Rice nitrogen response transcription factor OsNRTF2 gene, protein coded by same and application of rice nitrogen response transcription factor OsNRTF2 gene

Abstract

The invention belongs to the field of plant genetic engineering, and particularly relates to a rice nitrogen response transcription factor OsNRTF2 gene, a protein coded by the rice nitrogen response transcription factor OsNRTF2 gene and application. The invention provides a rice nitrogen response transcription factor gene OsNRTF2, and the nucleotide sequence of the OsNRTF2 gene is shown as Seq ID No.1. The invention also provides a preparation method of the rice nitrogen response transcription factor gene OsNRTF2. The invention also provides an application of the gene OsNRTF2 at the same time, wherein the application is at least any one of the following applications: regulation and control of rice yield and nitrogen utilization efficiency. The invention provides important guidance for cultivating a new variety of nitrogen-efficient rice, and has important significance for guaranteeing grain safety.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and specifically relates to a rice nitrogen response transcription factor OsNRTF2 gene and a protein encoded by the gene and application thereof. Background Art

[0002] Rice is one of the important food crops and a model plant for monocotyledon research. Nitrogen is a macronutrient necessary for plant growth and development, and an adequate nitrogen supply is crucial to crop yields. Increasing the amount of nitrogen fertilizer applied can significantly increase rice yields, but excessive use of nitrogen fertilizers not only increases the burden, but also causes serious environmental pollution. Therefore, improving the nitrogen use efficiency of rice and reducing the amount of nitrogen fertilizer used while maintaining rice yields is of great significance to green agricultural production.

[0003] The nitrogen utilization process of crops involves nitrogen absorption, transport and assimilation. At present, a series of genes related to nitrogen absorption, transport, assimilation and re-transportation have been cloned and analyzed in crops such as rice, including nitrate transporter NRT1s and NRT2s family genes, ammonium transporter AMT family genes, nitrate reductase encoding genes NRs, and glutamine synthetase GS family genes (Jiang Zhimin et al. 2018; Li Shan et al. 2021). Knocking out or overexpressing the above-mentioned related genes using gene editing technology can significantly affect crop nitrogen utilization efficiency and yield-related agronomic traits.

[0004] In addition to the above genes, transcription factors that can recognize specific motifs in the upstream promoter of target genes and activate or inhibit the expression of downstream target genes also play a key role in crop nitrogen utilization. For example, the GRF transcription factor OsGRF4 protein in rice can directly activate the expression of nitrogen absorption and assimilation-related genes, promote nitrogen absorption, assimilation and transportation, and improve rice yield and nitrogen fertilizer use efficiency (Li, et al. 2018). The TCP transcription factor OsTCP19 is the key to determining rice nitrogen response and tillering, and its expression level is negatively correlated with the number of rice tillers. The 29bp Indel in the promoter region of OsTCP19 is a key natural variation that determines the number of tillers in different rice varieties under low nitrogen levels (Liu, et al. 2021). MYB transcription factors are one of the largest plant transcription factor families, which play a very important role in plant growth and development, hormone signal transduction, and plant responses to biotic and abiotic factors. At least 155 MYB transcription factors were found in the rice genome using bioinformatics methods (Katiyar, et al. 2012). 130 rice MYB transcription factors were also collected in the Plant Transcription Factor Database (http: / / planttfdb.gao-lab.org / ). Among them, OsMYB305 encodes a transcriptional activator. Nitrogen deficiency induces OsMYB305 expression in roots. OsMYB305 overexpression enhances nitrogen absorption and assimilation, and improves rice growth under low nitrogen conditions, increasing tiller number, aboveground dry weight and total nitrogen concentration (Wang, et al. 2020). Rice MYB61 is a transcription factor that regulates cellulose synthesis. Its gene expression is induced by low nitrogen and regulated by OsGRF4. Natural variation in OsMYB61 between indica and japonica subspecies leads to high nitrogen use efficiency in indica rice (Gao, et al. 2020). OsNRTF2 was predicted to be a MYB-type transcription factor, and its biological function has not yet been reported.

