Sugarcane ScHAT1 gene, protein and application

Abstract

The invention provides a sugarcane ScHAT1 gene, a protein and application, belongs to the technical field of biology, and particularly discloses application of the sugarcane ScHAT1 gene in disease resistance, salt resistance and drought resistance. According to the invention, the biological stress and abiotic stress response of the ScHAT1 are preliminarily explored, and a solid foundation is laid for deeply researching the function and the action mechanism of the gene in the pathogenic bacteria stress and abiotic stress response process of the sugarcane.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, relates to plant transgenic biotechnology breeding, and particularly relates to a sugarcane ScHAT1 Genes, proteins and applications. Background Art

[0002] sugar cane( Saccharum spp. ) is one of the most important sugar crops in the world. It belongs to the monocotyledonous grass family C4 plant and is widely used in the production of sugar, ethanol, biofuels and fiber products. The sugarcane industry is not only related to the national sugar security, but also has an important impact on the development of agricultural economy. However, sugarcane production faces a variety of disease threats, among which the whip powder fungus ( Sporisorium scitamineum ) is one of the most destructive diseases in the world. The disease can seriously reduce sugarcane yield and sugar content, shorten the perennial root period, increase production costs, and even lead to crop failure in severe infection, becoming the main bottleneck restricting the development of the sugarcane industry. Since the planting of the Taiwan Province of China variety New Taiwan Sugar No. 22, which is highly susceptible to smut, the prevalence of smut has intensified in my country's main sugarcane producing areas. In recent years, the main cultivated varieties Guitang 42 and Liucheng 05-136 have also shown high susceptibility to the disease, making the need to breed disease-resistant varieties more urgent. Breeding of disease-resistant varieties is the most cost-effective strategy to control smut, and the discovery and identification of disease-resistant related proteins and genes is the key to achieving this goal.

[0003] Post-translational modification (PTM) of proteins is widely involved in biological processes such as gene expression regulation, DNA damage repair, cell division and signal transduction. Among them, acetylation modification is an important PTM that directly affects chromatin structure and gene transcription. In eukaryotes, histone acetyltransferase (HAT) and histone deacetylase (HDAC) catalyze acetylation and deacetylation reactions, respectively. Histone acetylation reduces its positive charge, weakens its binding force with DNA, and causes nucleosome disassembly, thereby promoting gene transcription, which is essential for biological growth and development. HAT plays a key regulatory role in plant response to abiotic stresses (such as light, temperature, salt, etc.) and biological diseases. For example, in Arabidopsis, AtHAC1 regulates the upstream factors of FloweringLocus C (FLC) through epigenetic modification, thereby regulating the flowering process, and its loss can lead to developmental defects such as delayed flowering. In addition, GCN5 maintains the position of root stem cells by regulating the expression of PLETHORA (PLT) genes and promotes the division and proliferation of root transitional amplification cells to maintain the normal development of root meristem. OsHAG702 , OsHAG703and OsHAM701 The expression of HAT family members in wheat TaHAG1 Through TaNACL Interaction, regulation TaG1 and TaPSBR1 to enhance heat tolerance and improve tolerance to heat stress. TaHAG1 By regulating transduction genes TaPAD4 The above studies show that HAT plays an important regulatory role in plant response to abiotic stress (such as light, temperature, salt, etc.) and biological diseases. Summary of the invention

[0004] In view of the above problems, the present invention provides a sugarcane ScHAT1 Genes, proteins and applications.

[0005] A kind of sugar cane ScHAT1 Gene, ScHAT1 The coding sequence of the gene ScHAT1 The open reading frames of the genes are all SEQ ID NO: 1, and their open reading frames (ORF) are 1332 bp; ScHAT1 The gene coding sequence and its upstream and downstream sequences are shown in SEQ ID NO: 3; ScHAT1 The gene is associated with at least one of disease resistance, salt resistance and drought resistance.

[0006] A ScHAT1 protein with disease resistance, wherein the ScHAT1 protein is the above ScHAT1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO:2.

[0007] A primer pair, the primer pair is used for PCR amplification of the above ScHAT1 Gene, the primer pair comprises: ScHAT1 -F:5'- GGTCCCACAAGTCATCCG -3'; ScHAT1 -R:5'- GGTTATGGTTCTTTCGCTTT -3'; Specifically, the PCR amplification is performed using sugarcane cDNA as a template; ScHAT1 The cDNA sequence of the gene is shown in SEQ ID NO: 4; Among them, the reaction system of PCR amplification is:

[0008] The reaction procedure for PCR amplification is: .

[0009] A kind of ScHAT1 A plasmid containing a gene ScHAT1 The plasmid of the gene was constructed using the above ScHAT1 The gene is obtained by connecting it to a cloning vector; The inclusion ScHAT1 The plasmid of the gene is pEASY-Blunt Zero- ScHAT1 Plasmid.

[0010] A kind of ScHAT1 A recombinant vector of a gene, comprising ScHAT1 The recombinant vector of the gene is a ScHAT1 The PCR amplification product of the gene or ScHAT1 The plasmid of the gene was connected with pDONR-207 vector, subcellular localization vector pFAST-R05-GFP, pGBKT7 vector, plant expression vector pEarleyGate203 or prokaryotic vector pEZYHb to obtain; Said ScHAT1 The coding sequence of the gene is shown in SEQ ID NO:1.

[0011] A kind of ScHAT1 A strain comprising a gene ScHAT1 The strains containing the gene ScHAT1 Agrobacterium containing genes ScHAT1 Yeast containing genes or ScHAT1 Gene of Escherichia coli; The inclusion ScHAT1 The Agrobacterium tumefaciens containing the gene is ScHAT1 The recombinant vector of the gene is transformed into Agrobacterium to obtain; The method transformed into Agrobacterium comprises ScHAT1 The recombinant vector of the gene is a ScHAT1 The PCR amplification product of the gene or ScHAT1 The plasmid of the gene was connected with the pDONR-207 vector, the subcellular localization vector pFAST-R05-GFP or the plant expression vector pEarleyGate203 to obtain; The inclusion ScHAT1 The yeast containing the gene is used ScHAT1 The recombinant vector of the gene is transformed into yeast to obtain; The method transformed into yeast comprises ScHAT1 The recombinant vector of the gene is aScHAT1 The PCR amplification product of the gene or ScHAT1 The plasmid of the gene was connected with the pGBKT7 vector to obtain.

