GmDRM2c / 3a / 3b gene editing method for enhancing anti-SMV capability of soybeans and gRNA sequence design of GmDRM2c / 3a / 3b gene editing method

Abstract

The invention relates to the technical field of biotechnology, and discloses a GmDRM2c / 3a / 3b gene editing method for enhancing the anti-SMV ability of soybeans and gRNA sequence design thereof, the gRNA sequence can specifically target and knock out GmDRM2c, GmDRM3a and GmDRM3b genes so as to enhance the resistance of the soybeans to soybean mosaic viruses, the gRNA sequence shared by the GmDRM3b and the GmDRM2c is TGAAGCATAATTCTGAGCTGG, and the gRNA sequence of the GmDRM3a is GTGTCAAAGCCTCAAAAGGG.According to the application, a specific gene is edited through a CRISPR / Cas9 technology, so that the anti-SMV ability of the soybeans is enhanced, the gene expression related to disease resistance can be accurately regulated and controlled, so that the resistance of soybean plants to SMV is remarkably improved, the method is not only suitable for soybeans, but also can be expanded to other leguminous crop varieties, and the possibility of disease resistance improvement is provided for various leguminous crops.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology technology, and specifically to a GmDRM2c / 3a / 3b gene editing method and gRNA sequence design thereof for enhancing soybean resistance to SMV. Background Art

[0002] DNA methylation is an important epigenetic modification that plays a key role in biological processes by regulating gene expression and maintaining genome stability. It is mainly divided into two modes: maintenance methylation and de novo methylation. De novo methylation refers to the occurrence of new methylation modifications at specific sites that were originally unmethylated under the action of specific enzymes. In plants, the key enzymes involved in this process include RDR2 (RNA-DependentRNA Polymerase 2), DCL3 (Dicer-Like Protein 3) and DRM2, which play an important role in the RNA-directed DNA methylation (RdDM, RNA-Directed DNA Methylation) pathway.

[0003] CHH methylation is a special form of DNA methylation, which is usually maintained by DRM2 or CMT2, depending on the genomic region where it is located. DRM2 is responsible for maintaining CHH methylation in the regions targeted by the RdDM pathway, which mainly include young transposons, repetitive sequences on autosome arms, and the edge parts of long transposons in heterochromatin regions. Studies have shown that the DRM-mediated RdDM pathway is essential for improving plant adaptability to biotic stresses. For example, in Arabidopsis infected with turnip mosaic virus (TuMV), the expression of DRM2 was significantly increased, indicating that it can regulate the plant's antiviral response.

[0004] Soybean mosaic virus (SMV) is one of the most common soybean viral diseases worldwide. Its host range is limited to six plant families and it is most common in wild soybean and cultivated soybean. SMV can be transmitted by aphids in a non-persistent manner or by seeds carrying the virus. SMV infection of soybean was first recorded in China in 1915 and has since been found in almost all cultivated soybean varieties worldwide. Symptoms of SMV infection include mosaic and necrosis, which seriously affect plant growth and cause 8% to 50% yield losses.

[0005] In view of the above background, the present invention uses CRISPR / Cas9 gene editing technology, especially the editing of GmDRM2c / 3a / 3b genes, to explore and develop a method for enhancing soybean resistance to SMV, so as to improve the disease resistance and yield stability of crops. This method not only helps to deeply understand the mechanism of action of the RdDM pathway in soybean disease resistance, but also provides new strategies and technical means for soybean disease resistance breeding. Summary of the invention

[0006] The object of the present invention is to provide a GmDRM2c / 3a / 3b gene editing method for enhancing soybean resistance to SMV, so as to solve the problems raised in the above-mentioned background technology.

[0007] In order to solve the above technical problems, the present invention provides the following technical solutions: a gRNA sequence for creating soybean GmDRM2c / 3a / 3b mutants, wherein the gRNA sequence can specifically target and knock out the GmDRM2c, GmDRM3a and GmDRM3b genes, thereby enhancing the resistance of soybean to soybean mosaic virus, the gRNA sequence shared by GmDRM3b and GmDRM2c is TGAAGCATCAATTCTGAGCTGG, and the gRNA sequence of GmDRM3a is GTGTCAAAGCCTCCTCAAAAGGG.