[0005] The references involved are as follows:

[0006] Jiang Zhimin, Wang Wei, Chu Chengcai (2018) Research progress and prospects of efficient nitrogen utilization in plants. Life Science 30:1060-1071 Li Shan, Huang Yunzhi, Liu Xueying, Fu Xiangdong (2021) Research progress on genetic improvement of nitrogen fertilizer utilization efficiency in crops. Heredity 43:629-641;

[0007] Barman HN(2021)CRISPR-Cas9-Mediated Genome Editing in Rice:ASystematic Protocol for Single-and Multi-Target Vector Construction.CRISPR-Cas Methods:Volume 2 179-205;

[0008] Chen J,Zhang Y,Tan Y,Zhang M,Zhu L,Xu G,Fan X(2016)Agronomicnitrogen-use efficiency of rice can be increased by driving OsNRT2.1expression with the OsNAR2.1 promoter.Plant Biotechnology Journal 14:1705-1715;

[0009] Gao Y,Xu Z,Zhang L,Li S,Wang S,Yang H,Liu X,Zeng D,Liu Q,Qian Q(2020)MYB61is regulated by GRF4 and promotes nitrogen utilization and biomassproduction in rice.Nature communications 11:5219;

[0010] Katiyar A,Smita S,Lenka SK,Rajwanshi R,Chinnusamy V,Bansal KC(2012)Genome-wide classification and expression analysis of MYB transcriptionfactor families in rice and Arabidopsis.BMC genomics 13:544;

[0011] Li S,Tian Y,Wu K,Ye Y,Yu J,Zhang J,Liu Q,Hu M,Li H,Tong Y(2018)Modulating plant growth–metabolism coordination for sustainableagriculture.Nature 560:595-600;

[0012] Liu Y,Wang H,Jiang Z,Wang W,Xu R,Wang Q,Zhang Z,Li A,Liang Y,Ou S(2021)Genomic basis of geographical adaptation to soil nitrogen inrice.Nature 590:600-605;

[0013] Wang D,Xu T,Yin Z,Wu W,Geng H,Li L,Yang M,Cai H,Lian X(2020)Overexpression of OsMYB305 in rice enhances the nitrogen uptake under low-nitrogen condition.Frontiers in plant science 11:369;

[0014] Wen Y,Wu K,Chai B,Fang Y,Hu P,Tan Y,Wang Y,Wu H,Wang J,Zhu L(2023)NLG1,encoding a mitochondrial membrane protein,controls leaf and graindevelopment in rice.BMC Plant Biology 23:418;

[0015] Xiong M, Chu L, Li Q, Yu J, Yang Y, Zhou P, Zhou Y, Zhang C, Fan X, Zhao D (2021) Brassinosteroid and gibberellin coordinate rice seed germination and embryo growth by regulating glutelin mobilization. The Crop Journal 9:1039-1048. Summary of the invention

[0016] The technical problem to be solved by the present invention is to provide a rice nitrogen response transcription factor gene OsNRTF2 and its encoded protein and application.

[0017] In order to solve the above technical problems, the present invention provides a rice nitrogen response transcription factor gene OsNRTF2, and the nucleotide sequence of the OsNRTF2 gene is shown in Seq ID No.1.

[0018] As an improvement of the OsNRTF2 gene of the present invention: the cDNA and CDS nucleotide sequences of the gene OsNRTF2 are shown in Seq ID No. 2 and Seq ID No. 3, respectively.

[0019] The present invention also provides a protein encoded by the gene OsNRTF2, and its amino acid sequence is shown in Seq ID No.4.

[0020] The present invention also provides a knockout vector containing the above gene OsNRTF2: pC1300-Cas9-SK5G is used as a basic vector, and the editing target site sequence CGGCGTACCCTGGTCCGAA or CCGGGTCCTGGGACGATAA located in the exon of the gene OsNRTF2 is inserted between the AarI-AarI restriction sites of the basic vector.

[0021] The present invention also provides an overexpression vector containing the above gene OsNRTF2, which is obtained by taking pUbi-GFP as a basic vector and inserting the CDS sequence described in Seq ID No.3 (excluding the stop codon) between the SacI restriction sites of the basic vector.

[0022] The present invention also provides host cells containing the above gene, including Escherichia coli cells and Agrobacterium cells.

[0023] The present invention also provides the use of the gene OsNRTF2, which is at least any one of the following: regulating rice yield and nitrogen utilization efficiency.

[0024] As an improvement on the use of the gene OsNRTF2 of the present invention, the present invention also provides a method for regulating rice yield and nitrogen utilization efficiency: transforming a knockout vector or an overexpression vector into monocotyledonous plant (eg, rice) cells, and then cultivating the transformed monocotyledonous plant cells into plants.