[0012] The inclusion ScHAT1 The Escherichia coli containing the gene is used ScHAT1 The recombinant vector of the gene or the above-mentioned ScHAT1 The plasmid of the gene was transformed into Escherichia coli to obtain; The said transformed into Escherichia coli comprises ScHAT1 The recombinant vector of the gene is a ScHAT1 The PCR amplification product of the gene or ScHAT1 The plasmid of the gene was connected with the prokaryotic expression vector pEZYHb to obtain.

[0013] One of the above ScHAT1 The application of genes in improving disease resistance is ScHAT1 The gene is used in sugarcane or tobacco to improve disease resistance; specifically, the application is to reduce ScHAT1 Gene expression to improve disease resistance.

[0014] One of the above ScHAT1 The application of genes in salt resistance and / or drought resistance is to ScHAT1 Genes are used in sugarcane to improve salt and / or drought resistance; specifically, the application is to overexpress in sugarcane ScHAT1 genes to improve salt and / or drought tolerance; The application is to ScHAT1 The gene is used in Escherichia coli to improve salt resistance and / or drought resistance; specifically, the application is to overexpress in Escherichia coli ScHAT1 Genes to improve salt and / or drought tolerance.

[0015] A method of breeding plants for disease resistance by reducing the ScHAT1 Gene expression levels to obtain disease-resistant sugarcane; By reducing tobacco ScHAT1 Gene expression levels to obtain tobacco with disease resistance; Said ScHAT1 The coding sequence of the gene is shown in SEQ ID NO:1.

[0016] A method for breeding salt and / or drought resistant plants by overexpressing sugarcane 7 ScHAT1 Gene expression level to obtain sugarcane with salt and / or drought resistance; By overexpressing Escherichia coli ScHAT1Gene expression levels to obtain Escherichia coli with salt and / or drought resistance; Said ScHAT1 The coding sequence of the gene is shown in SEQ ID NO:1.

[0017] A kind of sugarcane of the present invention ScHAT1 The beneficial effects of genes, proteins and applications are: HAT genes play an important role in the interaction between plants and pathogens. ScHAT1 A preliminary study was conducted on the response to biotic and abiotic stresses, laying a solid foundation for in-depth research on the function and mechanism of this gene in the process of sugarcane responding to pathogenic and abiotic stresses. The present invention is to treat sugarcane ScHAT1 Gene research helps to understand the disease resistance mechanism, salt resistance and drought resistance mechanism of sugarcane, and provides a theoretical basis and reference for inducing plants to have disease resistance, salt resistance and drought resistance using genetic engineering technology. The present invention comprises ScHAT1 Plant expression recombinant vector and containing ScHAT1 Gene-transfected Agrobacterium tumefaciens successfully ScHAT1 The gene was introduced into heterologous Nicotiana benthamiana and analyzed ScHAT1 The results showed that by reducing ScHAT1 Gene expression can improve disease resistance; therefore, the ScHAT1 The gene has important application value not only in improving the disease resistance of native sugarcane, but also in heterologous Nicotiana benthamiana. The present invention comprises ScHAT1 Genetic analysis of Escherichia coli ScHAT1 The salt and drought resistance functions of the gene in Escherichia coli; the results showed that overexpression ScHAT1 Can improve the salt stress and drought stress tolerance of Escherichia coli, that is, overexpression ScHAT1 Can improve salt resistance and drought resistance; therefore, the invention disclosed ScHAT1 Genes not only have important application value in improving disease resistance, but can also be used to improve salt resistance and drought resistance; The present invention is to treat sugarcane ScHAT1 Gene research found ScHAT1 The gene was expressed in different tissues of sugarcane, with the highest expression in sugarcane leaves, followed by sugarcane peel, indicating that ScHAT1 The gene is constitutively expressed in sugarcane. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 In Example 1 of the present invention ScHAT1Gene expression profiles; Figure 1 Figure A in ScHAT1 Figure 1 shows the expression level of genes in different tissues of sugarcane; Figure B shows the expression level of genes in resistant varieties (YT93-159) and susceptible varieties (Xintaitang 22) under the stress of smut fungus. ScHAT1 Gene expression change diagram; Figure C is ScHAT1 The expression diagram of genes under salicylic acid stress; Figure D is ScHAT1 Gene expression diagram under jasmonic acid stress; among them, the internal reference gene is GAPDH The Duncan new multiple range method was used to calculate the significant difference of the data (p-value < 0.05), and lowercase letters were used to represent the data. All data points are mean ± standard error (n = 3). Figure 2 is a diagram of the conserved domain of the ScHAT1 protein in Example 3 of the present invention; Figure 3 is a diagram comparing homologous sequences of the ScHAT1 protein in Example 3 of the present invention with those of other species; Figure 4 is a phylogenetic tree of the ScHAT1 protein in Example 3 of the present invention and homologous sequences in other species; Figure 5 The recombinant plasmid pDONR-207- ScHAT1 Carrier map; Figure 6 The recombinant plasmid pFAST-R05- ScHAT1 -GFP vector map; Figure 7 The subcellular localization of the ScHAT protein in Nicotiana benthamiana leaves in Example 3 of the present invention; Figure 8 The recombinant plasmid pGBKT7- ScHAT1 Carrier map; Figure 9 It is the sugarcane in Example 4 of the present invention ScHAT1 Analysis of gene transcription self-activation activity; the left picture shows the screening results on the SD / -Leu / -Trp with Agar screening plate; the right picture shows the screening results on the SD / -Ade / -His / -Leu / -Trp with Agar screening plate; Figure 10 -1 , 10 -2 , 10 -3 , 10 -4 Different concentrations of pGBKT7-Lam+pGADT7-T, pGBKT7-53+pGADT7-T and pGBKT7- ScHAT1+pGADT7; DDO represents leucine and tryptophan auxotrophic medium (i.e., SD / -Leu / -Trp with Agar medium); QDO represents leucine, tryptophan, histidine, and adenine auxotrophic medium (i.e., SD / -Ade / -His / -Leu / -Trp with Agar medium); Figure 10 The recombinant plasmid pEarleyGate203- ScHAT1 Carrier map; Figure 11 In Example 5 of the present invention ScHAT1 Transient expression profile of genes in Nicotiana benthamiana leaves; Figure 11 Figure A in the middle shows pEarleyGate 203- ScHAT1 Schematic diagram of the recombinant vector. Figure B shows the disease phenotype and DAB staining of N. benthamiana after inoculation with R. solanacearum for 0 and 8 days. Figure C shows the expression of 7 immune-related marker genes in tobacco after inoculation with R. solanacearum for 0 and 8 days. The internal reference gene is NbEF-1α Gene, all data points represent mean ± standard error (n = 3), lowercase letters indicate significant differences calculated using Duncan's new multiple range method (p-value < 0.05); Figure 12 The recombinant plasmid pEZYHb- ScHAT1 Carrier map; Figure 13 The prokaryotic expression of the ScHAT1 protein in Example 6 of the present invention and its plate stress verification under abiotic factor treatment; Figure 12 Figure A is the SDS-PAGE test result. In Figure A, M represents protein marker, 1 represents uninduced E. coli BL21 empty bacteria, 2 represents uninduced pEZYHb-BL21 empty bacteria, and 3 represents uninduced pEZYHb- ScHAT1 -BL21 recombinant strain, 4 to 7 represent pEZYHb-induced for 2, 4, 6, and 8 hours, respectively. ScHAT1 -BL21 recombinant strain, 8 represents the empty E. coli BL21 strain induced for 12 hours, 9 represents the empty pEZYHb-BL21 strain induced for 12 hours, 10; pEZYHb- ScHAT1 -BL21 recombinant strain; Figure B shows sugarcane under different abiotic stresses (NaCl and D-Mannitol) ScHAT1 Genes in stress tolerance in E. coli cells; Figure B shows 10 -3 , 10 -4 Indicates that the bacterial solution concentration is diluted by 10 -3 and 10 -4 Each concentration point was replicated 4 times. DETAILED DESCRIPTION