[0008] The gene editing method for enhancing soybean resistance to SMV comprises the following steps: S1, designing specific gRNA using the gRNA sequence according to claim 1; S2, constructing a gene editing vector comprising the gRNA sequence and the Cas9 nuclease coding sequence; S3, introducing the gene editing vector into soybean cells through Agrobacterium-mediated cotyledon node transformation; S4, screen soybean plants containing the expected mutation and verify their resistance to SMV.

[0009] According to the above technical scheme, the gRNA sequence is designed based on CRISPR-P software to ensure high target score and low off-target rate.

[0010] According to the above technical solution, the gene editing vector also includes a selection marker gene for screening transgenic plants.

[0011] According to the above technical solution, the screening step includes using molecular biology technology to detect the knockout status of GmDRM2c, GmDRM3a and GmDRM3b genes.

[0012] According to the above technical solution, the resistance verification step includes inoculating SMV SC1 and SC3 mixed viruses under greenhouse conditions and evaluating the disease resistance performance of transgenic plants.

[0013] According to the above technical solution, the resistance verification also includes analyzing the changes in the expression level of the CP gene by qRT-PCR to confirm the reduction in the level of viral replication in the transgenic plants.

[0014] According to the above technical solution, the GC content of the seed region of the gRNA sequence is controlled at 40% to 60% to improve the specificity of gRNA and target recognition.

[0015] According to the above technical solution, the method is applicable to improving the disease resistance of other leguminous crop varieties.

[0016] Compared with the prior art, the beneficial effects achieved by the present invention are: (1) Precision editing: Editing specific genes through CRISPR / Cas9 technology can accurately regulate the expression of genes related to disease resistance, thereby significantly improving the resistance of soybean plants to SMV; (2) Wide applicability: This method is not only applicable to soybeans, but can also be extended to other legume varieties, providing the possibility of improving disease resistance for a variety of legume crops; (3) Reduce yield losses: SMV infection can cause yield losses of 8% to 50%, and in severe cases may even lead to complete crop loss. By enhancing soybean disease resistance, we can effectively reduce yield losses caused by virus infection and ensure the stability and sustainability of agricultural production. (4) Improve grain quality: reduce the brown spots on grains caused by SMV, and improve the commodity value and market competitiveness of soybeans; (5) Scientific Exploration: The editing and study of GmDRM2c / 3a / 3b genes will help us gain a deeper understanding of the specific mechanism of action of the RNA-directed DNA methylation (RdDM) pathway in plant disease resistance, providing a theoretical basis for further research; (6) Rapidly obtain high-quality varieties: Gene editing technology can be used to cultivate new soybean varieties with high resistance in a relatively short period of time, which greatly shortens the time cycle compared to traditional breeding methods; (7) Resource conservation: It reduces the time and resource investment required for repeated experiments and screening, improves breeding efficiency and reduces costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation of the present invention. In the accompanying drawings: Figure 1 It is a schematic diagram of the primer sequence for identifying gene marker types of the present invention; Figure 2 is a schematic diagram of plant phenotype after SMV inoculation of the present invention; Figure 3 It is a schematic diagram of the Sanger sequencing results of the GmDRM2c / 3a / 3b mutant of the present invention; Figure 4 It is a schematic diagram of the analysis of the expression level of the SMV CP gene of the present invention; DETAILED DESCRIPTION

[0018] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0019] See also Figure 1-4 The present invention provides a technical solution: a gRNA sequence for creating a soybean GmDRM2c / 3a / 3b mutant, wherein the gRNA sequence can specifically target and knock out the GmDRM2c, GmDRM3a and GmDRM3b genes, thereby enhancing the resistance of soybean to soybean mosaic virus, the gRNA sequence shared by GmDRM3b and GmDRM2c is TGAAGCATCAATTCTGAGCTGG, and the gRNA sequence of GmDRM3a is GTGTCAAAGCCTCCTCAAAAGGG.

[0020] The gene editing method for enhancing soybean resistance to SMV comprises the following steps: S1, designing specific gRNA using the gRNA sequence according to claim 1; S2, constructing a gene editing vector comprising the gRNA sequence and the Cas9 nuclease coding sequence; S3, introducing the gene editing vector into soybean cells through Agrobacterium-mediated cotyledon node transformation; S4, screen soybean plants containing the expected mutation and verify their resistance to SMV.

[0021] Specifically, the gRNA sequence was designed based on CRISPR-P software to ensure high target scores and low off-target rates.

[0022] Specifically, the gene editing vector also includes a selection marker gene for screening transgenic plants.

