Method for eliminating CD19 positive lymphatic system malignant tumors by using NK cells expressing CD19-CAR

Abstract

The invention relates to elimination of CD19 positive lymphatic system malignant tumors by an NK cell expressing CD19-CAR. Provided herein are compositions of # imgabs0 # cells that express CD19 CAR, CD16, and IL2, as well as methods of using these cells and treating cancer in a patient.

Description

[0001] This application is a divisional application of the invention application with the application date of August 1, 2019, the Chinese national application number of 201980023744.6, and the invention name of "NK cells expressing CD19-CAR eliminate CD19-positive lymphoid system malignancies". Technical Field

[0002] The field of the invention is engineered cells relevant to cancer treatment. Background Art

[0003] The Background Description includes information that may be useful in understanding the present invention. No admission is made that any of the information provided herein is prior art or relevant to the presently claimed invention, nor is an admission made that any publication specifically or implicitly mentioned is prior art.

[0004] All publications and patent applications are incorporated herein by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. Where a definition or use of a term in an incorporated reference is inconsistent or contrary to the definition of that term provided herein, the definition of that term provided herein applies and the definition of that term in the reference does not apply.

[0005] Natural killer (NK) cells are cytotoxic lymphocytes that constitute the main components of the innate immune system. Natural killer (NK) cells usually represent about 10%-15% of circulating lymphocytes, which bind and kill target cells (including virus-infected cells and many malignant cells) that are not specific to antigens and have no previous immune sensitization. Herberman et al., Science [Science] 214:24 (1981). The killing of target cells occurs by inducing cell lysis. NK cells used for autologous NK cell transplantation are partially separated from the peripheral blood lymphocytes ("PBL") of the subject's blood, amplified in cell culture to obtain a sufficient number of cells, and then re-infused into the subject. Such autologous NK cells show some effectiveness in in vivo treatment. However, this therapy is limited to autologous situations and is further complicated by the fact that not all NK cells have cytolytic properties.

[0006] NK- is a cytolytic cancer cell line that was found in the blood of subjects with non-Hodgkin's lymphoma and then immortalized in vitro. The cells are derived from NK cells but lack the major inhibitory receptors present on normal NK cells while retaining most of the activating receptors. The cells will not attack normal cells and will not cause unacceptable immune rejection in humans. Characterization of the cell lines is disclosed in WO 1998 / 049268 and U.S. Patent Application Publication No. 2002-0068044. NK- The cells have been evaluated as therapeutic agents for treating certain cancers. Summary of the invention

[0007] In some embodiments, the present disclosure provides an NK- In some embodiments, the NK- The cell comprises a polycistronic construct encoding the CD19CAR and the Fc receptor. In some embodiments, the Fc receptor is CD16. In some embodiments, the Fc receptor comprises SEQ ID NO:2. In some embodiments, the polycistronic transgene further comprises a sequence encoding IL-2 or a variant thereof. In some embodiments, the IL-2 variant is erIL-2. In some embodiments, the coding sequence of one or more of the CD19CAR, the Fc receptor or erIL-2 is codon optimized for expression in a human system.

[0008] In some embodiments, NK- In some embodiments, the CD19CAR comprises a scFv antibody fragment. In some embodiments, the scFv antibody fragment has an amino acid sequence of SEQ ID NO: 10. In some embodiments, the polycistronic construct comprises a sequence of SEQ ID NO: 9, wherein the sequence encodes the scFv antibody fragment. In some embodiments, the NK- The cell comprises a sequence encoding a self-cleaving peptide, wherein the sequence is located between the CD19 CAR and CD16, and wherein the sequence allows equimolar expression of the CD19 CAR and the FcR. In some embodiments, the NK- The cells contain an internal ribosome entry sequence (IRES) between the sequence encoding CD16 and the sequence encoding IL-2 or a variant thereof.

[0009] In some embodiments, when the effector to target ratio is 10, the NK- The direct cytotoxicity of the NK cells to CD19 expressing cells is 70%-100%. In some embodiments, when the effector to target ratio is 10, the NK- The ADCC activity of the cell is 30%-90%. In some embodiments, the CD19 CAR comprises a sequence having at least 90% identity to SEQ ID NO:10.

[0010] In some embodiments, the present disclosure provides a kit comprising a NK- Pharmaceutical compositions of cells.

[0011] In some embodiments, the present disclosure provides a method for producing NK- A method for treating NK cells, the method comprising providing a vector, and introducing the vector into NK- cells to produce the NK- Cells, wherein the vector encodes CD19 CAR and CD16. In some embodiments, the vector further comprises a sequence encoding IL-2. In some embodiments, the vector comprises a sequence encoding a self-cleaving peptide, wherein the sequence is located between CAR and CD16, and wherein the sequence allows equimolar expression of CAR and CD16. In some embodiments, the vector comprises an internal ribosome entry sequence (IRES) between the CD16 coding sequence and the IL-2 coding sequence.

[0012] In some embodiments, the present disclosure provides a method of treating cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of a composition comprising a plurality of NK- In some embodiments, about 1 x 10 8 About 1x10 11 Modified cells / m 2 Subject's body surface area.

[0013] In some embodiments, the cancer is leukemia or lymphoma.

[0014] In some embodiments, the cancer is one or more of: B cell malignancies, B cell malignancies after HSCT, CLL, B-ALL, acute lymphoblastic leukemia (ALL), B lineage lymphoid malignancies after UCBT, chronic lymphocytic leukemia (CLL), B-Non-Hodgkin's Lymphoma (B-NHL), ALL after HSCT; lymphoma, refractory follicular lymphoma or lymphoblastic leukemia. In some embodiments, the B cell malignancy is mantle cell lymphoma. In some embodiments, multiple NK- In some embodiments, the multiple NK- cell.

[0015] The foregoing general description and the following detailed description are exemplary and explanatory and are intended to provide further explanation of the present disclosure. Other objects, advantages and novel features will be apparent to those skilled in the art. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The objects, features and advantages of the present disclosure will be more readily understood upon referring to the following disclosure when considered in conjunction with the accompanying drawings.

[0017] Figure 1 Schematic diagram of the structural domains of first-generation, second-generation, and third-generation CARs.

[0018] Figure 2 The components of the tricistronic plasmid are shown, which contain the CAR coding sequence, the P2A sequence, the CD16 coding sequence and the erIL-2 coding sequence.

[0019] Figure 3A and 3B The results of flow cytometry analysis were shown, which showed that CD16 and CD19-CAR were expressed in CD19t-haNK cells. TM Expression on the cell surface. The peaks on the right side of each panel represent the population of cells expressing CD16 or CD19.

[0020] Figure 4A CD19t-haNK TM Cytotoxicity of cells against K562 cells. 16B1 and 18B1 are two CD19t-haNK obtained from two electroporation events performed on two different dates. TM group. Figure 4B Selected CD19t-haNK TM Cytotoxic effects of clones on K562 in cytotoxicity assay.

[0021] Figure 5A CD19t-haNK TM Cytotoxicity of cells against SUP-B15 cells. 16B1 and 18B1 are two CD19t-haNK obtained from two electroporation events performed on two different dates. TM group. Figure 5B Selected CD19t-haNK TM The cytotoxic effects of clones on SUP-B15 in cytotoxicity assay.

[0022] Fig. 6A showed that when combined with Herceptin (anti-Her2 antibody), CD19t-haNK TM ADCC activity of cells against SKBr3 cells. Anti-CD20 antibody Rituxan was used as a control. Figure 6B Figure 3 shows that when combined with the anti-CD20 antibody rituximab, selected CD19t-haNKTM ADCC activity of clones against SUP-B15 cells expressing CD19KO / CD20+.

[0023] Figure 7 Selected CD19t-haNK TM Doubling time of the clone.

[0024] Figure 8 The results show that CD19t-haNK cells were expressed in the culture medium. TM clones release IL-2.

[0025] Fig. 9 Survival curves of intravenous Raji tumor-bearing animals are shown. Statistical analysis was performed by log-rank (Mantel-Cox) test. ****, P < 0.0001.

[0026] Fig.10 Animal body weight changes in the intravenous Raji tumor model are shown. Data are mean ± SEM. SEM is calculated as the standard deviation divided by the square root of N.

[0027] Fig.11 Tumor growth curves of the subcutaneous Raji model are shown. Data are mean ± SEM. Statistical analysis was performed using two-way ANOVA followed by multiple comparisons by Tukey's test; ***, P < 0.001; ****, P < 0.0001.

[0028] Fig.12 CD19t-haNK TM Reduced metastatic disease burden in the liver of subcutaneous Raji tumor-bearing mice. (a) Whole liver images from animals in the indicated treatment groups on day 13. Yellow arrows indicate metastatic lesions. Livers were fixed in 10% formalin for at least 24 hours prior to photography, (b) Percentage involvement of tumor cells in the liver (assessed by H&E staining) was quantified on the indicated days. On day 13: *, P = 0.0257 by unpaired two-tailed t-test. Statistical analysis on days 11 and 15 could not be performed due to limited sample size. See Table 4 for raw data.

[0029] Fig.13 Shown are changes in animal body weight in the subcutaneous Raji tumor model. Data are mean ± SEM. DETAILED DESCRIPTION

[0030] Overview

[0031] The present disclosure provides NK- In some embodiments, these cells also express IL-2. In some embodiments, these NK- The cells comprise a tricistronic construct comprising nucleic acid sequences encoding CD19CAR, Fc and IL2.

[0032] the term

[0033] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art.

[0034] Throughout this specification and the claims that follow, reference will be made to a number of terms which shall be defined to have the following meanings:

[0035] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. As used herein, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. Thus, for example, reference to "a natural killer cell" includes a plurality of natural killer cells.

[0036] All numerical designations, such as pH, temperature, time, concentration, amount and molecular weight, including ranges, are approximate and these values ​​vary where appropriate in increments of 0.1 or 1.0, i.e., (+) or (-). It should be understood that, although not always explicitly stated, all numerical designations may be preceded by the term "about".

[0037] As used herein, "+" when used to indicate the presence of a particular cell marker means that the cell marker is detectably present relative to an isotype control in fluorescence activated cell sorting; or detectable above background in quantitative or semi-quantitative RT-PCR.

[0038] As used herein, "-" when used to indicate the presence of a specific cell marker means that the cell marker is not detectably present relative to an isotype control in fluorescence activated cell sorting; or is not detectable above background in quantitative or semi-quantitative RT-PCR.

[0039] As will be understood by those skilled in the art, for any and all purposes, particularly in providing a written description, all ranges disclosed herein also encompass any and all possible sub-ranges and combinations of sub-ranges thereof. Any listed range can be easily identified as fully describing and capable of decomposing the same range into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be easily decomposed into a lower third, a middle third, and an upper third, etc. As also understood by those skilled in the art, all languages, such as "at most", "at least", "greater than", "less than", etc., include the numbers and refer to ranges that can be subsequently decomposed into the above-mentioned sub-ranges. Finally, as understood by those skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 cells refers to a group having 1, 2, or 3 cells. Similarly, a group having 1-5 cells refers to a group having 1, 2, 3, 4, or 5 cells, etc.

[0040] As used herein, when referring to NK- When measuring certain quantifiable properties of cells, such as cytotoxicity, viability or cell doubling time, the term "substantially the same" is used interchangeably with the term "comparable" or "substantially similar" to mean that two measurements of these properties differ from each other by no more than 15%, no more than 10%, no more than 8% or no more than 5%.

[0041] It is also understood, although not always explicitly stated, that the reagents described herein are exemplary only and that equivalents thereof are known in the art.