[0019] The technical solutions in the embodiments of the present invention are described clearly and completely below. In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention can also be implemented in other ways different from those described herein, and those skilled in the art can make similar generalizations without violating the connotation of the present invention, so the present invention is not limited by the specific embodiments disclosed below. The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

[0020] In addition, if no specific techniques or conditions are specified in the specific examples disclosed below, the techniques or conditions described in the literature in this field (for example, refer to "Molecular Cloning Experiment Guide" written by Sambrook et al., translated by Huang Peitang et al., third edition, Science Press) or the product instructions are used. If the manufacturer of the reagents used is not specified, they are all conventional products that can be purchased.

[0021] Plant materials: Smut-resistant sugarcane varieties (YT93-159), smut-susceptible sugarcane varieties (Xintaitang No. 22), and wild-type Nicotiana benthamiana were provided by Fujian Key Laboratory of Sugarcane Biology and Genetic Breeding, Ministry of Agriculture and Rural Affairs, Fujian Agriculture and Forestry University. Wild-type Nicotiana benthamiana (WT) was grown in an incubator at 25 °C with a light condition of 16 h / 8 h (light / dark).

[0022] Vectors: pEASY®-Blunt Zero, pDONR-207, pFAST-R05-GFP, pGADT7, pGBKT7, pEarleyGate203, and pEZYHb.

[0023] Strains: Escherichia coli strain DH5α, yeast strain Y2Hgold, Agrobacterium strain GV3101 and Escherichia coli strain BL21 (DE3).

[0024] Main reagents: High-fidelity enzyme (2×Phanta Flash Master Mix, #P510), blue universal dye qPCR detection kit (ChamQ Blue Universal SYBR qPCR Master Mix, #Q312), Hifair® Ⅲ1st Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus) (#11141ES60) and acetosyringone (Acetosyringone, AS, #60326ES03) were purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.; MagZolTM Reagent (#R4801-01), agarose gel DNA recovery kit (#D2110-03) and plasmid extraction kit (#P1001-03C) were purchased from Guangzhou Meiji Biotechnology Co., Ltd.; Gateway™ BP Clonase™ II enzyme mixture (#11789020) Gateway™ LR Clonase™ II enzyme mixture (#11791020), restriction enzymes FastDigestEcoRI (#FD0274) and FastDigest BamHI (#FD0054) were purchased from Thermo Fisher Scientific; 2-(N-morpholino)ethanesulfonic acid monohydrate (MES, #A610341) and magnesium chloride hexahydrate (MgCl2, #A610328) were purchased from Shanghai Bioengineering Co., Ltd.; SD / -Leu / -Trp with Agar (#PM2222), SD / -Leu / -Trp Broth (#PM2221), and SD / -Ade / -His / -Leu / -Trp with Agar (#PM2112) were purchased from Beijing Coolbo Technology Co., Ltd.; 3,3'-Diaminobenzidine tetrahydrochloride (3,3'-Diaminobenzidine Tetrahydrochloride, DAB, #D807420) was purchased from Shanghai MacLean Biochemical Technology Co., Ltd.

[0025] All primers involved in the present invention were designed using SnapGene and Primer Premier 5 software and sent to Sangon Biotech (Shanghai) Co., Ltd. for synthesis.

[0026] Example 1 ScHAT1 Gene expression pattern 1) Material handling Sugarcane (YT93-159 and New Taiwan Sugar No. 22) buds were inoculated with smut fungi according to the method of Su Yachun et al. in "Transcriptome and proteome research on sugarcane response to smut fungi infection and mining of resistance-related genes", and bud samples were collected 0 d, 1 d, 2 d, 3 d, 4 d and 5 d after inoculation. Specifically, 10-month-old healthy plants were selected from the field, cut into single bud segments, and placed in a 32°C incubator for germination. After the buds grew to 2-3 cm, buds with consistent growth were selected and inoculated with a mixed spore suspension of smut fungi (5×10 6 Each time point was set up with 3 biological replicates, and 3 sugarcane buds were taken from each replicate. The treated samples were quickly frozen in liquid nitrogen and stored in a -80℃ refrigerator for later use. ScHAT1 Detection of gene expression.