[0023] Specifically, the screening step includes using molecular biology techniques to detect the knockout of GmDRM2c, GmDRM3a and GmDRM3b genes.

[0024] Specifically, the resistance verification step includes inoculating SMV SC1 and SC3 mixed viruses under greenhouse conditions and evaluating the disease resistance performance of transgenic plants.

[0025] Specifically, the resistance verification also includes analyzing the changes in the expression level of the CP gene by qRT-PCR to confirm the reduction in the level of viral replication in the transgenic plants.

[0026] Specifically, the GC content of the seed region of the gRNA sequence is controlled at 40% to 60% to improve the specificity of gRNA and target recognition.

[0027] Specifically, the method is applicable to improving the disease resistance of other leguminous crop varieties.

[0028] The soybean materials used in this study include: the wild-type soybean variety Williams 82 (Wms82) and the GmDRM triple gene knockout homozygous mutant (GmDRM2c / 3a / 3b) created by CRISPR / Cas9 technology based on Wms82.

[0029] Example 1: gRNA sequence design Input target gene sequence: The whole genome sequence and CDS sequence of soybean GmDRMs were obtained from Phytozome, and the exon region was obtained after alignment. The gRNA sequence was designed in the exon region, and the GmDRM2c, GmDRM3a and GmDRM3b gene sequences were input using CRISPR-P software.

[0030] Generate candidate gRNA sequences: The software automatically generates multiple candidate gRNA sequences and calculates the target score and potential off-target sites for each sequence.

[0031] Select the best gRNA sequence: Select a gRNA sequence with a high target score and low off-target risk, while ensuring that the GC content of the seed region is between 40% and 60%.

[0032] Example 2: Construction of gene editing vector Cloning gRNA sequence: Insert the selected gRNA sequence into the vector containing the Cas9 nuclease coding sequence.

[0033] Verify vector construction: Verify that the vector is constructed correctly by sequencing.

[0034] Example 3: Transformation of soybean cells Agrobacterium-mediated transformation: The constructed gene editing vector is introduced into Agrobacterium, and then the vector is introduced into soybean cells through the Agrobacterium-mediated cotyledon node transformation method. The specific steps are as follows: S1, select an appropriate amount of soybean Shennong9 seeds that are smooth, round, without spots or cracks, plump and yellow in color.

[0035] S2, put the selected seeds into a culture dish (do not put too many soybean seeds, just lay them in one layer, otherwise the beans will be stacked together and the sterilization will not be thorough), open the lid of the culture dish, and put it in a sealed jar; use a 50mL centrifuge tube to fill 40mL of sodium hypochlorite solution (NaClO), also put it in a sealed jar, drop 1.6mL of concentrated hydrochloric acid into the sodium hypochlorite solution to produce chlorine gas for sterilization (2HCl+NaClO=Cl2+NaCl+H2O), cover the sealed jar, seal the jar mouth with plastic wrap, and keep it sealed for 12-16h. Be sure to operate in a fume hood.

[0036] S3. During this period, prepare sufficient amounts of GM medium, CCM medium, SIM medium, SEM medium, and RM medium, pour the medium into plates overnight, prepare several tweezers, scalpels, blue gun tips, cut filter papers (placed in culture dishes), and appropriate amounts of culture dishes, put them in a high-pressure steam sterilizer, and sterilize them for later use.

[0037] S4, open the sealed can, quickly cover the culture dish lid, take out the culture dish and put it in the sterile operating table and blow it for 20-30 minutes to remove the smell of chlorine, and sterilize the sterilized tweezers again on the outer flame of the alcohol lamp. After the tweezers cool down, pick up the seeds with the hilum facing down and plant them in the GM culture medium. Note that the seeds should be slightly inserted into the culture medium. Plant 10 seeds in each culture dish.

[0038] S5. Place the culture dish with the seeds in a cardboard box and culture it in the dark at 25°C for 18-20 hours.

[0039] S6. The next day, take out the germinated soybean seeds, cut them along the hilum with a sterilized scalpel (cut on the lid of a sterilized plate, and you can put a piece of sterilized filter paper under it), slowly cut the seeds in half (one seed is divided into two halves), and use the scalpel blade to gently make 3 to 7 wounds at the cotyledon node, and also make a few wounds on the surface of the cotyledon. This is the explant.

[0040] S7, place the explants in Agrobacterium at around OD=0.8 and infect at 60 rpm for 15-20 min.