[0042] For the purposes of the present invention and unless otherwise indicated, the term "NK- " is intended to refer to the original NK- Cell lines and NK-92 cell lines, NK- Cloning of cells and NK- Cells. NK- Cells and exemplary and non-limiting modifications thereof are described in U.S. Pat. Nos. 7,618,817; 8,034,332; 8,313,943; 9,181,322; 9,150,636; and published U.S. Application No. 10 / 008,955, all of which are incorporated herein by reference in their entirety, and include wild-type NK- NK- -CD16, NK- -CD16-γ、NK- -CD16-ζ、NK- -CD16(F176V),NK- MI and NK- CI.NK- Cells are known to those of ordinary skill in the art. Such cells can be purchased from Nankvist Corporation ( Inc) is easily available.

[0043] As used herein, the term "NK- "Cells" refers to natural killer cells derived from a highly efficient unique cell line described by Gong et al. (Leukemia, April; 8(4): 652-8 (1994)), the rights to which are owned by Nanqvist Corporation (hereinafter "NK- cell").

[0044] As used herein, the term "aNK cells" refers to unmodified natural killer cells derived from a highly potent unique cell line described by Gong et al. (Leukemia, April; 8(4): 652-8 (1994)), the rights to which are owned by Nanqvist Corporation (hereinafter "aNK cells").

[0045] As used herein, the term "haNK cells" refers to natural killer cells derived from a highly potent unique cell line described by Gong et al. (Leukemia, April; 8(4): 652-8 (1994)), the rights of which are owned by Nanqvist, Inc., modified to express CD16 on the cell surface (hereinafter "CD16+NK- cells” or “haNK cells”).

[0046] As used herein, the term " " refers to natural killer cells derived from a highly potent unique cell line described by Gong et al. (Leukemia, April; 8(4): 652-8 (1994)), the rights to which are owned by Nanqvist, Inc., modified to express a chimeric antigen receptor (hereinafter "CAR-modified NK- Cells" or "taNK ”).

[0047] As used herein, the term "t-haNK TM "cells" refer to natural killer cells derived from a highly efficient unique cell line described by Gong et al. (Leukemia, April; 8(4): 652-8 (1994)), which are owned by Nanqvist, Inc., modified to express CD16 on the cell surface and to express a chimeric antigen receptor (hereinafter "CAR-modified CD16+NK- Cells" or "t-haNK TM In some embodiments, the tumor-specific antigen is CD19, and these NK- The cells are called CD19t-haNK TM cell.

[0048] As used herein, the term "polycistronic construct" refers to a recombinant DNA construct that will be transcribed into a single mRNA molecule, and the single mRNA molecule encodes two or more transgenes. If the polycistronic construct encodes two transgenes, it is called a bicistronic construct, and if it encodes three genes, it is called a tricistronic construct, and if it encodes four genes, it is called a tetracistronic construct, and so on.

[0049] As used herein, the term "chimeric antigen receptor" (CAR) refers to an extracellular antigen binding domain fused to an intracellular signaling domain. CARs can be expressed in T cells or NK cells to increase cytotoxicity. Typically, the extracellular antigen binding domain is a scFv that is specific for an antigen found on the target cell. Based on the specificity of the scFv domain, NK- Cell targeting cells that express certain antigens on their cell surface. The scFv domain can be engineered to recognize any antigen, including tumor-specific antigens and virus-specific antigens. For example, the CD19CAR recognizes CD19, a cell surface marker expressed by some cancers.

[0050] As used herein, the term "tumor-specific antigen" refers to an antigen present on cancer cells or neoplastic cells but not detectable on normal cells derived from the same tissue or lineage as the cancer cells. As used herein, tumor-specific antigens also refer to tumor-associated antigens, i.e., antigens expressed at higher levels on cancer cells than on normal cells derived from the same tissue or lineage as the cancer cells.

[0051] As used herein, the term "target" when referring to tumor targeting refers to NK- The ability of NK cells to recognize and kill tumor cells (i.e., target cells). The term "targeting" herein refers to, for example, The ability of a cell-expressed CAR to recognize and bind to a cell surface antigen expressed by the tumor.

[0052] The term "antibody" refers to a complete immunoglobulin of any isotype or a fragment thereof that can specifically bind to a target antigen in competition with a complete antibody, and includes chimeric, humanized, fully human and bispecific antibodies. A complete antibody typically comprises at least two full-length heavy chains and two full-length light chains, but may include fewer chains in some cases, such as antibodies naturally present in camelids, which may only comprise heavy chains. An antibody may be derived from only a single source, or may be "chimeric" so that different parts of the antibody are derived from two different antibodies. Antigen-binding proteins, antibodies or binding fragments may be produced in hybridomas by recombinant DNA technology or by enzymatic or chemical cleavage of a complete antibody. Unless otherwise indicated, the term "antibody" includes, in addition to antibodies comprising two full-length heavy chains and two full-length light chains, derivatives, variants, fragments and mutant proteins thereof. In addition, unless explicitly excluded, antibodies include: monoclonal antibodies, bispecific antibodies, miniantibodies, domain antibodies, synthetic antibodies (sometimes referred to herein as "antibody mimetics"), chimeric antibodies, humanized antibodies, human antibodies, antibody fusions (sometimes referred to herein as "antibody conjugates"), and fragments thereof, respectively. In some embodiments, the term also includes peptibodies.

[0053] The term "subject" refers to non-human animals (including mammals such as cats, dogs, cows, horses, pigs, sheep and goats) and humans. The term subject also refers to a patient in need of treatment for a disease described herein.

[0054] "Optional" or "optionally" means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where the event or circumstance occurs and instances where it does not occur.

[0055] The term "comprising" is intended to indicate that compositions and methods include the listed elements, but do not exclude other elements. When used to define compositions and methods, "consisting essentially of shall mean excluding other elements of any significance to the combination. For example, a composition consisting essentially of the ingredients defined herein will not exclude other ingredients that do not materially affect one or more of the basic and novel characteristics of the claims. "Consisting of" means excluding more than trace amounts of other ingredients and substantial method steps. Embodiments defined by each of these transition terms are within the scope of the present disclosure.

[0056] As used herein, the terms "cytotoxicity" and "cytolyticity" are intended to be synonymous when used to describe the activity of effector cells such as NK cells. Typically, cytotoxic activity involves killing target cells by any of a variety of biological, biochemical or biophysical mechanisms. Cytolysis more specifically refers to the activity of effectors that cleave the plasma membrane of target cells, thereby destroying their physical integrity. This results in the killing of target cells. Without wishing to be bound by theory, it is believed that the cytotoxic effect of NK cells is due to cytolysis.

[0057] The term "killing" with respect to a cell / cell population is intended to include any type of manipulation that will result in the death of that cell / cell population.

[0058] The term "cytokine" or "cytokines" refers to a general class of biological molecules that affect cells of the immune system. Exemplary cytokines include, but are not limited to, FLT3 ligand, interferons, and interleukins (IL), particularly IL-2, IL-12, IL-15, IL-18, and IL-21.

[0059] The terms "patient," "subject," "individual," and the like are used interchangeably herein and refer to any animal or cell thereof that can be used in the methods described herein, whether in vitro or in situ. In certain non-limiting embodiments, the patient, subject, or individual is a human.

[0060] The term "treatment" encompasses treatment of a disease or disorder described herein in a subject, such as a human, and includes: (i) inhibiting the disease or disorder, i.e., preventing its development; (ii) alleviating the disease or disorder, i.e., causing regression of the disorder; (iii) slowing the progression of the disorder; and / or (iv) inhibiting, alleviating, or slowing the progression of one or more symptoms of the disease or disorder. The term "administering" a monoclonal antibody or natural killer cell to a subject includes any route of introducing or delivering the antibody or cell to perform the intended function. Administration can be by any route suitable for delivering the cell or monoclonal antibody. Thus, routes of delivery can include intravenous, intramuscular, intraperitoneal, or subcutaneous delivery. In some embodiments, the modified NK- In some embodiments, the modified NK-1 cells described herein are administered parenterally, for example by injection, infusion, or implantation (subcutaneously, intravenously, intramuscularly, intracystically, intratumorally, or intraperitoneally). cell.

[0061] The term "expression" refers to the production of a gene product.

[0062] As used herein, the term "cytotoxicity" when used to describe the activity of effector cells such as NK cells, involves the killing of target cells by any of a variety of biological, biochemical, or biophysical mechanisms.

[0063] The terms "reduce" and "reduced" are all used herein to refer to a decrease of at least 10% compared to a reference level, such as a decrease of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a decrease of 100% (i.e., zero level compared to a reference sample), or any decrease between 10%-100% compared to a reference level.

[0064] The term "cancer" refers to all types of cancers, neoplasms or malignancies found in mammals, including leukemias, carcinomas and sarcomas. Exemplary cancers include brain cancer, breast cancer, cervical cancer, colon cancer, head and neck cancer, liver cancer, kidney cancer, lung cancer, non-small cell lung cancer, melanoma, mesothelioma, ovarian cancer, sarcoma, gastric cancer, uterine cancer and medulloblastoma. Other examples include Hodgkin's Disease, Non-Hodgkin's Lymphoma, Multiple Myeloma, Neuroblastoma, Ovarian Cancer, Rhabdomyosarcoma, Essential Thrombocythemia, Essential Macroglobulinemia, Primary Brain Tumors, Carcinoma, Malignant Pancreatic Insulinoma, Malignant Carcinoid, Bladder Cancer, Premalignant Skin Lesions, Testicular Cancer, Lymphoma, Thyroid Cancer, Neuroblastoma, Esophageal Cancer, Genitourinary Tract Cancer, Malignant Hypercalcemia, Endometrial Cancer, Adrenocortical Carcinoma, Endocrine and Exocrine Pancreatic Neoplasms, and Prostate Cancer.

[0065] The term "therapeutically effective amount" or "effective amount" refers to the amount required to improve the symptoms of a disease relative to an untreated patient. The effective amount of one or more active compounds used to practice the present disclosure to therapeutically treat a disease varies with the mode of administration, the age, weight, and general health of the subject. Ultimately, the attending physician or veterinarian will determine the appropriate amount and dosing regimen. Such an amount is referred to as an "effective" amount.

[0066] For the convenience of the reader, a title or subtitle may be used in the specification, which is not intended to affect the scope of the present disclosure. In addition, some terms used in this specification are defined in more detail below.

[0067] NK- cell

[0068] NK- is a cytolytic cancer cell line that was found in the blood of subjects with non-Hodgkin's lymphoma and then immortalized in vitro. The cells are derived from NK cells but lack the major inhibitory receptors present on normal NK cells while retaining most of the activating receptors. The cells will not attack normal cells and will not cause unacceptable immune rejection in humans. Characterization of the cell lines is disclosed in WO 1998 / 049268 and U.S. Patent Application Publication No. 2002-0068044. NK- The cells have been evaluated as therapeutic agents for treating certain cancers.

[0069] Carrier

[0070] Described herein are vectors for transfecting cells to produce modified cells described herein. In one embodiment, the vectors described herein are transient expression vectors. The exogenous transgene introduced using such vectors is not integrated into the nuclear genome of the cell; therefore, in the absence of vector replication, the exogenous transgene will degrade or dilute over time.

[0071] In one embodiment, the vector described herein allows stable transfection of cells. In one embodiment, the vector allows one or more transgenics to be incorporated into the genome of the cell. In one embodiment, the vector has a positive selection marker. The positive selection marker includes any gene that allows cells to grow under conditions of killing cells that do not express the gene. Non-limiting examples include antibiotic resistance, such as geneticin (Neo gene from Tn5).

[0072] In one embodiment, the vector is a plasmid vector. In one embodiment, the vector is a viral vector. As will be appreciated by those skilled in the art, any suitable vector may be used. Suitable vectors are well known in the art.