[0027] 2) RNA extraction and RT-qPCR analysis RNA was extracted from sugarcane and Nicotiana benthamiana plants using MagZolTM Reagent (#R4801-01), and then reverse transcribed and synthesized into cDNA according to the instructions of Hifair® Ⅲ 1st Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus) (#11141ES60) for use as a template for subsequent gene expression detection.

[0028] Designed with Primer Premier 5 software ScHAT1 Specific quantitative primers (primer pair: Q- ScHAT1 -F / R), and the internal reference gene of sugarcane was glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ), (Primer Pair: GAPDH -F / R), the internal reference gene of Nicotiana benthamiana is NbEF-1α (Primer pairs: NbEF-1α-F / R ) See Table 1 for details.

[0029] Table 1 Primers for RT-qPCR analysis

[0030] 3) Analysis of gene expression patterns Healthy plants of mature sugarcane cultivar New Taiwan Sugar No. 22 were selected, and five tissues including sugarcane buds, leaves, roots, pith and peel were taken. RNA was extracted and then cDNA was synthesized to detect the tissue specificity of the target gene.

[0031] Using sugarcane cDNA samples at different time points after SA and MeJA treatment as templates, the expression of target genes under hormone stress was detected with reference to the method of Wang et al. in "Identification and characterization of WAK gene family in saccharum and the negative roles of ScWAK1 under the pathogen stress".

[0032] The cDNA of sugarcane with different genotypes inoculated with Ustilago smut was used as template to detect the expression of target genes under the stress of Ustilago smut. GAPDH The gene expression was detected according to the instructions of the blue universal dye qPCR detection kit (ChamQ Blue UniversalSYBR qPCR Master Mix, #Q312). -ΔΔCt The data were processed using the method of GraphPad Prism 10 software.

[0033] The results of qRT-PCR analysis showed that ScHAT1 The relative expression level of the gene in the leaves of Xintaitang No. 22 was the highest, about 13.7 times that in the roots. The gene expression levels in the skin, pith, buds and roots were second, and the differences among the four were not significant (see Figure 1 Figure A), which shows ScHAT1 The gene was constitutively expressed in sugarcane Xintaitang 22. ScHAT1 The relative expression of the gene increased with the increase of infection time. At the seventh day of infection, its expression level was about 3.29 times that of the control. ScHAT1 The relative expression of the gene was downregulated after infection, and gradually recovered to the initial level and slightly increased until the late stage of infection (see Figure 1 This shows ScHAT1 The gene may play a negative regulatory role in the infection process of smut fungus, and its up-regulation promotes disease susceptibility. ScHAT1 The expression of the genes showed a similar pattern, first decreasing at 12 h, and then only 0.46 times the original level at 3 h after SA treatment, and then returning to the initial level at 24 h. This suggests that the gene may be inhibited by SA and JA (see Figure 1 Figure 3.2: Figure 3.3.

[0034] Example 2 ScHAT1 Gene cloning 1) Based on the genome annotation information of sugarcane cultivar R570, cloning primers were designed using SnapGene software ScHAT1 -F / R, see the table below.

[0035] Table 2 Cloning primers ScHAT1 -F / R

[0036] 2) Using sugarcane leaf cDNA as template, PCR amplification was performed according to the instructions of high-fidelity enzyme (2×Phanta Flash Master Mix, #P510). ScHAT1 The cDNA sequence of the gene is shown in SEQ ID NO:4.

[0037] Table 3 PCR reaction system

[0038] Table 4 PCR reaction procedure

[0039] The ligation system was incubated at 25°C for 15 min.

[0040] 3) Perform electrophoresis on the PCR product using 1.5% agarose gel and recover the target band (i.e. ScHAT1 gene); among which, ScHAT1 The coding sequence of the gene ScHAT1 The open reading frames of the genes are all SEQ ID NO: 1, and their open reading frames (ORF) are 1332 bp; ScHAT1 The gene coding sequence and its upstream and downstream sequences are shown in SEQ ID NO: 3 (PCR amplification primers were designed based on the upstream and downstream sequences). ScHAT1 -F / R); 4) Connect the recovered product to the cloning vector pEASY®-Blunt Zero. For the specific connection method, refer to the instructions of the pEASY®-Blunt Zero Cloning Kit; 5) Transform the ligation product into E. coli strain DH5α and spread on LB (Kan + 50 mg / L) plates; 6) Culture in a 37°C incubator overnight, pick the colonies on the plate, identify them by PCR, select the colonies with the correct bands, and send them to Fuzhou Shangya Biotechnology Co., Ltd. for sequencing; 7) Use a plasmid extraction kit to extract plasmids from the colonies that have been sequenced correctly. The resulting plasmid is pEASY-BluntZero- ScHAT1The plasmids were stored at -20°C for subsequent experiments.

[0041] Example 3 ScHAT1 Gene sequence analysis and subcellular localization studies 1) Bioinformatics analysis Using sugarcane leaf cDNA as template, we cloned ScHAT1 In order to explore the CDS sequence of the gene ScHAT1 To determine the biological function of a gene, we first analyze its sequence characteristics. ScHAT1 The ORF length of the gene is 1332bp, encoding 443 amino acids. The amino acid sequence of the ScHAT1 protein is shown in SEQ ID NO: 2. The molecular weight of the protein is 50.5kDa, and the isoelectric point is 7.21, which is speculated to be a neutral protein. In addition, the instability coefficient and average hydrophobicity of the protein are 38.37 and -0.578, respectively. The instability coefficient of the ScHAT1 protein is less than 40 and the average hydrophobicity is less than 0, so it is speculated that the protein is a stable hydrophilic protein. The subcellular localization prediction results show that ScHAT1 is located in the cell nucleus.