[0025] As an improvement of the method for regulating rice yield and nitrogen utilization efficiency of the present invention:

[0026] The knockout vector pC1300-Cas9-SK5G-OsNRTF2 was transformed into rice cells to obtain knockout mutants, and rice yield and nitrogen use efficiency were significantly increased;

[0027] When the overexpression vector pUbi-OsNRTF2-GFP was transformed into rice cells, the yield and nitrogen utilization efficiency of transgenic rice were significantly reduced.

[0028] The technical solution provided by the present invention is as follows:

[0029] The rice nitrogen response transcription factor gene OsNRTF2 of the present invention has the sequences shown in (a) and (b):

[0030] (a) The genomic nucleotide sequence shown in Seq ID No.1;

[0031] (b) cDNA and CDS nucleotide sequences shown in Seq ID No. 2 and Seq ID No. 3;

[0032] The Nipponbare genome nucleotide sequence shown in Seq ID No. 1 has a total of 1393 nucleotides, the Nipponbare cDNA sequence shown in Seq ID No. 2 has a total of 1143 nucleotides, and the Nipponbare CDS sequence shown in Seq ID No. 3 has a total of 522 nucleotides (including the terminator TGA).

[0033] Another object of the present invention is to provide a protein encoded by the above gene, having the sequence shown in (A):

[0034] (A) Amino acid sequence shown in Seq ID No.4;

[0035] The protein shown in Seq ID No. 4 belongs to the MYB transcription factor and has 173 amino acids.

[0036] The present invention also aims to provide a knockout and overexpression vector containing the rice nitrogen response transcription factor gene OsNRTF2. Figure 2pC1300-Cas9-SK5G shown in A, after gene editing, caused a single base deletion mutation, which resulted in premature termination of OsNRTF2 protein translation in OsNRTF2-KO1 and OsNRTF2-KO2 plants, as shown in Seq ID No.5 and Seq ID No.6, resulting in the loss of OsNRTF2-KO1 and OsNRTF2-KO2 proteins; the overexpression vector is Figure 2 B shows pUbi-GFP, which can improve the expression of OsNRTF2. The present invention also aims to provide a host cell containing the rice gene OsNRTF2, wherein the host cell is an Escherichia coli cell, an Agrobacterium cell or a plant cell.

[0037] The purpose of the present invention also includes using the above-mentioned OsNRTF2 gene to regulate rice yield and nitrogen utilization efficiency, including transforming rice cells with knockout and overexpression vectors constructed with the gene having the nucleotide sequence shown by the above-mentioned OsNRTF2, and then cultivating the transformed rice cells into plants.

[0038] The specific technical steps for implementing the present invention are as follows:

[0039] 1. Screening of candidate genes

[0040] Under hydroponic conditions, seedlings of conventional indica rice varieties Yuefeng B, Xiangzao 143, Zhenguiai 1, and Zaogui 1 were treated with different nitrogen (NH4NO3) concentrations for one week, and samples of the aboveground and underground parts of the rice seedlings were selected for RNA-seq sequencing to screen genes that responded to nitrogen gradient regulation in the four indica rice varieties. The results showed that the gene expression of OsNRTF2 in the underground and aboveground parts of the four indica rice varieties showed a downward trend with the increase of nitrogen concentration ( Figure 1 ), suggesting that OsNRTF2 may regulate nitrogen utilization in rice.

[0041] 2. Functional analysis of OsNRTF2 gene

[0042] Through transgenic technology, the present invention obtains OsNRTF2 gene knockout and overexpression plants ( Figure 2 Compared with the wild-type Nipponbare (WT), the yield per plant and nitrogen use efficiency of the two knockout lines OsNRTF2-KO1 and OsNRTF2-KO2 were significantly improved ( Figure 3 ), the yield per plant and nitrogen use efficiency of the two overexpression lines OsNRTF2-OE1 and OsNRTF2-OE2 were significantly reduced. This result proves that OsNRTF2 negatively regulates rice yield and nitrogen use efficiency.

[0043] The present invention provides the use of gene editing to knock out or negatively regulate the OsNRTF2 gene in improving one or more of crop yield and nitrogen use efficiency. The rice yield and nitrogen use efficiency of the gene editing knockout strains were significantly increased. The present invention provides important guidance for the cultivation of new nitrogen-efficient rice varieties, which is of great significance for ensuring food security.