[0073] In some embodiments, cells are transfected with mRNA encoding a protein of interest (e.g., CAR). Transfection of mRNA results in transient expression of the protein. In one embodiment, mRNA is transfected into NK- In one embodiment, "before" the administration of the cells refers to between about 15 minutes and about 48 hours before administration. Preferably, the mRNA transfection is performed about 5 hours to about 24 hours before administration.

[0074] CD19

[0075] CD19 is a transmembrane glycoprotein belonging to the immunoglobulin superfamily. It has a single transmembrane domain, a cytoplasmic C-terminus and an extracellular N-terminus. CD19 is a biomarker for normal and neoplastic B cells and follicular dendritic cells, and is critically involved in establishing the intrinsic B cell signaling threshold by regulating B cell receptor-dependent and -independent signaling.

[0076] CD19 is expressed in most acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), and B-cell lymphomas. Most B-cell malignancies express CD19 at normal to high levels (80% for ALL, 88% for B-cell lymphomas, and 100% for B-cell leukemias). Although CD19 is a B-cell marker, it has also been observed in cases of myeloid malignancies, including 2% of AML cases. Wang et al., Exp. Hematol. Oncol., 2012 Nov 29; 1:36. Table 1 shows non-limiting examples of malignancies associated with CD19.

[0077] Table 1: CD19 and related malignancies

[0078]

[0079] CAR

[0080] Phenotypic changes that distinguish tumor cells from normal cells derived from the same tissue are usually associated with one or more changes in the expression of specific gene products, including the loss of normal cell surface components or the acquisition of other cell surface components (antigens that cannot be detected in the corresponding normal non-cancerous tissue). Antigens expressed in neoplastic cells or tumor cells but not in normal cells or antigens expressed at levels much higher than those found in normal cells are called "tumor-specific antigens" or "tumor-associated antigens". Tumor-specific antigens have been used as targets for cancer immunotherapy. One such therapy utilizes chimeric antigen receptors (CARs) expressed on the surface of immune cells including T cells and NK cells to improve cytotoxicity against cancer cells. CAR comprises a single-chain variable fragment (scFv) connected to at least one intracellular signaling domain. ScFv recognizes and binds to antigens on target cells (e.g., cancer cells) and triggers effector cell activation. The signaling domain contains an immunoreceptor tyrosine-based activation domain (ITAM), which is very important for intracellular signaling through receptors.

[0081] The present disclosure provides NK- Cells. CAR combines an extracellular antigen recognition portion (usually derived from the variable domain of a specific antibody) with an intracellular signaling domain (single or with other co-stimulatory elements), which can trigger a cytolytic response after recognizing a specific antigen. There are many types of CARs, all of which can be used in this application. The first generation of CARs contains a cytoplasmic signaling domain. The signaling domain can be derived from, for example, an Fcε receptor γ (FcεRIγ) containing one ITAM, or from CD3ζ containing three ITAMs. It is believed that CD3ζCAR is more effective than FcεRIγCAR in eradicating tumors. See, for example, Haynes et al., 2001, J.Immunology [Journal of Immunology] 166: 182-187; Cartellieri et al., 2010, J.Biomed andBiotech [Journal of Biomedicine and Biotechnology], Vol. 2010, Article ID 956304. Second and third generation CARs combine multiple signaling domains, such as the cytoplasmic signaling domain of CD3ζ, and co-stimulatory signaling domains, such as CD28 / CD134 / CD137 / ICOS and CD28 / CD134, with a single CAR to promote NK- Therefore, in some embodiments, CD19t-haNK TM The CD19CAR expressed by the cell comprises a hinge region from CD8 and / or a transmembrane domain of CD28. In some embodiments, the CD19CAR comprises a cytoplasmic signaling domain of FcεRIγ. In some embodiments, the CD19CAR comprises a cytoplasmic signaling domain of CD3ζ. Examples of hinge regions, transmembrane domains of CD28, and cytoplasmic signaling domains of FcεRIγ or CD3ζ are disclosed in U.S. Provisional Application No. 62 / 674,936, the entire contents of which are incorporated herein by reference.

[0082] Although previous publications, such as Haynes et al., 2001, J. Immunology 166:182-187 and Cartellieri et al., 2010, J. Biomed and Biotech, Vol. 2010, Article ID 956304, have disclosed that CD3ζCAR may be more effective than FcεRIγCAR in eradicating tumors, in this case, the inventors surprisingly and unexpectedly found that this was not the case with the cells, compositions and methods disclosed herein. In fact, the inventors found that when the NK- When the cells have the FcεRIγ CAR domain, they are just as effective as having the CD3ζ CAR, or in some embodiments, even more effective.

[0083] Optionally, the CAR is specific for CD19. In some embodiments, CD19 is human CD19. In some embodiments, the CD19CAR comprises a scFv fragment comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the CD19CAR comprises the amino acid sequence of SEQ ID NO: 12. In some embodiments, the CD19t-haNK TM The cell comprises a nucleic acid sequence of SEQ ID NO: 9, which encodes SEQ ID NO: 10. In some embodiments, CD19t-haNK TM The cell comprises a nucleic acid sequence of SEQ ID NO: 11, which encodes SEQ ID NO: 12. In some embodiments, CD19t-haNK TM The cells comprise the tricistronic construct of SEQ ID NO:13.

[0084] In some embodiments, the CD19CAR polypeptide comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 10. In some embodiments, an epitope tag peptide, such as FLAG, myc, poly-histidine or V5, can be added to the amino terminal domain of the polypeptide to assist cell surface detection by using anti-epitope tag peptide monoclonal or polyclonal antibodies.

[0085] In an example, variant polypeptides are prepared using methods known in the art, such as oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning and PCR mutagenesis. Site-directed mutagenesis (Carter, 1986; Zoller and Smith, 1987), cassette mutagenesis, restricted selection mutagenesis (Wells et al., 1985) or other known techniques can be performed on cloned DNA to produce CD16 variants (Ausubel, 2002; Sambrook and Russell, 2001).

[0086] In some embodiments, the polynucleotide encoding CD19CAR is mutated to change the amino acid sequence encoding CAR without changing the function of CAR. For example, polynucleotide substitutions causing amino acid substitutions at "non-essential" amino acid residues can be performed in SEQ ID NO:9 or 11.

[0087] Conservative substitutions in SEQ ID NO: 10 or 12 (in which an amino acid of one class is replaced by another amino acid of the same class) are within the scope of the disclosed variants as long as the substitution does not substantially change the activity of the polypeptide. Conservative substitutions are well known to those skilled in the art. Non-conservative substitutions (which affect (1) the structure of the polypeptide backbone, such as β-sheet or α-helical conformation, (2) charge, (3) hydrophobicity, or (4) the volume of the target site side chain) can modify the function or immunological properties of the polypeptide. Non-conservative substitutions require exchanging a member of one class for another class. Substitutions can be introduced into conservative substitution sites or, more preferably, into non-conservative sites.

[0088] In an example, variant polypeptides are prepared using methods known in the art, such as oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning and PCR mutagenesis. Site-directed mutagenesis (Carter, 1986; Zoller and Smith, 1987), cassette mutagenesis, restriction-selection mutagenesis (Wells et al., 1985) or other known techniques can be performed on cloned DNA to generate variants (Ausubel, 2002; Sambrook and Russell, 2001).

[0089] Optionally, CD19t-haNK TMThe cells can be used to treat cancer, in particular cancer expressing CD 19. Optionally, the cancer is selected from the group consisting of leukemia (including acute leukemia (e.g., acute lymphocytic leukemia, acute myeloid leukemia (including myeloblastic, promyelocytic, myelomonocytic, monocytic and erythroid leukemia)) and chronic leukemia (e.g., chronic myeloid (granulocytic) leukemia and chronic lymphocytic leukemia)), polycythemia vera, lymphoma (e.g., Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia (Waldenstrom's macroglobulinemia), heavy chain disease, solid tumors, including but not limited to sarcomas and carcinomas such as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endothelial cell sarcoma, lymphangiosarcoma, lymphangioendothelial cell sarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatocarcinoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor (Wilm's tumor, cervical cancer, testicular tumor, lung cancer, small cell lung cancer, bladder cancer, epithelial cancer, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, melanoma, neuroblastoma, and retinoblastoma.

[0090] FC receptor

[0091] In some embodiments, the modified NK- The cell expresses at least one Fc receptor, such that the at least one Fc receptor is presented on the NK- On the cell surface of cells. Fc receptors bind to the Fc portion of antibodies. Several Fc receptors are known and differ in their preferred ligands, affinity, expression, and effects after binding to antibodies.

[0092] Table 2. Illustrative Fc receptors

[0093]

[0094]

[0095] In some embodiments, the modified NK- Cells can express Fc receptor proteins on the cell surface.

[0096] In some embodiments, the Fc receptor is CD16. For purposes of this disclosure, specific amino acid residues of CD16 are designated with reference to SEQ ID NO:2 or SEQ ID NO:1 (which differs at one position relative to SEQ ID NO:1). Thus, the amino acid residue at "position 158" of a CD16 polypeptide is the amino acid residue corresponding to position 158 of SEQ ID NO:2 (or SEQ ID NO:1) when the CD16 polypeptide is maximally aligned with SEQ ID NO:2. In some embodiments, modified NK- Cells are expressed human CD16, which has a phenylalanine at position 158 in the mature form of the protein, such as SEQ ID NO: 1. In typical embodiments, NK- The cell expresses a high affinity form of human CD16 that has a valine at position 158 of the mature form of the protein, such as SEQ ID NO:2. Position 158 of the mature protein corresponds to position 176 of the CD16 sequence including the natural signal peptide. In some embodiments, the CD16 polypeptide is encoded by a polynucleotide encoding a polypeptide sequence of SEQ ID NO:3 or SEQ ID NO:4 precursor (i.e., having a natural signal peptide). Thus, in one embodiment, the Fc receptor comprises FcγRIII-A (CD16). In some embodiments, NK- The cells are genetically modified to express an Fc receptor encoding a polypeptide having at least 90% sequence identity to SEQ ID NO: 1 (FcγRIII-A or CD16 with phenylalanine at position 158 (F-158)); or having at least 90% identity to SEQ ID NO: 2 (CD16 with valine at position 158 (F158V), a higher affinity form).

[0097] In some embodiments, the polynucleotide encoding the CD16 polypeptide has at least about 70% polynucleotide sequence identity with a polynucleotide sequence encoding a full-length (including signal peptide) naturally occurring CD16 (which has a phenylalanine at position 176 of the full-length CD16 (corresponding to position 158 of the mature CD16 protein). In some embodiments, the polynucleotide encoding the CD16 polypeptide has at least about 70% polynucleotide sequence identity with a polynucleotide sequence encoding a full-length (including signal peptide) naturally occurring CD16 (which has a valine at position 176 (corresponding to position 158 of the mature protein). In some embodiments, the polynucleotide encoding CD16 has at least 70%, 80%, 90% or 95% identity with SEQ ID NO: 13, and comprises a codon encoding a valine at a polynucleotide position encoding a full-length (including signal peptide) CD16 polypeptide. In some embodiments, the polynucleotide encoding CD16 comprises SEQ ID NO: 13, but has a codon encoding a valine at position 176 of the full-length CD16.

[0098] In some embodiments, the CD16 polynucleotide encodes a polypeptide having at least 70%, 80%, 90% or 95% identity to SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the polynucleotide encodes a polypeptide having at least 70%, 80%, 90% or 95% identity to SEQ ID NO: 2, and comprises a valine at position 158 as determined with reference to SEQ ID NO: 2. In some embodiments, the polynucleotide encodes SEQ ID NO: 2. In some embodiments, the CD16 polynucleotide encodes an extracellular domain of CD16 with or without a signal sequence, or any other fragment of full-length CD16, or a chimeric receptor comprising at least a portion of the CD16 sequence fused to the amino acid sequence of another protein. In other embodiments, an epitope tag peptide, such as FLAG, myc, polyhistidine or V5, can be added to the amino terminal domain of the mature polypeptide to assist cell surface detection by using anti-epitope tag peptide monoclonal or polyclonal antibodies.

