until the bacterial density stabilizes and measurements are stopped.
[0148] The results showed that *Candida albicans* CGMCC No. 30793 could inhibit the growth of *Staphylococcus aureus*. During the observation period of 12–24 hours, the concentration of *Staphylococcus aureus* in the experimental group was significantly lower than that in the control group. Figure 9 ).
[0149] Example 6: Investigation of the ability of Candida albicans CGMCC No. 30793 to metabolize nitrates
[0150] In the food industry, controlling the levels of nitrates and nitrites is crucial for food safety. Candida albicans CGMCC No. 30793 of this invention is commonly used in the preparation of fermented foods. Therefore, this embodiment investigates the ability of Candida albicans CGMCC No. 30793 to metabolize nitrates. The specific investigation method is as follows.
[0151] 1. Preparation of bacterial strains
[0152] The *Candida* strain CGMCC No. 30793, stored at -80℃, was inoculated into an Erlenmeyer flask containing 100 mL of enrichment medium (EM). The flask was then incubated for 24 hours at 25℃ and 160 rpm using a constant-temperature shaker. After activation, the cell density was adjusted to approximately 2.0 (OD) using sterile water. 600 =2.0), to obtain OD 600 =2.0 bacterial suspension.
[0153] 2. Investigation of the strain's ability to metabolize nitrates
[0154] Take 1 mL of OD 600 Add the bacterial suspension (2.0 g / L) to a new 99 mL Erlenmeyer flask containing EM (e.g., EM without bacterial suspension) as a blank control. Shake well and measure the OD value at 600 nm. Measure the OD value at 600 nm every 1 hour until the cell density is basically stable and then stop measuring. Add 5 mL of OD... 600 A bacterial suspension with a concentration of 2.0 μL was added to a fresh 95 mL Erlenmeyer flask containing nitrate medium (NM), and the change in nitrate content was analyzed to determine the strain's ability to metabolize nitrate. All experiments included a blank control and three replicates.
[0155] The results showed that after Candida albicans CGMCC No. 30793 reached the stationary phase, the NaNO3 metabolism level remained above 70 mg / L. Figure 10 It has a strong ability to metabolize nitrates.
[0156] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.
Claims
1. A microorganism, characterized in that, The microorganism is Candida utilis (ATCC 8865) Candida sp. ) FVPHBJ24143, deposited with the China General Microbiological Culture Collection Center on May 27, 2024, and assigned accession number CGMCC No. 30793.
2. A microbial inoculant, characterized in that, Includes the microorganisms described in claim 1.
3. A food additive or feed additive, characterized in that, Includes the microorganisms described in claim 1.
4. A food or feed, characterized in that, The food includes at least one of the microorganisms of claim 1, the microbial agent of claim 2, or the food additive of claim 3; the feed includes at least one of the microorganisms of claim 1, the microbial agent of claim 2, or the feed additive of claim 3.
5. The food or feed according to claim 4, characterized in that, This further includes food or feed-acceptable excipients or carriers.
6. The use of the microorganisms described in claim 1, the microbial agents described in claim 2, and the food additives or feed additives described in claim 3 in the preparation of food or feed.
7. A method of preparing a food or feed product, characterized in that, include: The food or feed is obtained by fermenting at least one of the microorganisms of claim 1, the microbial agent of claim 2, or the food additive or feed additive of claim 3 with food raw materials or feed raw materials.
8. The method of claim 7, wherein, Before fermentation, the food or feed ingredients are mixed with sodium chloride. The amount of sodium chloride added is 5 to 25 wt% based on the mass of the food or feed ingredients.
9. The method of claim 8, wherein, The amount of sodium chloride added is 5–20 wt%.
10. The method of claim 8, wherein, The pH of the fermentation treatment is 2.5 to 6.
5.
11. The method according to claim 8, characterized in that, The pH of the fermentation treatment is 3 to 6.
12. The method of claim 8, wherein, The pH of the fermentation treatment is 4 to 6.
13. A method of inhibiting the growth of pathogenic bacteria in vitro, comprising contacting the bacteria with a composition according to any one of claims 1 to 12. include: The microorganisms of claim 1, the microbial agents of claim 2, or the food additives or feed additives of claim 3 are co-cultured with samples containing pathogens. The pathogenic bacteria are selected from at least one of Staphylococcus aureus and Escherichia coli.
Citation Information
Patent Citations
Candida zeylanoides capable of producing protease
CN111647517A
Candida sp. B2, chili product and method
CN116769619A
Haemophilus candida and application thereof in aquaculture
CN117603824A
Candida rugosa with bacteriostatic activity and fermentation metabolite and application thereof
CN117683649A
Candida tropicalis with effect of reducing nitrite and ammonia nitrogen and application of candida tropicalis
CN119120235A