[0044] It should be emphasized that there are hundreds of MYB-type transcription factors in rice. The protein sequence identities of OsNRTF2 of the present invention and the currently existing nitrogen utilization-related MYB transcription factors MYB61 and MYB305 are only 15.2% and 18.6%, respectively. In addition, unlike MYB61 and MYB305 which positively regulate nitrogen utilization, OsNRTF2 negatively regulates rice yield and nitrogen utilization rate. Therefore, the participation of MYB61 and MYB305 in nitrogen utilization regulation cannot provide technical inspiration for the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] The specific implementation modes of the present invention are further described in detail below with reference to the accompanying drawings.

[0046] Figure 1 The response pattern of OsNRTF2 gene expression in four indica rice varieties to NH4NO3 gradient treatments.

[0047] Figure 2 Schematic diagram of vector and transgenic molecular identification. (A) pC1300-Cas9-SK5G knockout vector; (B) pUbi-GFP overexpression vector; (C) Mutation of OsNRTF2-KO1 and OsNRTF2-KO2 knockout plants in the editing target site sequence; (D) Relative expression of OsNRTF2 gene in wild-type Nipponbare (WT) and overexpression lines (OsNRTF2-OE1 and OsNRTF2-OE2). Data are expressed as mean ± standard deviation (SD).

[0048] Figure 3 The yield per plant (A) and agronomic nitrogen use efficiency (B) of wild-type Nipponbare (WT), OsNRTF2 knockout mutants (OsNRTF2-KO1 and OsNRTF2-KO2) and overexpression plants (OsNRTF2-OE1 and OsNRTF2-OE2) are shown. Data are expressed as mean ± standard error (SEM). * indicates that there is a significant difference at the P < 0.05 level in the t-test, and ** indicates that there is a significant difference at the P < 0.01 level in the t-test. DETAILED DESCRIPTION

[0049] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0050] Example 1: Candidate gene identification

[0051] 1. Rice material

[0052] Conventional indica rice varieties include Yuefeng B, Xiangzao 143, Zhenguiai 1 and Zaogui 1.

[0053] The seeds of the above varieties were thoroughly washed with deionized water and soaked at 30°C for 36 hours; the seeds were wrapped with moistened paper towels, placed in ziplock bags, and germinated at 37°C in the dark for 24 hours; seeds with relatively consistent germination potential were selected and placed in a 96-well PCR plate with a hollow bottom, cultured in 1 / 2Yoshida hydroponic nutrient solution (i.e., Yoshida rice nutrient solution) for 2 days, and then transferred to complete Yoshida hydroponic nutrient solution for 7 days; the nitrogen content of 1.43mM NH4NO3 in complete Yoshida hydroponic nutrient solution was used as the standard, and 0N (0mM NH4NO3), 0.1N (0.143mM NH4NO3), 1N (1.43mM The rice seedlings were transferred to modified Yoshida hydroponic nutrient solution with different nitrogen concentrations for 7 days. For each variety and each nitrogen level treatment, 12 seedlings were randomly selected from underground and aboveground parts to extract total RNA for RNA-seq sequencing. During the entire culture process, the pH value of the nutrient solution was maintained at around 5.8, and the nutrient solution was replaced every two days.

[0054] 2. RNA-seq sequencing and candidate gene screening

[0055] High-throughput RNA-seq sequencing was performed using the Illumina NovaSeq platform of Personalbio (http: / / www.personalbio.cn). Clean reads were aligned with the Minghui 63 reference genome (MH63RS, http: / / rice.hzau.edu.cn / rice_rs2 / ) using HISAT2 software. Gene expression was quantified and normalized using HTSeq software and expressed as fragments per kilo bases per million fragments (FPKM). Based on gene expression values, genes that responded to nitrogen gradient regulation in all four indica rice varieties were screened. The results showed that the gene expression of OsNRTF2 in both the underground and aboveground parts of the four indica rice varieties showed a downward trend with increasing nitrogen concentration ( Figure 1 ).