[0099] In some embodiments, the homologous CD16 polynucleotides may be about 150 to about 700, about 750, or about 800 polynucleotides in length, although CD16 variants having more than 700 to 800 polynucleotides are within the scope of the disclosure.

[0100] Homologous polynucleotide sequences include those sequences encoding polypeptide sequences encoding CD16 variants. Homologous polynucleotide sequences also include naturally occurring allelic variations associated with SEQ ID NO: 1. NK-1 cells are transfected with any polynucleotide encoding a polypeptide having an amino acid sequence as set forth in SEQ ID. NO: 1 or SEQ ID NO: 2, a naturally occurring variant thereof, or a sequence at least 70% identical or at least 80%, 90% or 95% identical to SEQ ID. NO: 1 or SEQ ID NO: 2. Cells are within the scope of the present disclosure. In some embodiments, the homologous polynucleotide sequence encodes a conservative amino acid substitution in SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, a degenerate homologous CD16 polynucleotide sequence that is different from the native polynucleotide sequence but encodes the same polypeptide is used to transfect NK- cell.

[0101] In other examples, a cDNA sequence with a polymorphism that alters the amino acid sequence of CD16 is used to modify NK- Cells, such as allele variation between individuals showing genetic polymorphism in the CD16 gene. In other examples, CD16 genes from other species having polynucleotide sequences different from the sequence of SEQ ID NO: 1 are used to modify NK- cell.

[0102] Variant polypeptides can be prepared using methods known in the art, such as oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning and PCR mutagenesis. Site-directed mutagenesis (Carter, 1986; Zoller and Smith, 1987), cassette mutagenesis, restricted selection mutagenesis (Wells et al., 1985) or other known techniques can be performed on cloned DNA to produce CD16 variants (Ausubel, 2002; Sambrook and Russell, 2001).

[0103] In some embodiments, the polynucleotide encoding CD16 is mutated to change the amino acid sequence encoding CD16 without changing the function of CD16. For example, polynucleotide substitutions that result in amino acid substitutions at "non-essential" amino acid residues can be made in SEQ ID NO: 1 or SEQ ID NO: 2.

[0104] Conservative substitutions in SEQ ID.NO:1 or SEQ ID NO:2 (in which an amino acid of one class is replaced by another amino acid of the same class) are within the scope of the disclosed CD16 variants as long as the substitution does not substantially change the activity of the polypeptide. Conservative substitutions are well known to those skilled in the art. Non-conservative substitutions (which affect (1) the structure of the polypeptide backbone, such as β-sheet or α-helical conformation, (2) charge, (3) hydrophobicity, or (4) the volume of the target site side chain) can modify the function or immunological properties of the CD16 polypeptide. Non-conservative substitutions require exchanging a member of one class for another class. Substitutions can be introduced into conservative substitution sites or, more preferably, into non-conservative sites.

[0105] In some embodiments, the CD16 polypeptide variant is at least 200 amino acids in length and has at least 70% amino acid sequence identity, or at least 80% or at least 90% identity to SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the CD16 polypeptide variant is at least 225 amino acids in length and has at least 70% amino acid sequence identity, or at least 80% or at least 90% identity to SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the CD16 polypeptide variant has a valine at position 158 as determined with reference to SEQ ID NO: 2.

[0106] In some embodiments, the nucleic acid encoding the CD16 polypeptide can encode a CD16 fusion protein. The CD16 fusion polypeptide includes any CD16 part or the whole CD16 fused with a non-CD16 polypeptide. Fusion polypeptides are conveniently produced using recombinant methods. For example, a polynucleotide encoding a CD16 polypeptide such as SEQ ID NO: 1 or SEQ ID NO: 2 is fused in frame with a non-CD16 encoding polynucleotide (such as a polynucleotide sequence encoding a signal peptide of a heterologous protein). In some embodiments, a fusion polypeptide can be produced in which a heterologous polypeptide sequence is fused to the C-terminus of CD16 or is located inside CD16. Typically, up to about 30% of the CD16 cytoplasmic domain can be replaced. Such modifications can enhance expression or enhance cytotoxicity (e.g., ADCC responsiveness). In other examples, chimeric proteins (such as domains from other lymphocyte activation receptors, including but not limited to Ig-a, Ig-B, CD3-e, CD3-d, DAP-12 and DAP-10) replace a portion of the CD16 cytoplasmic domain.

[0107] The fusion gene can be synthesized by conventional techniques, including an automatic DNA synthesizer and PCR amplification using anchor primers that generate complementary overhangs between two consecutive gene fragments that can then be annealed and reamplified to generate a chimeric gene sequence (Ausubel, 2002). Many vectors are commercially available that facilitate in-frame subcloning of CD16 into the fusion moiety.

[0108] Cytokines

[0109] NK- The cytotoxicity of the cells depends on the presence of cytokines such as interleukin 2 (IL-2). The cost of exogenously added IL-2 required by the cells is very high. Administration of sufficient amounts of IL-2 to human subjects to continuously activate NK92 cells can cause adverse side effects.

[0110] In one embodiment, the modified NK- The cell is to express at least one cytokine. In particular, the at least one cytokine is IL-2 (SEQ ID NO: 6), IL-12, IL-15, IL-18, IL-21 or a variant thereof. In some embodiments, the cytokine is IL-2, IL-15 or a variant thereof. In certain embodiments, IL-2 is a variant targeting the endoplasmic reticulum, and IL-15 is a variant targeting the endoplasmic reticulum.

[0111] In one embodiment, IL-2 is cloned and expressed with a signal sequence (SEQ ID NO: 7) that directs IL-2 to the endoplasmic reticulum (erIL-2). This allows IL-2 to be expressed at levels sufficient for autocrine activation, but does not release IL-2 extracellularly. See Konstantinidis et al., "Targeting IL-2 to the endoplasmic reticulum confines autocrine growth stimulation to NK- Targeting IL-2 to the endoplasmic reticulum restricts autocrine growth stimulation to NK- [Exp Hematol. 2005 Feb;33(2):159-64. NK-1 cells expressing FcRs can be prevented, for example, by the presence of suicide genes. Continuous activation of cells.

[0112] Suicide gene

[0113] The term "suicide gene" refers to a transgene that allows negative selection of cells expressing the suicide gene. Suicide genes are used as a safety system to allow cells expressing the gene to be killed by introducing a selection agent. This is ideal when the recombinant gene causes a mutation that leads to uncontrolled cell growth or the cell itself is capable of such growth. Many suicide gene systems have been identified, including the herpes simplex virus thymidine kinase (TK) gene, the cytosine deaminase gene, the varicella zoster virus thymidine kinase gene, the nitroreductase gene, the Escherichia coli gpt gene, and the Escherichia coli Deo gene. Typically, the protein encoded by the suicide gene has no adverse effects on the cell, but will kill the cell in the presence of a specific compound. Therefore, the suicide gene is typically part of the system.

[0114] In one embodiment, the suicide gene is in NK- In one embodiment, the suicide gene is a thymidine kinase (TK) gene. The TK gene can be a wild-type or mutant TK gene (e.g., tk30, tk75, sr39tk). Ganciclovir can be used to kill cells expressing the TK protein.

[0115] In another embodiment, the suicide gene is cytosine deaminase, which is toxic to cells in the presence of 5-fluorocytosine. Garcia-Sanchez et al., "Cytosine deaminase adenoviral vector and 5-fluorocytosine selectively reduce breast cancer cells 1 million-fold when they contaminate hematopoietic cells: a potential purging method for autologous transplantation." Blood. 1998 Jul 15;92(2):672-82.

[0116] In another embodiment, the suicide gene is a cytochrome P450 that is toxic in the presence of ifosfamide or cyclophosphamide. See, e.g., Touati et al. "A suicide gene therapy combining the improvement of cyclophosphamide tumor cytotoxicity and the development of an anti-tumor immune response." Curr Gene Ther. 2014; 14(3): 236-46.

[0117] In another embodiment, the suicide gene is iCasp9. Di Stasi, (2011) "Inducible apoptosis as a safety switch for adoptive cell therapy." N Engl J Med [New England Journal of Medicine] 365: 1673-1683. See also Morgan, "Live and Let Die: A New Suicide Gene Therapy Moves to the Clinic [Survival and death: A new suicide gene therapy moves to the clinic]" Molecular Therapy [Molecular Therapy] (2012); 20: 11-13. iCasp9 induces apoptosis in the presence of the small molecule AP1903. AP1903 is a biologically inert small molecule that has been shown to be well tolerated in clinical studies and has been used in the context of adoptive cell therapy.

[0118] Codon optimization

[0119] In some embodiments, the sequence codons of the construct used to transform aNK cells are optimized to maximize the expression efficiency of CD19CAR, CD16 and / or erIL-2 in the human system. Codon optimization is typically performed by replacing at least one, more than one or a large number of codons in the native sequence with more commonly used or most commonly used codons in the expression system gene for nucleic acid sequence modification. Codon optimization can be used for evaluation of translation, or to produce recombinant RNA transcripts with desired properties such as a longer half-life compared to transcripts produced using non-optimized sequences. Codon optimization methods are readily available, for example, GeneArt TM, from Thermo Fisher Scientific (Waltham, MA); Optimizer, available free from http: / / genomes.urv.es / OPTIMIZER, and GeneGPS expression optimization technology from DNA 2.0 (Newark, California). In a specific embodiment, the coding sequence of CD19CAR is codon optimized and comprises the sequence shown in SEQ ID NO:9.

[0120] Transgene expression

[0121] The transgenes can be engineered into the expression vector by any mechanism known to those skilled in the art. Where multiple transgenes are inserted into the cell, the transgenes can be engineered into the same expression vector or into different expression vectors.

[0122] In some embodiments, cells are transfected with mRNA encoding the transgenic protein to be expressed.

[0123] The transgene and mRNA can be introduced into the NK-1 cells using any transfection method known in the art, including but not limited to infection, electroporation, lipofection, nucleofection, or "gene gun". cell.

[0124] NK cells expressing CD19CAR cell

[0125] The present disclosure provides a modified NK- Optionally, the modified NK- The cells further expressed IL-2.

[0126] In some embodiments, the modified NK- The cells comprise a polycistronic transgene encoding a chimeric antigen receptor and an Fc receptor, and optionally IL-2.

[0127] In some embodiments, the FcR is CD 16. In some embodiments, the CD 16 is high affinity CD 16 comprising or consisting of SEQ ID NO: 2. In some embodiments, the IL-2 is erIL-2 comprising or consisting of SEQ ID NO: 7.

[0128] In certain embodiments, the CD19CAR coding sequence is separated from the CD16 coding sequence by a sequence encoding a self-cleaving peptide, to produce an equimolar expression level of CD19CAR and CD16 encoded by the same mRNA.Self-cleaving peptides and their coding sequences are well known, for example, as disclosed in Wang et al., Scientific Reports 5 [Science Report 5], article number 16273 (2015), and its related disclosures are incorporated herein by reference.Non-limiting examples of self-cleaving peptides include porcine tetanus virus-12A (P2A), thosea asigna virus 2A (T2A), equine rhinitis A virus 2A (E2A), cytoplasmic polyhedrosis virus (BmCPV 2A) and silkworm (B.mori) softening virus (BmIFV 2A). In some embodiments, the self-cleaving peptide is the P2A peptide encoded by SEQ ID NO: 8: ggaagcggagctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacct.

[0129] In some embodiments, the CD16 coding sequence and the erIL-2 coding sequence are separated by an internal ribosome entry sequence (IRES) that allows initiation of translation from an internal region of an mRNA transcribed from the nucleic acid sequence.