[0042] The domain structure of ScHAT1 protein was predicted using the NCBI Conserved Domain Search online website (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi). The homologous sequences of candidate interacting proteins in other species were retrieved using the BLAST tool on the NCBI website, and multiple sequence alignment was performed using DANMAN software. The subcellular localization of HAT proteins was predicted and analyzed using WoLF PSORT. The phylogenetic tree was constructed using Neighbor-Joining in MEGA11 software.

[0043] The results of the conserved domain analysis showed that the ScHAT1 protein has a PLN00104 domain at the position of 3-443aa (see Figure 2). The BLAST tool of NCBI retrieved that the amino acid sequence similarities of ScHAT1 with maize (Zea mays, NP_001105074.1), sorghum (Sorghum bicolor, XP_002463217.1), rice (Oryza brachyantha, XP_006657984.2), wheat (Triticum aestivum, XP_044455776.1), pineapple (Ananas comosus, XP_020100762.1) and Arabidopsis thaliana (Arabidopsis thaliana, NP_201266.1) were 99.77%, 99.1%, 96.88%, 94.58%, 97.69% and 89.12%, respectively (see Figure 3 ). The phylogenetic tree of ScHAT1 protein and the above 7 proteins was constructed, and the results showed that it was clustered into the same cluster as the genes of maize and sorghum (see Figure 4 ), indicating that they are more closely related and may have diverged later.

[0044] 2) Subcellular localization analysis Use Primer 5 software to design Gateway entry vector primers pDONR-207- ScHAT1 (See Table 5). ScHAT1 The plasmid was used as a template for PCR amplification and purification, and the BP reaction was performed ScHAT1 The gene was connected to the pDONR-207 vector and transformed into DH5α. The positive recombinant plasmid pDONR-207- ScHAT1 (See Figure 5 ). Then insert the entry vector pDONR-207- ScHAT1 The overexpression recombinant vector pFAST-R05- ScHAT1 -GFP (see Figure 6 The plant expression recombinant vector sequenced correctly by Fuzhou Shangya Biotechnology Co., Ltd. was transformed into Agrobacterium GV3101 for infection of Nicotiana benthamiana in the next step.

[0045] Table 5 List of Gateway entry vector primer sequences

[0046] Table 6 BP reaction system

[0047] The subcellular localization vector pFAST-R05-GFP (as a control group 35S::GFP) and the recombinant vector pFAST-R05- ScHAT1 -GFP (as the experimental group 35S:: ScHAT1 ::GFP) were transformed into Agrobacterium strain GV3101 and spread on LB resistance plates (spectinomycin 50 µg / mL and rifampicin 50 µg / mL). After culturing in a 28°C incubator for 2 days, single clones on the plate were picked and placed in 1 mL of LB liquid medium (spectinomycin 50 µg / mL and rifampicin 50 µg / mL) for overnight culture. 200 µL of the positive bacterial solution after PCR detection was selected and added to a new 10 mL of LB liquid medium (spectinomycin 50µg / mL and rifampicin 50 µg / mL), and cultured overnight at 28°C in a shaker at 250 rpm. The bacteria were collected by centrifugation, washed twice with infection solution (10 mM MES, 10 mM MgCl2, and 200µM acetosyringone), and then the bacterial solution OD was adjusted. 600 ≈0.6, and injected into the back of tobacco leaves with a 1 mL sterile syringe. After culturing at room temperature for 2 days, cut 1 cm 2 Slides were made from tobacco leaves and observed and photographed under a laser confocal microscope (Leica TCS SP8, Leica Microsystems (Shanghai) Trading Co., Ltd.).

[0048] The subcellular localization of ScHAT1 protein was observed using laser confocal microscopy. Figure 7 , the control group 35S::GFP (green fluorescent protein gene followed by ccdB No fluorescence was observed after Agrobacterium-mediated transformation and transient expression in Nicotiana benthamiana leaves, while in the experimental group 35S:: ScHAT1 ::GFP green fluorescence was observed in the nuclei of the lower epidermal cells of the leaves. Combined with the previous prediction results of the subcellular localization prediction program in WoLF PSORT, this result is consistent with the prediction results, indicating that the ScHAT1 protein is localized in the nucleus.

[0049] Example 4 Analysis of transcriptional autoactivation activity To detect ScHAT1 Whether it has transcriptional self-activation activity, ScHAT1 Constructed into vector pGBKT7 to form expression vector pGBKT7- ScHAT1 , the specific construction method is as follows: 1) Select EcoRI and BamHI restriction sites to linearize the pGBKT7 vector; 2) Design pGBKT7 vector adapter primers using SnapGene software ScHAT1 -F / R (see Table 7); 3) Using the pEASY-Blunt Zero- ScHAT1 The plasmid was used as a template, and the reaction system was set up according to the instructions of the non-ligase-dependent single-fragment one-step cloning kit (ClonExpress II One Step Cloning Kit, #C112-01) (see Table 8), and the reaction was carried out at 37°C for 30 min; 4) The ligation product obtained above was transformed into Escherichia coli DH5α and cultured on LB solid medium (kanamycin 50 mg / L) in a 37°C incubator overnight; 5) Pick monoclonal colonies for PCR detection and sequencing analysis (Fuzhou Shangya Biotechnology Co., Ltd.); 6) Extract the plasmid from the bacterial solution with the correct sequencing results according to the instructions of the plasmid extraction kit (#P1001-03C) to obtain the recombinant vector pGBKT7- ScHAT1 (See Figure 8 ).

[0050] Table 7 pGBKT7 vector linker primers pGBKT7- ScHAT1 Sequence List

[0051] Table 8 One-step cloning reaction system

[0052] The constructed recombinant vector pGBKT7- ScHAT1 The yeast strain Y2Hgold (as the experimental group) was co-transformed with the pGADT7 empty plasmid and plated on SD / -Leu / -Trp with Agar screening plates and cultured in a 28°C incubator for 3 days. Single clones were picked and cultured in SD / -Leu / -Trp Broth liquid medium at 28°C with a shaker at 250 rpm overnight. 10 µL of the bacterial solution was diluted in 90 µL of ddH2O and diluted tenfold in three gradients to obtain four gradients of yeast solution (10 -1 , 10 -2 , 10 -3 and 10 -4 ). Take 10 µL of each of the above bacterial solutions and drop them on SD / -Leu / -Trp with Agar medium and SD / -Ade / -His / -Leu / -Trp with Agar medium, invert and culture at 28°C for 3 days, and then observe the growth. Among them, the positive control is pGBKT7-53 and pGADT7-T co-transformed into the Y2HGold yeast strain, and the negative control is pGBKT7-Lamin and pGADT7-T co-transformed into the Y2HGold yeast strain.