[0056] Example 2: Plant transformation and functional analysis

[0057] 1. Obtaining OsNRTF2 gene knockout mutants

[0058] 1. OsNRTF2 was knocked out using the pC1300-Cas9-SK5G gene editing vector provided and modified by Wang Kejian's research group at the Chinese Academy of Rice Research. The CGGCGTACCCTGGTCCGAA and CCGGGTCCTGGGACGATAA sequences on the first exon of the OsNRTF2 gene were selected as editing target sites ( Figure 2 A). The primer sequences related to vector construction are as follows: Target site 1 forward primer OsNRTF2-sgRNA1-F: GGCATTATCGTCCCAGGACCCGG

[0059] Target site 1 reverse primer OsNRTF2-sgRNA1-R: AAACCCGGGTCCTGGGACGATAA

[0060] Target site 2 forward primer OsNRTF2-sgRNA2-F: GGCATTCGGACCAGGGTACGCCG

[0061] Target site 2 reverse primer OsNRTF2-sgRNA2-R: AAACCGGCGTACCCTGGTCCGAA

[0062] Target site identification primer pC1300-F: ACACTTTATGCTTCCGGCTC

[0063] Description: The pC1300-Cas9-SK5G gene editing vector is modified from pC1300-Cas9 (Barman 2021; Xiong, et al. 2021). The fragment of the original intermediate vector SK-gRNA containing the gRNA expression cassette after KpnI-BglII double digestion is pre-connected to the KpnI-BamHI double digested pC1300-Cas9 vector. This is the prior art.

[0064] 2. Steps for constructing OsNRTF2 gene knockout vector:

[0065] Preparation of target linker 1: 20 μl of each of 100 μM OsNRTF2-sgRNA1-F and OsNRTF2-sgRNA1-R primers were mixed, incubated in a 100°C water bath for 5 minutes, and cooled to room temperature to form primer dimers.

[0066] Preparation of target linker 2: 20 μl of each of the 100 μM OsNRTF2-sgRNA2-F and OsNRTF2-sgRNA2-R primers were mixed, incubated in a 100°C water bath for 5 minutes, and cooled to room temperature to form primer dimers.

[0067] Linearization of expression vector: The pC1300-Cas9-SK5G gene editing vector was digested with restriction endonuclease AarI (Ferment). Reaction system: 1.5 μg pC1300-Cas9-SK5G plasmid; 10×AarI buffer 5 μL; 50×oligonucleotide 1 μL; AarI restriction endonuclease 1 μL; ddH2O to 50 μL. Digest at 37°C for 6 hours, and purify the digested product with a kit.

[0068] Target adapter 1 or target adapter 2 is connected to the expression vector: Use T4 ligase (NEB) to connect the prepared target adapter 1 or target adapter 2 to the linearized pC1300-Cas9-SK5G gene editing vector. Ligation reaction system: linearized pC1300-Cas9-SK5G 20ng; 7μL target adapter 1 / target adapter 2; 1μL 10×T4 ligase buffer; 0.5μL T4 ligase; ddH2O is added to 10μL. Ligation is carried out at 16℃ for 1 hour.

[0069] The above ligation reaction product was transformed into E. coli DH5α competent cells, and a single colony was picked for sequencing.

[0070] Primer pC1300-F was used to sequence and screen single colonies containing the OsNRTF2 gene-specific target sequence, and the plasmid was extracted to obtain the recombinant knockout vector pC1300-Cas9-SK5G-OsNRTF2.

[0071] 3. The pC1300-Cas9-SK5G-OsNRTF2 vector containing the OsNRTF2-specific target site was transformed into the rice variety Nipponbare using the Agrobacterium-mediated rice callus infection method. Using the transgenic plant DNA as a template, the sequences at both ends of the OsNRTF2 target site were amplified by PCR using knockout identification primers and then sequenced for identification.

[0072] The knockout identification primer sequences are as follows:

[0073] OsNRTF2-CRISPR-F: CGGCATGGATTTGTACGGC

[0074] OsNRTF2-CRISPR-R:GCTGGGAAGAGTTTGTTGGTTT

[0075] The CTAB method was used to extract leaf DNA from the Nipponbare wild-type and gene-edited rice lines.

[0076] PCR reaction system for identification of mutant transgenic plants: 25 μL 2×Rapid Taq Master Mix (Nanjing Novozymes); 2 μL transgenic plant leaf DNA; 1 μL each of 10 μM primers OsNRTF2-CRISPR-F and OsNRTF2-CRISPR-R; 21 μL ddH2O.

[0077] PCR reaction program: (1) 95°C, 3 minutes; (2) 98°C, 15 seconds; (3) 58°C, 15 seconds; (4) 72°C, 10 seconds; (5) 72°C, 5 minutes; steps (2)-(4) were repeated for 38 cycles.