[0130] In some embodiments, NK- The cells contain a tricistronic construct that expresses CAR, high affinity CD16, and erIL-2 from a single mRNA. The integration of CAR enables effector cells to specifically engage and kill target cells expressing the target recognized by the CAR; the integration of CD16 enables ADCC when combined with a therapeutic monoclonal antibody; and erIL2 allows cells to expand and maintain the selective pressure of transgene expression in the absence of exogenous IL-2. An illustrative tricistronic construct is shown in Figure 2 as shown in .

[0131] To generate a modified NK cell expressing CAR and CD16 (e.g., high affinity CD16) and erIL-2 cells, and introducing the polycistronic plasmid into aNK cells by, for example, electroporation. Cells were grown in medium without IL-2 and could be isolated from transformed NK- Single clones are selected in cells and characterized according to standards including, for example, high levels of CAR and CD16 expression, cytotoxicity, ADCC, growth rate and / or IL-2 secretion. Suitable clones can also express surface markers, such as CD3, CD16, CD54, CD56, NKG2D and / or NKp30, at levels substantially similar to those of aNK cells. Optionally, whole genome sequencing (WGS) is performed to determine transgenic integration sites. One or more clones meeting these criteria can be selected for further development and used to treat clinical patients.

[0132] Express

[0133] IL-2 expression can be enhanced by modifying NK- The ability of cells to express IL-2 in the absence of IL-2 can be demonstrated. The expression of CAR and CD16 can be measured by flow cytometry. For NK cells that have been transformed with a tricistronic construct comprising the coding sequence of CD19CAR, CD16 and IL-2 (e.g., erIL-2), the expression of CAR and CD16 can be measured by flow cytometry. Cells, typically at least 70%, at least 80%, at least 85% of the transformed cells that are able to grow in the absence of IL-2 also show high expression levels of both CAR and CD16.

[0134] Optionally, the transformed NK- IL-2 secretion levels of cells.

[0135] In some embodiments, the level of IL-2 in the culture supernatant is measured to determine the level of IL-2 released into the cell culture medium. In some embodiments, the level of IL-2 in the cell pellet is measured to assess the total intracellular level of IL-2. In some embodiments, both the amount of IL-2 in the supernatant and the amount of IL-2 in the cell pellet are measured to determine the amount of IL-2 released into the cell culture medium by the transformed NK- The total amount of IL-2 produced by cells.

[0136] Optionally, transformed NK- Other surface markers of cells. These markers include, but are not limited to, CD54, CD56, NKG2D, NKp30, and CD3. Suitable clones are clones that have demonstrated expression levels of these markers substantially similar to aNK cells under the same growth conditions.

[0137] Cytotoxicity

[0138] Optionally, NK cells transformed with the tricistronic plasmid can be assessed using a flow-based cytotoxicity assay. Cell cytotoxicity. Cells) are mixed with target cells labeled with fluorophores, such as tumor cells, at different effector to target ratios. Propidium iodide (PI) can be added to the cells, and the sample can be analyzed by flow cytometry. Preferably, the fluorophore used to label the target cells can be distinguished from PI in the flow cytometer. In some embodiments, the fluorophore is CFSE. In some embodiments, the fluorophore is PKHGL67. Cytotoxicity can be determined by the percentage of PI positive cells in the fluorophore positive target population.

[0139] Optionally, NK cells transformed with the tricistronic plasmid can also be tested using methods well known in the art. Cytotoxicity of NK cells. The cytotoxicity of cells can be reflected by their direct cytotoxicity or ADCC activity. The direct cytotoxicity of the cells, the ability to target and kill abnormal cells such as tumor cells, can be assessed by methods well known in the art, for example, using the procedure described by Klingemann et al. (Cancer Immunol. Immunother. 33:395-397 (1991)). 51 Cr release assay (Gong et al. (Leukemia [leukemia], April; 8 (4): 652-8 (1994))). In some embodiments, the target cell expresses a protein that can be detected by t-haNK TM The antigen recognized by the CAR expressed on the cell surface. 51 Cr-labeled target cells and NK- The cells are mixed and lysed. 51 The percentage of specific cytotoxicity is calculated from the amount of Cr. See patent publication number US20020068044.

[0140] Alternatively, the production of NK- Direct cytotoxicity of NK cells. Cells (referred to as effectors in the assay) are mixed with target cells loaded with calcein (referred to as targets in the assay) at certain ratios. After a period of incubation, the calcein released from the target cells can be assessed, for example, by a fluorescent plate reader.

[0141] The ratio of effector to target used in each assay can vary, optionally, the effector: target ratio can be 20: 1, 15: 1, 10: 1, 8: 1 or 5: 1; preferably, the effector: target ratio is 10: 1. The target cell can be any cell expressing an antigen molecule that can be expressed by an NK- Cells (t-haNK TM For example, SUP-B15 cells can be recognized by CD19CAR and are CD19t-haNK TM NK- The cytotoxicity values ​​of the cells may vary depending on the type of target cells used and the effector:target ratio. The cells may have 60%-100%, such as 70-100% or 80%-100% cytotoxicity. In some cases, when using a 1:10 effector:target ratio, NK- The cytotoxicity of the cells is 80%-100%, such as 82%-100%, 85%-100%, 87%-100%, 88%-100%, or 89%-100%.

[0142] Optionally, assess NK- Cells such as t-haNK TM The cytotoxicity of cells is antibody-dependent cellular cytotoxicity (ADCC). The method for measuring ADCC activity of cells is similar to the method described above for measuring direct cytotoxicity, but with the addition of an antibody that can recognize the target cell. The Fc receptors of NK cells recognize the cell-bound antibody and trigger a cytolytic reaction and killing of the target cell. In one illustrative example, t-haNK TM Cells are incubated with Herceptin (an anti-Her2 antibody) and SKBr3 (target cells), and the target cells can be activated by releasing internal components of the target cells such as the above 51 Cr or calcein, or the killing of SKBr3 cells was measured by PI staining of target cells.

[0143] Doubling time

[0144] NK- Cells such as t-haNK TM The growth rate of cells can be assessed by the cell doubling time, which is the time required for cells to double their initial cell number. The doubling time is inversely related to the growth rate of the cells; the longer the doubling time, the lower the growth rate.

[0145] WGS

[0146] Optionally, transforming NK- Whole genome sequencing (WGS) of cells to identify the insertion site of the polycistronic construct.

[0147] Therapeutic applications

[0148] The present disclosure also provides a method for treating any type of cancer in a subject at any stage of the disease. Non-limiting examples of suitable cancers include carcinomas, melanomas, or sarcomas. In some embodiments, the present invention is used to treat cancers of hematopoietic origin, such as leukemias or lymphomas. In some embodiments, the cancer is a solid tumor.

[0149] In some embodiments, a method of treating any type of cancer in a subject comprises administering to the patient a therapeutically effective amount of the above-described NK- cells, wherein cancer is thereby treated. In some embodiments, NK- The cells express an Fc receptor, such as a high affinity Fc receptor having the sequence shown in SEQ ID NO: 2. In some embodiments, NK- The cells express CD19CAR, Fc receptor and IL-2. In some embodiments, the modified NK- The cell comprises a polycistronic construct, and wherein the polycistronic construct encodes a chimeric antigen receptor and an Fc receptor.

[0150] Also provided are NK- Methods of cell therapy in a subject in need thereof. In some embodiments, the subject or patient has cancer or an infectious disease, such as a viral infection.

[0151] Modified NK- The cells can be administered to the individual in absolute numbers of cells, for example, from about 1000 cells / injection to up to about 10 billion cells / injection, such as about, at least about, or at most about 1 x 10 cells per injection. 8 , 1x10 7 , 5x10 7 , 1x10 6 , 5x10 6 , 1x10 5 , 5x10 5 , 1x10 4 , 5x10 4 , 1x10 3 , 5x10 3 NK- cells, or any range (including endpoints) between any two of these numbers. Therefore, the present disclosure also provides a method comprising a plurality of NK- A composition of cells, wherein the number of cells is 1x10 8 , 1x10 7 , 5x10 7 , 1x10 6 , 5x10 6 , 1x10 5 , 5x10 5 , 1x10 4 , 5x10 4 , 1x10 3 or 5x10 3 (etc.).

[0152] In other embodiments, about 1000 cells / injection / m 2 Up to approximately 10 billion cells / injection / m 2 Administer to the subject, such as about, at least about, or at most about 1 x 10 8 pcs / m 2 , 1x10 7 pcs / m 2 , 5x10 7 pcs / m 2 , 1x10 6 pcs / m 2 , 5x10 6 pcs / m 2 , 1x10 5 pcs / m 2 , 5x10 5 pcs / m 2 , 1x10 4 pcs / m 2 , 5x10 4 pcs / m 2 , 1x10 3 pcs / m 2 , 5x10 3 pcs / m 2 (etc.)NK- cells, or any range between any two of these numbers (including the endpoints).

[0153] In other embodiments, NK- The cells can be administered to the individual in a relative number of cells, for example, about 1000 cells up to about 10 billion cells / kg of the individual can be administered to the individual, such as about, at least about, or at most about 1 x 10 8 , 1x10 7 , 5x10 7 , 1x10 6, 5x10 6 , 1x10 5 , 5x10 5 , 1x10 4 , 5x10 4 , 1x10 3 or 5x10 3 NK- cells / kg individual, or any range between any two of these numbers (including the endpoints).

[0154] In other embodiments, the total dose may be m 2 The body surface area is calculated to include approximately 1x10 11 , 1x10 10 , 1x10 9 , 1x10 8 , 1x10 7 pcs / m 2 , or any range between any two of these numbers (including the endpoints). The average human is about 1.6 to about 1.8m 2 In a preferred embodiment, between about 1 billion and about 3 billion NK cells are administered to the patient. In other embodiments, each dose of NK- The amount of cells can be expressed in m 2 Calculated based on body surface area, including 1x10 11 , 1x10 10 , 1x10 9 , 1x10 8 , 1x10 7 pcs / m 2 The average human body surface area is 1.6-1.8m 2 .

[0155] In other embodiments, NK- The cells can be administered to the individual in a relative number of cells, for example, about 1000 cells up to about 10 billion cells / kg of the individual can be administered to the individual, such as about, at least about, or at most about 1 x 10 8 , 1x10 7 , 5x10 7 , 1x10 6 , 5x10 6 , 1x10 5 , 5x10 5 , 1x10 4 , 5x10 4 , 1x10 3 or 5x10 3 NK- cells / kg individual, or any range between any two of these numbers (including the endpoints).

[0156] NK- The cells can be administered to a patient with cancer once during therapy or they can be administered multiple times, for example once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 hours, or once every 1, 2, 3, 4, 5, 6, or 7 days, or once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 weeks or more, or any range between any two of these numbers (including the endpoints).

[0157] In some embodiments, the NK- cells. In some embodiments, the culture medium comprises human serum albumin. In some embodiments, the culture medium comprises human plasma. In some embodiments, the culture medium comprises about 1% to about 15% human serum or a human serum equivalent. In some embodiments, the culture medium comprises about 1% to about 10% human serum or a human serum equivalent. In some embodiments, the culture medium comprises about 1% to about 5% human serum or a human serum equivalent. In a preferred embodiment, the culture medium comprises about 2.5% human serum or a human serum equivalent. In some embodiments, the serum is human AB serum. In some embodiments, a serum substitute acceptable for use in human therapeutics is used in place of human serum. Such serum substitutes may be known in the art or developed in the future. Although concentrations of human serum in excess of 15% may be used, it is contemplated that concentrations greater than about 5% will be cost prohibitive. In some embodiments, the serum substitute may be used to replace human serum. NK- In some embodiments, NK- cell.