[0053] SD / -Leu / -Trp with Agar medium formula: yeast nitrogen base (YNB) 6700 mg / L, glucose 20000 mg / L, adenine sulfate 40 mg / L, L-arginine hydrochloride 20 mg / L, L-aspartic acid 100 mg / L, L-glutamate 100 mg / L, L-histidine 20 mg / L, L-lysine 30 mg / L, L-methionine 20 mg / L, L-phenylalanine 50 mg / L, L-serine 375 mg / L, L-threonine 200 mg / L, L-tyrosine 30 mg / L, L-valine 150 mg / L, uracil 20 mg / L and agar 15 g / L.

[0054] SD / -Leu / -Trp Broth liquid medium formula: yeast nitrogen base (YNB) 6700 mg / L, glucose 20000 mg / L, adenine sulfate 40 mg / L, L-arginine hydrochloride 20 mg / L, L-aspartic acid 100 mg / L, L-glutamic acid 100 mg / L, L-histidine 20 mg / L, L-lysine 30 mg / L, L-methionine 20 mg / L, L-phenylalanine 50 mg / L, L-serine 375 mg / L, L-threonine 200 mg / L, L-tyrosine 30 mg / L, L-valine 150 mg / L and uracil 20 mg / L.

[0055] SD / -Ade / -His / -Leu / -Trp with Agar medium formula: yeast nitrogen base (YNB) 6700 mg / L, glucose 20000 mg / L, L-arginine hydrochloride 20 mg / L, L-aspartic acid 100 mg / L, L-glutamate 100 mg / L, L-lysine 30 mg / L, L-methionine 20 mg / L, L-phenylalanine 50 mg / L, L-serine 375 mg / L, L-threonine 200 mg / L, L-tyrosine 30 mg / L, L-valine 150 mg / L, uracil 20 mg / L and agar 15 g / L.

[0056] pGBKT7-53+pGADT7-T was used as the positive control, and pGBKT7-lamin+pGADT7-T was used as the negative control. ScHAT1 +pGADT7 were transformed into yeast strain Y2HGold, and all combinations grew normally on SD / -Leu / -Trp with Agar screening plates, indicating that they were successfully transformed into yeast strains (see Figure 9On the SD / -Ade / -His / -Leu / -Trp with Agar screening plate, only the colonies in the positive control group grew normally, while no colonies grew in the negative group or the experimental group (see Figure 9 The above results show that ScHAT1 It has no transcriptional autoactivation activity.

[0057] Example 5 ScHAT1 Genes that negatively regulate resistance to pathogens The fusion expression vector pEarleyGate203- was constructed using the Gateway vector construction method. ScHAT1 (See Figure 10 ), specifically: referring to the instructions of Gateway™ LR Clonase™ II enzyme mixture (#11791020), pDONR-207- ScHAT1 The plasmid was constructed into the plant expression vector pEarleyGate203 by LR reaction to obtain the recombinant plasmid pEarleyGate203- ScHAT1 The LR reaction system is shown in Table 9.

[0058] Table 9 LR reaction system

[0059] Furthermore, using the Agrobacterium-mediated tobacco transient expression method (the method is the same as that in step 2 of Example 3), the transient overexpression vector pEarleyGate203 (i.e., the control group 35S:00) and the fusion expression vector pEarleyGate203- ScHAT1 (ie experimental group 35S: ScHAT1 ) were transiently overexpressed in tobacco leaves, and then the transient overexpression vector pEarleyGate203 (i.e., 35S:00) and the fusion expression vector pEarleyGate203- ScHAT1 (i.e. 35S: ScHAT1 ) of Nicotiana benthamiana plants were inoculated with tobacco solanacearum. At 0d and 8d after inoculation, the tobacco leaves were phenotypically observed and DAB stained and photographed. The specific steps of DAB staining are as follows: dissolve DAB powder at a ratio of 1:1000 (DAB powder: sterile water), soak the tobacco leaves in the DAB aqueous solution, let stand for 8 h in the dark, then decolorize with anhydrous ethanol, and take photos. Extract RNA from tobacco leaves at 0d and 8d after inoculation with solanacearum and synthesize cDNA. Afterwards, detect the SA marker gene ( NbPR1- A / C )、JA synthesis related genes( NbLOX1 and NbPR1b )、ET marker gene(NbACO-like )、HR marker genes( NbHSR515 ) and ROS scavenging-related genes ( NbGST1 and NbCAT1 ) expression levels, and the detection primers are shown in Table 10.

[0060] Table 10 Detection primer list

[0061] Through the Agrobacterium-mediated transformation system, 35S:00 and 35S: ScHAT1 Transient overexpression in tobacco leaves. Two days after transient overexpression, tobacco solanacearum was inoculated to observe the phenotypic changes of tobacco leaves. Overexpression of 35S:: ScHAT1 The phenotype and DAB staining degree of ScHAT1 in leaves were not significantly different from those in the control group at 0 days after inoculation. ScHAT1 The leaves were wilted, wrinkled and whitened around the leaves, while the control group showed almost no symptoms. DAB staining results showed that 35S:: ScHAT1 The leaves were also significantly darker in color than the control leaves (see Figure 11 Figure A in the figure).