[0078] By comparing with the Nipponbare wild type Seq ID No.1, the OsNRTF2 gene knockout mutants were obtained. The obtained gene knockout mutants OsNRTF2-KO1 and OsNRTF2-KO2 had deletion mutations ( Figure 2 C), the amino acid sequences of OsNRTF2 in the knockout mutants of OsNRTF2-KO1 and OsNRTF2-KO2 are shown in Seq ID No. 5 and Seq ID No. 6, respectively.

[0079] 2. Obtaining OsNRTF2 gene overexpression strains

[0080] 1. Total RNA extraction and RNA reverse transcription

[0081] Take 50-100 mg of Nipponbare rice seedling leaf samples, freeze them in liquid nitrogen and grind them into powder. Use the Novozymes FastPure Universal Plant Total RNA Isolation Kit to extract total RNA according to the operating instructions.

[0082] Using MonaBio MonScript TM RTllI Super Mix with dsDNase (Two-Step) kit was used to perform RNA reverse transcription according to the operating instructions to obtain the first-strand cDNA.

[0083] 2. Acquisition of target genes

[0084] Using the cDNA synthesized by reverse transcription as a template, the CDS sequence of the Nipponbare OsNRTF2 gene (Seq ID No. 3, with the stop codon removed) was PCR amplified using the high success rate PCR enzyme KOD FX (TOYOBO), and the target expression vector recombinant linker was added. The primer sequences involved are as follows:

[0085] OsNRTF2-F:gtgttatacttctgcaggagctcATGGATTTGTACGGCCGG

[0086] OsNRTF2-R:catggatccggtaccgagctcAGGGGTGGTGATGTCATG

[0087] PCR reaction system: 25μL 2x PCR buffer for KOD FX; 10μL 2mM dNTPs; 1μL cDNA template; 1.5μL each of 10μM primers OsNRTF2-F and OsNRTF2-R; 1μL KOD FX; 10μL ddH2O.

[0088] PCR reaction program: (1) 94°C, 2 minutes; (2) 98°C, 10 seconds; (3) 58°C, 30 seconds; (4) 68°C, 40 seconds; (5) 68°C, 5 minutes; steps (2)-(4) were repeated for 35 cycles.

[0089] The PCR product was purified using the Easy Gel Extraction & Clean-up Kit (EasySign).

[0090] 3. Construction of overexpression recombinant vector

[0091] Linearization of expression vector: pUbi-GFP expression vector (Wen, et al. 2023) was digested with restriction endonuclease SacI (NEB). Reaction system: 1.5 μg pUbi-GFP plasmid; 10×rCutSmart TM Buffer 5μl; SacI restriction endonuclease 1μL; ddH2O to 50μL. Digest at 37℃ for 6 hours, and purify the digestion product with a kit.

[0092] Recombination ligation of the CDS sequence of the OsNRTF2 gene with the expression vector: Using the ClonExpress II One Step Cloning Kit of Novagen, the OsNRTF2 CDS (without the stop codon) with the recombination linker was recombined and ligated with the linearized pUbi-GFP expression vector.

[0093] Recombination and ligation reaction system: linearized pUbi-GFP 30ng; OsNRTF2 CDS with recombination linker (SeqID No.3, without stop codon) 100ng; 5×CE II Buffer 2μL; Exnase II 1μL; ddH2O to 10μL. React at 37℃ for 30 minutes and immediately cool on ice.

[0094] The above-mentioned recombination ligation reaction product was transformed into Escherichia coli DH5α competent cells, a single colony was picked for sequencing, and the correctly sequenced plasmid was extracted to obtain the recombinant overexpression vector pUbi-OsNRTF2-GFP.

[0095] 4. The recombinant overexpression vector pUbi-OsNRTF2-GFP was transformed into the rice variety Nipponbare using the Agrobacterium-mediated rice callus infection method. The cDNA of the leaves of the surviving positive transgenic plants screened with conventional hygromycin was used as a template, and the OsNRTF2 overexpressing plants were screened by qRT-PCR using the Novagen Taq Pro Universal SYBR qPCR Master Mix kit.

[0096] The primer sequences for qRT-PCR identification are as follows:

[0097] qOsNRTF2-F:GGGTCCTGGGACGATAACGA

[0098] qOsNRTF2-R:CCGTACCTGTCCAACCCCTC

[0099] The sequences of the internal reference primers for qRT-PCR are as follows:

[0100] qActin-F:ATCAATCCTTGCATCTCTGAGC

[0101] qActin-R: TAGAAGCACTTCCTGTGGACGAqRT-PCR reaction system: 7.5μL 2×Taq ProUniversal SYBR qPCR Master Mix; 3μL 10-fold diluted cDNA template; 0.3μL each of 10μM forward and reverse primers; 3.9μL ddH2O.