[0158] Contains NK- The pharmaceutically acceptable composition of the cell can include a variety of carriers and excipients. A variety of aqueous carriers can be used, such as buffered saline, etc. These solutions are sterile and generally do not contain unwanted substances. Suitable carriers and excipients and their formulations are described in Remington: The Science and Practice of Pharmacy [Remington: Pharmaceutical Science and Practice], 21st edition, David B. Troy, Lippicott Williams & Wilkins [Lippicott Williams & Wilkins] (2005). A pharmaceutically acceptable carrier refers to a material that is not biologically or otherwise unsuitable, that is, the material is administered to the subject without causing unsuitable biological effects or interacting with other components contained in the pharmaceutical composition in a harmful manner. If administered to the subject, the carrier is optionally selected to minimize the degradation of the active ingredient and minimize the adverse side effects of the subject. As used herein, the term pharmaceutically acceptable is used synonymously with physiologically acceptable and pharmacologically acceptable. Pharmaceutical compositions generally include reagents for buffering and preservation in storage, and may include buffers and carriers for appropriate delivery depending on the route of administration.

[0159] These compositions for in vivo or in vitro use can be sterilized by sterilization techniques used for cells. These compositions can contain acceptable auxiliary substances required to approximate physiological conditions, such as pH adjusters and buffers, toxicity regulators, etc., for example sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate, etc. The cell concentration in these preparations and / or other agents can vary and will be selected based on the specific mode of administration selected and the needs of the subject, mainly based on fluid volume, viscosity, body weight, etc.

[0160] In one embodiment, NK- The cells are administered to the patient along with one or more other treatments or agents for the cancer being treated. In some embodiments, the one or more other treatments for the cancer being treated include, for example, antibodies, radiation, chemotherapy, stem cell transplantation, or hormone therapy.

[0161] In some embodiments, NK- The NK cells and other cancer agents / treatments are administered simultaneously or approximately simultaneously (e.g., within about 1, 5, 10, 15, 20, or 30 minutes of each other). In some embodiments, the NK cells and other cancer agents / treatments are administered sequentially. Cells and other cancer agents / therapies. In some embodiments, upon administration of NK- The other cancer treatment / agent is administered one, two, or three days after the cells.

[0162] In one embodiment, the other cancer agent is an antibody. In one embodiment, the NK- In one embodiment, NK- The cells and antibodies are administered to the patient in the following manner: together, for example, in the same formulation; separately, for example, in separate formulations, at the same time; or can be administered separately, for example, at different dosing schedules or at different times of the day. When administered separately, the antibody can be administered by any suitable route, such as intravenous or intratumoral injection.

[0163] In some embodiments, the NK- Cells are used in combination with therapeutic antibodies and / or other anti-cancer agents. Therapeutic antibodies can be used to target cells expressing cancer-related or tumor-related markers. Table 4 shows examples of cancer therapeutic monoclonal antibodies. In some embodiments, NK- The cells express an Fc receptor, such as a high affinity Fc receptor having the sequence shown in SEQ ID NO: 2. In some embodiments, these NK- Cells are In one embodiment, the therapeutic antibody is avelumab.

[0164] Table 3. Illustrative Therapeutic Monoclonal Antibodies Examples of FDA-approved Therapeutic Monoclonal Antibodies

[0165]

[0166]

[0167] Examples of FDA-approved therapeutic monoclonal antibodies

[0168]

[0169]

[0170] This type of NK- Administration of the cells can be performed simultaneously with administration of the monoclonal antibody, or in a sequential manner. In some embodiments, after a subject has been treated with the monoclonal antibody, the subject is administered the NK- Alternatively, NK- cell.

[0171] In some embodiments, NK- In some embodiments, NK- The cells are infused directly into the bone marrow.

[0172] Therefore, the present disclosure provides a method of treating cancer or viral infection in a patient in need thereof, the method comprising administering to the patient a therapeutically effective amount of the NK- cells, thereby treating cancer.

[0173] Reagent test kit

[0174] Also disclosed are methods of using a plurality of NK- In some embodiments, the kit disclosed herein may further include at least one monoclonal antibody. The NK- The cells express CAR and Fc receptors. In some embodiments, NK- The cells further express IL-2, such as erIL-2, or IL-15, such as erIL-15. In some embodiments, the NK- The cell comprises a polycistronic construct, and wherein the polycistronic construct encodes a chimeric antigen receptor, an Fc receptor, and optionally IL-2 or IL-15.

[0175] In certain embodiments, the kit may contain other compounds, such as therapeutically active compounds or compounds to be used in the administration of NK- Drugs administered before, simultaneously with, or after the cells. Examples of such compounds include antibodies, vitamins, minerals, fludrocortisone, ibuprofen, lidocaine, quinidine, chemotherapeutic agents, and the like.

[0176] In various embodiments, the instructions for use of the kit will include instructions for using the kit components in the treatment of cancer or infectious diseases. The instructions may further contain instructions for how to treat NK- The instructions may further include guidance on dosage and frequency of administration.

[0177] In certain embodiments, the kit further comprises one or more compositions described herein, such as NK- A container of a composition of cells. A label indicating that the kit is used to treat cancer, such as a cancer described herein, can optionally be associated with such container. Optionally, the label also includes a notice in the form prescribed by a governmental agency regulating the manufacture, use, or sale of the drug or biological product, which notice reflects approval of the agency of manufacture, use, or sale for human administration.

[0178] Disclosed are the following materials, compositions and components, which can be used for the products of the disclosed methods and compositions, can be used in combination with these products, can be used to prepare these products, or disclose these products. These and other materials are disclosed herein, and it should be understood that when disclosing combinations, subgroups, interactions, groups, etc. of these materials, although the specific mention of each individual and overall combination of these compounds and the transformation may not be explicitly disclosed, each is specifically contemplated and described herein. For example, unless specifically indicated to the contrary, if a method is disclosed and discussed, and multiple modifications (including the method) that can be performed on multiple molecules are discussed, each and every combination and transformation of the method and possible modifications are specifically contemplated. Similarly, any subgroup or combination thereof is also specifically contemplated and disclosed. This concept applies to all aspects of the present disclosure, including but not limited to steps in the method using the disclosed composition. Therefore, if multiple other steps can be performed, it should be understood that each of these other steps can be performed with any specific method step or combination of method steps of the disclosed method, and each such combination or subgroup of combinations is specifically contemplated and should be considered disclosed.

[0179] Examples

[0180] The following examples are for illustrative purposes only and should not be construed as limiting. A variety of alternative techniques and procedures are available to those skilled in the art that would similarly allow one to successfully perform the following examples.

[0181] Example 1 : Generation of CD19CAR-modified NK- cell

[0182] The CD19CAR was cloned into the tricistronic plasmid pNEUKv l FcR_IL-2 vector, which also contains CD16 and erIL-2 transgenes. These tricistronic plasmids were electroporated into aNK cells. NK cells expressing CD19CAR were selected by IL-2-deficient medium. cells, because non-transformed aNK cells that are dependent on IL-2 cannot survive in IL-2-deficient medium.

[0183] Limiting dilution cloning

[0184] CD19t-haNK TMAliquots of the swarm culture were diluted to a density of 3 cells / ml in growth medium without the addition of IL-2. This cell suspension was aliquoted in 96-well plates at a volume of 200 μl per well, which was equivalent to an average of 0.6 cells per well. The plates were incubated at 37°C for 10 days and then visually inspected for cell growth. A total of 20 cultures (now called clones) were picked and transferred to larger containers and numbered according to their initial growth rate, with clones #1 to #10 being passaged first.

[0185] Example 2 .Bioanalytical methods

[0186] Cell culture:

[0187] Polyclonal and clonal CD19t-haNK TM Cells were cultured in growth medium supplemented with 5% heat-inactivated human AB serum (from a CMV-negative test donor) and without IL-2.

[0188] aNK cells were cultured in growth medium supplemented with 5% heat-inactivated human AB serum (from a CMV-negative test donor) and 500 IU / ml recombinant human IL-2.

[0189] HaNK cells were cultured in growth medium supplemented with 5% heat-inactivated human AB serum (from a CMV-negative test donor) and without IL-2.

[0190] K562 cells were cultured in RPMI-1640 supplemented with 10% heat-inactivated fetal bovine serum and an antibiotic / antimycotic cocktail. K562 cells were passaged every 2-5 days or whenever the culture medium developed a yellow color.

[0191] SUP-B15 and SUP-B15 CD19KO / CD20+ Cells were cultured in RPMI-1640 supplemented with 20% heat-inactivated fetal bovine serum, 55 uM β-mercaptoethanol, and an antibiotic / antimycotic cocktail. Cells were also passaged as above for K562 cells.

[0192] Antibody staining for flow cytometry analysis:

[0193] Cells were collected by centrifugation, washed twice in FACS buffer (5% FBS in 1X D-PBS), and resuspended in 1 ml FACS buffer. For direct fluorophore-coupled antibody staining of surface proteins, cells were incubated with appropriate coupled antibodies (or isotype controls) at 4 ° C in the dark for 20 minutes and then washed twice with FACS buffer. To detect CAR protein, cells were incubated with biotinylated anti-F (ab') 2 fragment antibodies and then incubated with streptavidin-APC antibodies. Samples were analyzed on a MACSQuant flow cytometer.

[0194] Growth assay:

[0195] From an initial concentration of 1x10 resuspended in growth medium supplemented with 5% heat-inactivated human AB serum 5 Starting from 10 cells / mL (day 1), the cultures were counted by an automated cell counter on days 3, 5, and 7. The growth rate was calculated by the following formula:

[0196] Doubling time (hours) =

[0197] [Duration (hours) x log(2)] / [log(final cell density)-log(initial cell density)]

[0198] Cytotoxicity:

[0199] The cell lines grown in suspension are resuspended by pipetting the cell culture up and down. Cell viability is determined by automatic counting (trypan blue exclusion method). Target cells are labeled with CFSE dye, and target cells and effector cells are diluted to the desired cell concentration in RPMI-1640 supplemented with 10% heat-inactivated FBS and antibiotics / antimycotics. Effector cells and target cells are mixed in 96-well plates with different effectors and targets (E: T is 20: 1, 10: 1, 5: 1, 2.5: 1, 1.25: 1, 0.62: 1, 0.31: 1 and 0.15: 1) ratios and incubated in an incubator at 5% CO2 atmosphere and 37°C for 4h. PI is then added to fluorescently label dead cells, and the assay is analyzed on a MACSquant flow cytometry device.

[0200] ADCC:

[0201] The cell lines grown in suspension were resuspended by pipetting the cell culture up and down. Cell viability was determined by automated counting (trypan blue exclusion). Target cells were labeled with PKH67-GL dye and diluted to the desired cell concentration in RPMI-1640 supplemented with 10% heat-inactivated FBS and antibiotics / antimycotics. Target cells were pre-incubated with monoclonal antibodies trastuzumab, rituximab or no antibody for 30 min at room temperature. Antibody-labeled target cells (and no antibody controls) and effector cells were then mixed in 96-well plates at different effector to target ratios (E:T was 20:1, 10:1, 5:1, 2.5:1, 1.25:1, 0.62:1, 0.31:1 and 0.15:1) and co-incubated in an incubator at 5% CO2 atmosphere and 37°C for 4 h. PI was then added to fluorescently label dead cells and the assay was analyzed on a MACSquant flow cytometry device.