[0062] RT-qPCR analysis results showed (see Figure 11 Figure B), SA pathway-related genes in leaves of the control group at the time of disease onset NbPR-A / C , JA pathway related genes NbLOX1 and NbPR1b , ROS pathway-related genes NbGST1 and NbCAT1 , HR pathway related genes NbHSR515 and ET pathway-related genes NbACO-like Compared with 0d, the expression of NbPR-A / C , NbGST1 and NbCAT1 The gene expression levels were 3.92, 4.61, and 2.88 times that of 0d, respectively. ScHAT1 The expression of leaf-related genes is only related to ROS pathway genes NbGST1 and NbCAT1 Compared with 0d, there was an upregulation, and the upregulation degree was lower than that of the empty load. The remaining SA pathway-related genes NbPR-A / C , JA pathway related genes NbLOX1 and NbPR1b , HR pathway related genes NbHSR515 and ET pathway-related genes NbACO-like Compared with 0d, the expression of ScHAT1The gene may regulate through multiple pathways such as SA, JA, ROS, HR and ET, thereby enhancing the infection of pathogens to plants. ScHAT1 Gene expression can improve disease resistance.

[0063] Example 6 ScHAT1 Genes enhance host cell tolerance to abiotic stress The fusion expression vector pEZYHb- ScHAT1 (See Figure 12 ), specifically: referring to the instructions of Gateway™ LR Clonase™ II enzyme mixture (#11791020), pDONR-207- ScHAT1 The plasmid was constructed into the prokaryotic vector pEZYHb by LR reaction to obtain the recombinant plasmid pEZYHb- ScHAT1 The LR reaction system is shown in Table 10. Then, pEZYHb- ScHAT1 The plasmid and pEZYHb empty vector plasmid were transformed into Escherichia coli BL21 (TIANGEN, Beijing, China).

[0064] Take pEZYHb- ScHAT1 -BL21 bacterial solution, pEZYHb-BL21 bacterial solution (negative control), and BL21 bacterial solution (blank control) were propagated in 20 mL centrifuge tubes, and the OD 600 At 0.6-0.7, 0.7 mM isopropyl-beta-D-thiogalactopyranoside (IPTG) was added, and protein production was induced at 16°C, 28°C, and 37°C under a shaker. Samples were taken at 0, 2, 4, 6, 8, 10, and 12 hours; the negative control and blank control were sampled once at 0 and 12 hours. All bacterial samples were centrifuged, added with loading buffer, and boiled at 100°C. After running on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), staining with Coomassie brilliant blue, and decolorizing, the target protein was observed to be induced.

[0065] After the target protein was induced, the spot experiment was used to explore the effects of salt stress and drought stress on the ScHAT1 Stress response of genes in Escherichia coli. ScHAT1 -BL21 bacterial solution and pEZYHb-BL21 bacterial solution (negative control) were expanded to OD 600When the concentration of the culture medium is about 0.6, add 0.7mM IPTG and incubate at 37℃ and 200rpm in a shaker. After induction for 6h, dilute the culture medium with LB medium (containing ampicillin resistance) to the same concentration, and then continue to dilute to 10 -3 , 10 -4 , take 10 μL of bacterial solution and spot it on LB plates with different concentrations of NaCl and D-Mannitol, and culture it at 37℃ overnight.

[0066] Table 11 LR reaction system

[0067] The successfully constructed prokaryotic expression vector pEZYHb- ScHAT1 Transformed into E. coli BL21 (DE3), SDS-PAGE detection results are shown in Figure 13 As shown in Figure A, the ScHAT1 recombinant protein was successfully induced to express. Since the prokaryotic expression vector carries a 6×His tag, the detected target protein is higher than the predicted theoretical molecular weight of 50.5 kDa. ScHAT1 Genes expressing stress tolerance in E. coli cells (see Figure 13 Figure B), recombinant cells pEZYHb- ScHAT1 -BL21 grew faster under NaCl and D-Mannitol stress than the control group, and the number of cell colonies was more than that of the empty-loaded cell colonies. -4 The number of colonies at the bacterial solution concentration was very small, while the recombinant cell pEZYHb- ScHAT1 -BL21 can still grow normally. The results show that the recombinant cell pEZYHb- ScHAT1 -BL21 showed positive responses to NaCl and D-Mannitol stress, indicating that overexpression ScHAT1 Can improve the salt stress and drought stress tolerance of Escherichia coli, that is, overexpression ScHAT1 Can improve salt and drought resistance.

[0068] Since histone acetyltransferases mediate plant organ development, hormone signal coordination, and biotic and abiotic stress responses in the form of complexes by dynamically regulating histone acetylation modification, and are also involved in chromosome remodeling, DNA replication and repair, and cell cycle regulation, forming an epigenetic-environment interaction network. At present, research on the HAT gene family has been carried out in a variety of plants, and 12, 8, 7, 31, 32, and 6 HAT family genes have been identified in Arabidopsis, rice, grapes, wheat, tomatoes, and litchi, respectively.

[0069] In the present invention, a ScHAT1 gene, the molecular weight of the protein is 50.5kDa, and there is a PLN00104 domain at the position of 3~443aa. The highest homology of ScHAT1 protein and NP_001105074.1 protein in maize is 99.77%, but there are no reports on HAT involved in plant-pathogen interaction in maize. ScHAT1 protein is localized in the nucleus, and its nuclear localization characteristics are consistent with the localization of HAT proteins in tomatoes and wheat, which is consistent with its epigenetic regulatory function of mediating histone acetylation modification. There are extensive reports that acetylation modification genes are involved in plant response to biological stress. Cassava MeHAM1 gene interacts with molecular chaperone DNAJA2, thereby regulating SA accumulation and positively regulating resistance to cassava wilt. In rice, OsHDT701 reduces the acetylation level of rice histone H4, thereby reducing the transcription of pattern recognition receptors (PRR) and defense-related genes, thereby negatively regulating rice innate immunity. In the deletion mutant of AtHDA19 in Arabidopsis, the acetylation level increased, the SA content increased, the expression of related PR genes was promoted, and the disease resistance of the plant was improved. Other studies have shown that Arabidopsis AtHDA19 is upregulated after SA induction, and positively regulates the plant's resistance to Pseudomonas syringae through deacetylation. Arabidopsis acetyltransferase GCN5 inhibits the conduction of the JA signaling pathway by acetylation of the Groucho / Tup1-like auxiliary inhibitor TOPLESS (TPL), thereby reducing its resistance to Botrytis cinerea. Similarly, after the GhCaM7 gene in cotton mutates at the acetylation site, the JA content in the cotton is reduced, and the cotton is more susceptible to dahlia verticillium than cotton expressing wild-type GhCaM7. The present invention ScHAT1 The gene was down-regulated after SA and JA treatments, and up-regulated in susceptible varieties after smut treatment, but had no significant changes in resistant varieties, indicating that ScHAT1 It may play a negative regulatory role in the plant's immune response. ScHAT1 The gene was overexpressed in Nicotiana benthamiana and compared with the control after inoculation with tobacco solanacearum ScHAT1 The tobacco with the gene had more severe disease, and RT-qPCR analysis results showed that the expression of key genes in the SA / JA signaling pathway (NbPR-A / C, NbLOX1) was inhibited, indicating that ScHAT1 The gene may enhance the susceptibility of plants to pathogens by inhibiting plant SA and JA signal transduction pathways. ScHAT1 It may play the role of a negative regulatory factor in the response to biological stress. In summary, it can be shown that reducing the expression of the ScHAT1 gene can improve disease resistance.