[0102] qRT-PCR reaction procedure: (1) 95°C, 2 min; (2) 95°C, 10 sec; (3) 60°C, 15 sec; steps (2)-(3) were repeated for 42 cycles.

[0103] According to 2 -ΔCT The relative expression levels of the target gene OsNRTF2 in wild-type and overexpression plants were calculated and compared by this method. Figure 2 The relative expression levels of OsNRTF2 in the OsNRTF2-OE1 and OsNRTF2-OE2 overexpression lines shown in D were 11.8 and 13.8 times that of the wild-type Nipponbare, respectively.

[0104] 3. Investigation of field plant yield and agronomic nitrogen use efficiency of OsNRTF2 knockout mutants and overexpression lines

[0105] The plant yield of OsNRTF2 knockout mutants and overexpression strains in the transgenic nursery in Fuyang, Hangzhou was measured. Agronomic nitrogen use efficiency refers to the ratio of plant yield to nitrogen application per unit area (Chen, et al. 2016). The results showed that the plant yield and agronomic nitrogen use efficiency of knockout mutants OsNRTF2-KO1 and OsNRTF2-KO2 increased significantly ( Figure 3 A and 3B), which increased by 14.8% and 31.6% respectively compared with the wild-type Nipponbare. In contrast, the yield per plant and agronomic nitrogen use efficiency of the OsNRTF2-OE1 and OsNRTF2-OE2 overexpression lines decreased significantly ( Figure 3 A and 3B), which were reduced by 26.2% and 38.3% respectively compared with the wild-type Nipponbare. Combined with the fact that the gene expression of OsNRTF2 was inhibited by nitrogen, the above results suggest that OsNRTF2 negatively regulates nitrogen use efficiency and yield.

[0106] Finally, it should be noted that the above examples are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

Claims

1. Rice nitrogen response transcription factor gene OsNRTF2, characterized by: The nucleotide sequence of the OsNRTF2 gene is shown in SeqID No.

1.

2. The rice nitrogen response transcription factor gene OsNRTF2 according to claim 1, characterized in that: The cDNA and CDS nucleotide sequences of the gene OsNRTF2 are shown in Seq ID No. 2 and Seq ID No. 3, respectively.

3. The protein encoded by the rice nitrogen response transcription factor gene OsNRTF2 according to claim 1 or 2, characterized in that: Its amino acid sequence is shown in Seq ID No.

4.

4. The knockout vector and overexpression vector of the gene OsNRTF2 according to claim 1 or 2.

5. The knockout vector of gene OsNRTF2 according to claim 4, characterized in that: Using pC1300-Cas9-SK5G as the basic vector, the editing target site sequence CGGCGTACCCTGGTCCGAA or CCGGGTCCTGGGACGATAA located in the exon of the gene OsNRTF2 was inserted between the AarI-AarI restriction sites of the basic vector.

6. The overexpression vector of gene OsNRTF2 according to claim 4, characterized in that: Using pUbi-GFP as the basic vector, the CDS sequence described in Seq ID No. 3 was inserted between the SacI restriction sites of the basic vector.

7. The use of the gene OsNRTF2 according to claim 1 or 2, characterized in that At least any one of the following: regulating rice yield and nitrogen use efficiency.

8. A method for regulating rice yield and nitrogen utilization efficiency, characterized in that: Monocotyledonous plant cells are transformed using knockout vectors and overexpression vectors, and the transformed monocotyledonous plant cells are then cultivated into plants.

9. The method according to claim 8, characterized in that: The knockout vector pC1300-Cas9-SK5G-OsNRTF2 was transformed into rice cells to obtain knockout mutants, and the rice yield and nitrogen utilization efficiency were increased; the overexpression vector pUbi-OsNRTF2-GFP was transformed into rice cells, and the yield and nitrogen utilization efficiency of transgenic rice were reduced.

10. The method according to claim 9, characterized in that: The amino acid sequences of OsNRTF2 in OsNRTF2-KO1 and OsNRTF2-KO2 plants obtained by knockout vector pC1300-Cas9-SK5G-OsNRTF2 are shown in Seq ID No. 5 and Seq ID No. 6, respectively.

Images