[0202] Quantification of IL-2

[0203] The cells to be analyzed were washed once in D-PBS to remove residual medium, resuspended in fresh growth medium, and cultured in triplicate at 10 5 The density of cells / well (=200 μl / well) was divided into two 96-well plates, and the plates were incubated at 37°C in a humidified incubator under 5% CO2. After incubation for 24h, one group of plates was analyzed and the other was performed at 48h. The sample supernatant for analysis was prepared by a first centrifugation step at 500x g for 5min to remove cells, followed by a second centrifugation step at 2000x g for 5min to remove cell debris. The sample supernatant was frozen at -80°C until analysis. The cell pellet from the 500x g centrifugation step was resuspended, pooled in triplicate and the cell density was recorded. The IL-2 concentration in the sample supernatant was measured according to the manufacturer's instructions using a human IL-2 ELISA detection kit (available from Thermo Fisher Scientific (Waltham, Massachusetts)) and compared with the standard provided. The IL-2 concentration was standardized to the number of cells at 24 and 48h and expressed as pg / ml / 10 5 cells.

[0204] Example 3 : Modified NK- Cell phenotype

[0205] Measurement of CD19t-haNK by flow cytometry TM The expression of CD19CAR in cells, and the results showed that CD19t-haNK TM The cells were able to grow in the absence of IL-2, and more than 80% of these cells expressed high levels of CD16 ( Figure 3A ) and CAR( Figure 3B )Both.

[0206] In a separate experiment, twenty selected clones were screened by flow cytometry for surface expression of CD19CAR (detected by biotinylated F(ab')2 fragment specific primary antibody and streptavidin-APC secondary antibody) and CD16 (detected by 3G8 monoclonal antibody). Clones showing multiple positive populations, low CD16 staining intensity or high background were discarded.

[0207] Table 4. Determination of CD19t-haNK TM The percentage and intensity of CD19CAR and CD16 expression on clones

[0208]

[0209] The selected CD19t-haNK cells were identified by antibody staining and flow cytometry. TM Expression profiles of six NK cell markers in clones were compared with aNKs. All clones and aNKs were negative for CD3 expression, while only aNKs were negative for CD16 expression. All clones were positive for CD54, CD56, NKp30, and NKG2D expression, and their expression levels were similar to aNK controls.

[0210] Table 5. Determination of CD19t-haNK TM The percentage and intensity of NK cell surface marker expression on clones

[0211]

[0212]

[0213] Example 4 :CD19t-haNK TM Cell cytotoxicity against target cell lines

[0214] CD19t-haNK TM The cytotoxicity of the cells was analyzed by incubating them with target cells K562 cells, SUP-B15 cells, and SKBr cells. Figure 4A CD19t-haNK cells were shown to kill K562 cells (target cells). TM The cells maintained cytotoxicity comparable to that of the parental aNK cells. 16B1 and 18B1 are two CD19t-haNK cells obtained from two electroporation events performed on different days. TM group.

[0215] In a separate experiment, the selected CD19t-haNKTM The clones were used as effectors in a flow cytometry-based in vitro cytotoxicity assay against the K562 target cell line (CD19-, NK sensitive). In the 4h cytotoxicity assay, all clones exhibited potent cytolytic activity against K562. At a 10:1 ratio, CD19t-haNK TM The average maximum killing efficiency of the clones ranged from 70.9% ± 10.1% to 84.4% ± 0.6%, compared to 84.1 ± 2.4% for the aNK controls (n = 2 to 5). Figure 4B .

[0216] Figure 5A CD19t-haNK TM Cells display aNK TM Enhanced specific killing of the resistant, CD19-positive SUP-B15 cell line - at an effector to target ratio of 10, approximately 80%-90% of cells were killed by CD19t-haNK cells compared to only approximately 10%-20% of cells killed by aNK cells TM Cell killing.

[0217] In a separate experiment, the selected CD19t-haNK TM The clones were used as effectors against the SUP-B15 target cell line (CD19+, NK resistant) in an in vitro cytotoxicity assay based on flow cytometry. All clones were able to effectively target and kill resistant SUP-B15 in a 4h cytotoxicity assay. At a 10:1 ratio, CD19t-haNK TM The average maximum killing efficiency of the clones ranged between 85.7±0.1% and 92.2±1.2%, compared to 10.8±7.4% for the aNK controls (n=2 to 5). Figure 5B .

[0218] Fig. 6A showed that when combined with the anti-Her2 / neu antibody Herceptin, CD19t-haNK TM The ADCC activity of cells against SKBr3 cells (CD19-, Her2 / neu+) was compared with that of cells expressing only CD16(158V) receptors. The cells are quite...

[0219] In another experiment, the selected CD19t-haNK TMThe clones were used as effectors against a modified SUP-B15 target cell line (CD19-, CD20+, Her2-neu-, NK-resistant) in combination with anti-CD20 rituximab monoclonal antibody or anti-Her2-neu trastuzumab monoclonal antibody in an in vitro ADCC assay based on flow cytometry. In a 4h cytotoxicity assay, all clones were able to effectively target and kill resistant SUP-B15CD19KO / CD20+ when combined with the anti-CD20 antibody rituximab. At a 10:1 ratio, CD19t-haNK TM The maximum killing efficiency of clones was between 63.7% and 77.8%, compared with The control was 67.1% (n=1 to 2). When combined with the anti-Her2 / neu control antibody trastuzumab, and CD19t-haNK TM The clones were unable to kill the target SUP-B15CD19KO / CD20+ cells (at a 10:1 ratio, CD19t-haNK TM The maximum killing efficiency of clones was between 7.7% and 21.9%, while At a ratio of 10:1, CD19t-haNK TM The ADCC-mediated killing of clones ranged between 46.4% and 65.2%, compared to The control was 62.7%. Figure 6B .

[0220] Example 5 :CD19t-haNK TM Other characteristics of cells

[0221] Determine the selected CD19t-haNK cells by 7-day cell growth assay without changing the culture medium. TM The population doubling time of the clones was calculated and the average doubling time was calculated. The population doubling time of all clones ranged from 33.1 to 54.5 hours compared to 34.5 hours for the aNK control. Figure 7 .

[0222] CD19t-haNK TM The clones were cultured at a density of 10e5 cells / ml in 6-well plates without IL-2 and the culture supernatants were harvested after 24 and 48 h. The supernatants were analyzed by ELISA to detect and measure CD19t-haNK TM The potential ERIL-2 release of cells. At 24 h in culture, CD19t-haNK TM The clones released between 16.1 and 1278.5 pg / ml / 105 cells. Figure 8 .

[0223] Example 6 :CD19t-haNK TM :Evaluation of CD19-targeted t-haNK TM Antitumor activity of cells in the intravenous and subcutaneous models of Raji human Burkitt's Lymphoma in NSG mice

[0224] CD19t-haNK TM CD19t-haNK cells are natural killer cells that express a chimeric antigen receptor (CAR) against CD19 to treat hematological cancers of the B cell lineage. In this study, repeated intravenous (IV) administration of CD19t-haNK cells was evaluated in intravenous and subcutaneous (SC) Raji xenograft models in NSG mice. TM In both models, CD19t-haNK TM The cells showed significant therapeutic efficacy. Specifically, in the intravenous tumor model, CD19t-haNK cells showed significant therapeutic efficacy compared with vehicle control. TM In a subcutaneous tumor model, CD19t-haNK cells significantly improved animal survival. TM It was able to significantly inhibit tumor growth, reduce the number of morbidity / mortality events in animals, and significantly reduce the metastatic disease burden in the liver.

[0225] It has been previously shown that targeted aNK cells expressing a chimeric antigen receptor (CAR) against CD19 exhibit efficacy in Raji tumor-bearing NSG mice, most likely due to target-specific cytotoxicity in CAR-expressing cells (see, e.g., Oelsner et al., Cytotherapy, 2017). In this study, CD19t-haNK was evaluated in two different variants of the Raji xenograft model. TM Efficacy of cells: 1) Raji cells inoculated intravenously (IV); and 2) Raji tumors inoculated subcutaneously (SC), where both models received CD19t-haNK TM Please note that other groups of animals (Groups B and E) were also included in the original study protocol to be evaluated in this model, but due to differences with CD19t-haNK TM The efficacy determination was not relevant and therefore not included in this report (see Table 6 for a brief experimental design).

[0226] Example 7 :For CD19t-haNK TM Materials studied

[0227] CD19t-haNK TMCells (clone 19.6): The cells were grown in a 1:1 PCR reaction using a flow cytometry system developed by the Process Development Department of Toripal, Inc. CD19t-haNK cells were cultured in growth medium supplemented with 5% heat-inactivated human AB serum according to the protocol provided by TM cell.

[0228] Test animals: The test animals used were female NOD.Cg-Prkdc 9-10 weeks old at the start of the study (after quarantine) and weighing between 20-27 g at the start of the study. scid Iq tm1Wjl / SzJ (NSG) mice. There were 20 animals in the intravenous tumor model and 12 in the subcutaneous tumor model. The animal supplier was The Jackson Laboratory (610 Main Street Bar Harbor, ME04609, USA). A sterile stainless steel ear tag was applied to each mouse with a handheld applicator for identification. In addition, each cage had a cage card containing the study number and animal number information.

[0229] Raji cancer cell line: Raji cells were originally purchased from ATCC (Catalog No. CCL-86 TM ; Lot No. 61723871), and then by Preclinical Development, , Inc). These cells were validated by IDEXX on March 18, 2018 (see Appendix 2 for validation report). The cell culture medium was RPMI-1640 medium prepared by ATCC, which was supplemented with 10% fetal bovine serum and penicillin (100 U / mL) and streptomycin (100 μg / mL). Exponential phase Raji cells (passage 12) were collected by centrifugation. The cells were washed and cultured at 5×10 5 The cells were resuspended in serum-free medium at a concentration of 10 viable cells / mL for intravenous inoculation and plated at 2.5 x 10 6 The cells were resuspended in culture medium / Matrigel (1:1 v / v) at a concentration of 10 viable cells / mL for subcutaneous implantation. The cells were stored on ice prior to animal injection. The cells used in the in vivo study had a viability of 96%.

[0230] Raji intravenous model: 20 animals were injected intravenously with 0.2 mL of Raji cell suspension (1x10 5cell inoculum).

[0231] Raji subcutaneous model: 12 animals were implanted subcutaneously with 0.1 mL of Raji cell suspension (2.5 x 10 5 cell inoculum).

[0232] Example 8 :CD19t-haNK TM Experimental procedures of the study

[0233] Intravenous Raji model: Within 24 hours after cancer cell inoculation (which was defined as day 1), 20 animals were pseudo-randomly divided into 2 groups of 10 animals each according to body weight to achieve similar average body weights between groups. CD19t-haNK cells growing in the exponential phase were harvested by centrifugation on days 2, 5, 8, 10, 12, and 17. TM cells, and 5x10 7 The cells were prepared at a concentration of 1 x 10 cells / mL in growth medium and injected at a volume of 200 μL per mouse. 7 As shown in Table 6, animals in Group A received vehicle control, while animals in Group C received CD19t-haNK TM cell.

[0234] Animals were weighed before injection of tumor cells and weighed twice a week. Animals were observed daily for mortality / morbidity (G0 to G4) and clinical signs of toxicity (T1 to T12; see Table 6). Paralyzed or moribund animals were euthanized. Animals were euthanized by inhalation of CO followed by cervical dislocation. Death events (euthanasia or spontaneous death) were recorded in the death log and calculated to calculate the survival curve.

[0235] Subcutaneous Raji Model: After subcutaneous tumor implantation, animals were examined at least twice a week for tumor formation. When tumors became palpable, tumor volume (TV) was measured once or twice a week with a digital handheld caliper and calculated using the formula: TV = length x width 2 / 2 [length is the largest diameter of the tumor, and width is the shortest diameter]. When the average tumor volume reaches an injectable size (in this case 195mm 3 At 24 days after implantation, 12 tumor-bearing animals were pseudo-randomly divided into 2 groups of 6 animals each to achieve similar tumor volumes between groups. This was defined as day 0. CD19t-haNK cells growing in the exponential phase were harvested by centrifugation on days 1, 4, 7, 9, 11, and 13. TM Cells were irradiated with 1000 cGy and 5x10 7The cells were prepared in growth medium at a concentration of 1 x 10 cells / mL per mouse in an injection volume of 200 μL. 7 As shown in Table 6, animals in Group D received vehicle solution, while animals in Group F received CD19t-haNK TM Animals were weighed prior to tumor cell injection and then twice weekly.