[0041] S8. Use clean tweezers to transfer soybean seeds infected with Agrobacterium to CCM medium covered with sterilized filter paper (remove the seed coat), and culture in the dark in an incubator at 24°C for 5 days.

[0042] S9, remove the explants from the incubator, transfer the explants with good growth adaxial surface upward to SIM induction medium, and culture them in an incubator at 25°C, 16 h light and 8 h dark for about 14 days.

[0043] S10, after 14 days of culture, the explants with good development status (abundant callus tissue and green color) were removed, the redundant hypocotyls at the bottom were cut off, and the explants were transferred to the induction medium SIM again and cultured under normal growth conditions for about 14 days.

[0044] S11, after 14 days of culture, the clustered buds produced from the explants in good condition are transferred to SEM bud elongation medium for culture at 25°C, 16h light and 8h dark conditions and placed in an incubator for about 14 days.

[0045] S12, when the resistant clustered buds grow to 3-5 cm (and they grow well with enough green leaves), they are quickly cut from the callus with a sterilized scalpel and soaked in 1mg / L IBA for 30s, then transferred to RM rooting medium for continuous cultivation at 25℃, 16h light and 8h dark. When the resistant buds grow strong white roots (the number of roots is sufficient and strong), they are transplanted to the greenhouse for normal cultivation after greenhouse seedling training (adding an appropriate amount of water to the surface of the culture medium).

[0046] Screening positive plants: Soybean plants containing the expected mutation are screened by selecting marker genes.

[0047] Example 4: Resistance Verification Greenhouse inoculation experiment: The GmDRM2c / 3a / 3b mutant and Williams 82 were co-grown in a greenhouse at 25°C with a 16-h light cycle and an 8-h dark cycle. Fourteen-day-old plants were used to detect virus resistance and were inoculated with a mixture of SMV SC1 and SMV SC3 and 0.01 mol / L phosphate solution as control treatments.

[0048] Molecular biology verification: The phenotype was observed 21 days after inoculation, and then the newly grown leaves were collected for RNA extraction. The changes in CP gene expression levels were analyzed by qRT-PCR to confirm the reduction in viral replication levels in transgenic plants.

[0049] It should be noted that, in this article, relational terms such as first and second, etc. are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "include", "comprise" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device.

[0050] Finally, it should be noted that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A gRNA sequence for creating soybean GmDRM2c / 3a / 3b mutants, characterized in that: The gRNA sequence can specifically target and knock out the GmDRM2c / 3a / 3b genes, thereby enhancing the resistance of soybean to soybean mosaic virus. The gRNA sequence shared by GmDRM3b and GmDRM2c is TGAAGCATCAATTCTGAGCTGG, and the gRNA sequence of GmDRM3a is GTGTCAAAGCCTCCTCAAAAGGG.

2. A gene editing method for enhancing soybean resistance to SMV, characterized in that: The following steps are involved: S1, designing specific gRNA using the gRNA sequence according to claim 1; S2, constructing a gene editing vector comprising the gRNA sequence and the Cas9 nuclease coding sequence; S3, introducing the gene editing vector into soybean cells through Agrobacterium-mediated cotyledon node transformation; S4, screen soybean plants containing the expected mutation and verify their resistance to SMV.

3. The gRNA sequence according to claim 1, characterized in that: The gRNA sequences were designed based on CRISPR-P software to ensure high on-target scores and low off-target rates.

4. The method according to claim 1 or 2, characterized in that: The gene editing vector also includes a selection marker gene for screening transgenic plants.

5. The method according to any one of claims 1 to 4, characterized in that: The screening step includes using molecular biology techniques to detect the knockout of GmDRM2c, GmDRM3a and GmDRM3b genes.

6. The method according to any one of claims 1 to 5, characterized in that: The resistance verification step includes inoculating SMV SC1 and SC3 mixed viruses under greenhouse conditions and evaluating the disease resistance performance of transgenic plants.

7. The method according to any one of claims 1 to 6, characterized in that: The resistance validation also includes analyzing the changes in CP gene expression levels by qRT-PCR to confirm the reduction in viral replication levels in transgenic plants.

8. The gRNA sequence according to claim 1, characterized in that: The GC content of the seed region of the gRNA sequence is controlled at 40% to 60% to improve the specificity of gRNA and target recognition.

9. The method according to any one of claims 1 to 8, characterized in that: The method is applicable to improving the disease resistance of other leguminous crop varieties.

Images