[0236] Animals were observed for mortality / morbidity (G0 to G4) and clinical signs of toxicity (T1 to T12) every day. Paralyzed or moribund animals were euthanized. Once moribund animals showed morbidity, they were euthanized, and surviving animals were scheduled for euthanasia to collect tissues. Specifically, on the 13th day, 6 hours after the last dose of the test substance, half of the surviving animals (up to 3 mice / group) were euthanized. On the 15th day, 48 hours after the last administration, the remaining animals were euthanized. Euthanasia was performed by cervical dislocation when the animals were in a deep anesthesia state after the final intracardiac hemorrhage. Blood / serum samples were not analyzed in this part of the study, so they are not included in this report.

[0237] After termination, necropsies were performed and organs with obvious macroscopic lesions were collected, fixed in 10% formalin, and sent to a contract pathology laboratory (Seventh Wave Laboratories) for histological evaluation of tumor / metastatic disease burden.

[0238] Table 6: Study design (abbreviated)

[0239]

[0240] IR, irradiation (1000 cGy); non-IR, non-irradiation; IV, intravenous; SC, subcutaneous; Tx, treatment.

[0241] Example 9 :CD19t-haNK TM Data analysis for the study

[0242] Tumor volume was calculated using the following equation: Tumor volume = length x width 2 / 2 (length and width are the longest and shortest diameters of the tumor, respectively).

[0243] Tumor growth inhibition (TGI) was calculated as follows: TGI = (T C -T t ) / △T C x 100%, where T C and T t are the mean tumor volumes of the control and treatment groups at the end of the study, and ΔTC is the change in mean tumor volume in the control group.

[0244] Tumor growth curves were analyzed by 2-factor ANOVA followed by multiple comparisons by Tukey's test. Survival curves were analyzed by log-rank (Mantel-Cox) test. Differences in liver metastatic disease burden on each day were analyzed by unpaired 2-tailed t-test. P < 0.05 was considered statistically significant. All statistical analyses were performed using GraphPad Prism 7 version.

[0245] Example 10 :CD19t-haNK TM Results of the Intravenous Raji Model Study

[0246] The primary readout in the intravenous tumor model is animal survival. Death events were counted when animals were found dead or euthanized due to disease-related morbidity and / or paralysis. Fig. 9 As shown, CD19t-haNK TM Cell treatment significantly improved the survival of the animals, with a median survival of 27 days compared to 21.5 days in the vehicle control group (P<0.0001). Animal body weight changes were also monitored throughout the study. Fig.10 As shown, CD19t-haNK TM Treated animals exhibited moderate (less than 10%) and short-term weight loss when treatment was first initiated, which is uncommon in animals receiving intravenous NK infusions and is not atypical for CD19t-haNK TM After the first week of treatment, their body weight was able to recover and then decreased again due to disease progression.

[0247] Example 11 :CD19t-haNK TM Results of the Subcutaneous Raji Model Study

[0248] The primary readout in subcutaneous tumor models is tumor growth. Fig.11 As shown, CD19t-haNK TM The cells demonstrated a clear and statistically significant inhibition of tumor growth on day 7 and thereafter, with a TGI of 49% at the end of the study (day 13).

[0249] Furthermore, since Raji is an aggressive lymphoma model, even when inoculated subcutaneously, cancer cells are able to spread and generate multiple metastatic sites, ultimately leading to animal morbidity and / or mortality. In the vehicle group, a total of 3 animals (50%) became moribund between days 11 and 13 and were therefore euthanized. In contrast, in the CD19t-haNKTM There were no unexpected death events in the cell groups (Table 7).

[0250] In addition, during autopsy, CD19t-haNK TM A qualitative reduction in liver metastases was observed in treated animals ( Fig.12 a). Semiquantitative estimates of disease burden were performed by a contract pathology laboratory (Wave 7 laboratory) on representatively sampled H&E-stained liver sections. Fig.12 As summarized in Table 8, there was a clear trend toward increased disease burden as the study progressed. TM The livers of treated animals showed a significantly lower percentage of cancer-infiltrated areas. Due to the small number of samples and unscheduled early deaths in the control group, statistical analysis was only possible for data from day 13. This analysis showed a significant difference in disease burden, with a significant difference in CD19t-haNK TM The mean infiltration in treated animals was 10% compared to 30% in controls. Body weight changes were monitored throughout the study, and similar to the intravenous Raji model, CD19t-haNK TM Treated animals exhibited moderate (less than 10%) and transient weight loss at the start of the treatment regimen ( Fig.13 ).

[0251] Table 7: Death / Mortal Records of Animals in the Subcutaneous Raji Model

[0252]

[0253] Scheduled: Scheduled euthanasia for tissue collection.

[0254] Table 8: Percentage of liver tumor cells involved

[0255]

[0256] Example 12 :CD19t-haNK TM Conclusions of the study

[0257] To evaluate CD19t-haNK TM The antitumor efficacy of the cells in a repeated intravenous dosing regimen was investigated using 2 variants of the Raji xenograft model with intravenous and subcutaneous tumor inoculation, respectively. In the intravenous tumor model, CD19t-haNK TM The cells were able to significantly improve animal survival, extending the median survival by 5.5 days (26% increase). TMThe cells were able to significantly inhibit tumor growth, resulting in a TGI of 49% at the end of the study. TM Treatment can reduce the number of animal morbidity / mortality events (CD19t-haNK TM 0 / 6 treated animals vs 3 / 6 controls) and significantly reduced metastatic disease burden in the livers of subcutaneous Raji tumor-bearing animals. Overall, CD19t-haNK cells significantly reduced metastatic disease burden in the livers of subcutaneous Raji tumor-bearing animals compared with vehicle controls in both variants of the Raji xenograft model. TM The cells showed remarkable therapeutic effects.

[0258] It should be clear to those skilled in the art that, without departing from the inventive concept of this article, more modifications are possible in addition to those already described. Therefore, the subject matter of the present invention is limited only to the scope of the appended claims. In addition, when interpreting the specification and claims, all terms should be interpreted in a manner as broad as possible consistent with the context. In particular, the terms "comprises" and "comprising" should be interpreted as referring to elements, components or steps in a non-exclusive manner, thereby indicating that the mentioned elements, components or steps can exist, or use, or combine with other elements, components or steps not explicitly mentioned. When the specification claims involve at least one of the groups selected from A, B, C ... and N, the text should be interpreted as requiring only one element in the group, rather than A plus N, or B plus N, etc.

Claims

1. A natural killer (NK) cell for reducing metastatic burden, wherein the NK cell expresses a CD19 CAR comprising an Fcε receptor γ (FcεRIγ), wherein the CD19 CAR comprises a first domain fused to a second domain, the first domain comprising a CD19-specific single-chain variable fragment (scFv), and the second domain comprising a transmembrane and cytoplasmic signaling domain having an amino acid sequence of amino acids 274-407 of SEQ ID NO:

12.

2. The NK cell of claim 1, wherein the coding sequence of the CD19 CAR is codon-optimized for expression in a human system.

3. The NK cell according to any one of claims 1-2, wherein the NK cell is capable of killing CD19-expressing tumor cells.

4. The NK cell of claim 1, wherein the scFv antibody fragment comprises an amino acid sequence that is at least 95% identical to SEQ ID NO:

10.

5. The NK cell of claim 1, wherein the NK cell comprises a nucleic acid having a sequence of SEQ ID NO: 9, wherein the sequence encodes the scFv antibody fragment.

6. The NK cell according to claim 1, wherein when the ratio of effector to target is 10, the direct cytotoxicity of the NK cell to CD19 expressing cells is 70%-100%. The NK cell according to claim 1 , wherein when the ratio of effector to target is 10, the ADCC activity of the NK cell is 30%-90%.

8. The NK cell of claim 1, wherein the CD19 CAR comprises an amino acid sequence that is at least 95% identical to SEQ ID NO:

12.

9. The NK cell of claim 1, wherein the NK cell expresses CD16 on the cell surface.

10. The NK cell of claim 1, wherein the NK cell expresses IL-2 or IL-15.

11. The NK cell of claim 1, wherein the NK cell comprises a tricistronic vector encoding the CD19 CAR, CD16, and IL-2 or IL-15.

12. The NK cell according to claim 11, wherein the tricistronic vector comprises the nucleic acid sequence of SEQ ID NO:

13.

13. The NK cell according to claim 1, wherein the NK cell is a primary NK cell. The NK cell according to claim 1 , wherein the NK cell is a NK-92 cell. 15 . A kit comprising a pharmaceutical composition containing the NK cell according to claim 1 .

16. A method for generating NK cells for use in reducing metastatic burden, the method comprising: A multicistronic vector is provided, wherein the multicistronic vector encodes a CD19 CAR, CD16, and IL-2 or IL-15, wherein the CD19 CAR comprises a first domain fused to a second domain, the first domain comprising a CD19-specific single-chain variable fragment (scfv), the second domain comprising a transmembrane and cytoplasmic signaling domain having an amino acid sequence of amino acids 274-407 of SEQ ID NO: 12; and The vector is introduced into NK cells to produce the NK cells.

17. The method of claim 16, wherein the vector comprises a sequence encoding a self-cleaving peptide, wherein the sequence is located between CAR and CD16, and wherein the sequence allows equimolar expression of CAR and CD16.

18. The method of claim 16, wherein the vector comprises an internal ribosome entry sequence (IRES) between the CD16 coding sequence and the IL-2 or IL-15 coding sequence.

19. A natural killer (NK) cell for treating B cell malignancies, wherein the NK cell expresses a CD19 CAR comprising an Fcε receptor γ (FcεRIγ), wherein the CD19 CAR comprises a first domain fused to a second domain, the first domain comprising a CD19-specific single-chain variable fragment (scFv), and the second domain comprising a transmembrane and cytoplasmic signaling domain having an amino acid sequence of amino acids 274-407 of SEQ ID NO:

12.

20. The NK cell of claim 19, wherein the B cell malignancy is one or more of: B acute lymphoblastic leukemia, chronic lymphocytic leukemia, B cell non-Hodgkin's lymphoma, refractory follicular lymphoma, and mantle cell lymphoma.

21. The NK cell of claim 19, wherein the scFv comprises an amino acid sequence that is at least 95% identical to SEQ ID NO:

10.

22. The NK cell of claim 19, wherein the CD19 CAR comprises an amino acid sequence that is at least 95% identical to SEQ ID NO:

12.

23. The NK cell of claim 19, wherein the NK cell is a NK-92 cell.

24. The NK cell of claim 23, wherein the NK-92 cell expresses CD16 on the cell surface.

25. The NK cell of claim 23, wherein the NK-92 cell expresses IL-2 or IL-15.

26. The NK cell of claim 19, further comprising an anti-CD20 antibody.

27. The NK cell of claim 26, wherein the anti-CD20 antibody is rituximab.

28. The NK cells according to claim 24, further comprising primary NK cells.

29. A kit comprising a pharmaceutical composition containing the NK cells according to claim 19.

30. A natural killer (NK) cell for killing CD19-expressing tumor cells, wherein the NK cell expresses a CD19 CAR comprising an Fcε receptor γ (FcεRIγ), wherein the CD19 CAR comprises a first domain fused to a second domain, the first domain comprising a CD19-specific single-chain variable fragment (scFv), and the second domain comprising a transmembrane and cytoplasmic signaling domain having an amino acid sequence of amino acids 274-407 of SEQ ID NO: 12.

Images