[0070] In addition, there are also extensive reports on the involvement of HAT in plant responses to abiotic stress. In rice, drought treatment can significantly increase the expression of OsHAG702, OsHAG703 and OsHAM701, and the acetylation levels on histones H3 and H4 are also upregulated, indicating that OsHATs are involved in the drought stress response of rice. Under drought stress, the expression levels of wheat TaHAG2, TaHAG3, TaHAC2 and TaHDT1 genes were higher in the drought-resistant variety BN207. This result suggests that the differential expression of these HAT genes may be the reason for the higher drought resistance of BN207. Similar results showed that HAT genes in millet, citrus and poplar were all induced by drought stress, and the expression of PtrHDA906 and PtrHAG3 in poplar was significantly induced by drought. In the present invention, the recombinant cell pEZYHb- ScHAT1 -BL21 grew faster under NaCl and D-Mannitol stress than the control group, and the number of cell colonies was more than that of the empty cell colonies, indicating that HAT may have a certain tolerance to salt stress and drought stress, and may be a positive response factor to salt stress and drought stress. ScHAT1 Can improve the salt stress and drought stress tolerance of Escherichia coli, that is, overexpression ScHAT1 Can improve salt and drought resistance.

[0071] In summary, HAT genes play an important role in the interaction between plants and pathogens. ScHAT1 Preliminary research has been conducted on responses to biotic and abiotic stresses, laying a solid foundation for in-depth research on the function and mechanism of action of this gene in the process of sugarcane responding to pathogen stress and abiotic stress.

[0072] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, rather than all the embodiments. A person skilled in the art can also obtain other embodiments based on the embodiments without inventiveness, and these embodiments all belong to the protection scope of the present invention.

Claims

1. A kind of sugarcane ScHAT1 A gene characterized by Said ScHAT1 The coding sequence of the gene is SEQ ID NO: 1; Said ScHAT1 The gene is associated with at least one of disease resistance, salt resistance and drought resistance.

2. A sugarcane ScHAT1 protein, characterized in that The ScHAT1 protein is the one described in claim 1 ScHAT1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO:

2.

3. A primer pair, characterized in that: The primer pair is used for PCR amplification of the ScHAT1 Gene, the primer pair comprises: ScHAT1 -F:5’-GGTCCCACAAGTCATCCG-3’; ScHAT1 -R:5’-GGTTATGGTTCTTTCGCTTT -3’。 4. A type of ScHAT1 A plasmid containing a gene, characterized in that The inclusion ScHAT1 The plasmid of the gene is obtained by using the ScHAT1 The gene was connected to a cloning vector.

5. A type of ScHAT1 A recombinant vector of a gene, characterized in that The inclusion ScHAT1 The recombinant vector of the gene is a ScHAT1 The PCR amplification product of the gene or ScHAT1 The plasmid of the gene is connected to the vector to obtain; Said ScHAT1 The coding sequence of the gene is shown in SEQ ID NO:

1.

6. A type of ScHAT1 A strain of gene, characterized in that The inclusion ScHAT1 The strains containing the gene ScHAT1 Agrobacterium containing genes ScHAT1 Yeast or the yeast containing the gene ScHAT1 Gene of Escherichia coli; The inclusion ScHAT1 The Agrobacterium containing the gene is the one described in claim 5 ScHAT1 The recombinant vector of the gene is transformed into Agrobacterium to obtain; The inclusion ScHAT1 The yeast containing the gene is used as claimed in claim 5 ScHAT1 The recombinant vector of the gene is transformed into yeast to obtain; The inclusion ScHAT1 The Escherichia coli containing the gene is used as claimed in claim 5 ScHAT1 The recombinant vector of the gene or the above-mentioned ScHAT1 The plasmid containing the gene was transformed into Escherichia coli.

7. A method according to claim 1 ScHAT1 The application of genes in improving disease resistance is characterized in that: The application is to ScHAT1 Genes are used in sugarcane or tobacco to improve disease resistance.

8. A method according to claim 1 ScHAT1 The use of genes in salt resistance and / or drought resistance is characterized in that: The application is to ScHAT1 Genes are used in sugarcane to improve salt and / or drought tolerance; The application is to ScHAT1 Genes are used in E. coli to improve salt and / or drought tolerance.

9. A method for breeding plants with disease resistance, characterized in that: By reducing the sugarcane ScHAT1 Gene expression levels to obtain disease-resistant sugarcane; By reducing tobacco ScHAT1 Gene expression levels to obtain tobacco with disease resistance; Said ScHAT1 The coding sequence of the gene is shown in SEQ ID NO:

1.

10. A method for breeding salt-resistant and / or drought-resistant plants, characterized in that: By overexpressing Sugarcane 7 ScHAT1 Gene expression level to obtain sugarcane with salt and / or drought resistance; By overexpressing Escherichia coli ScHAT1 Gene expression levels to obtain Escherichia coli with salt and / or drought resistance; Said ScHAT1 The coding sequence of the gene is shown in SEQ ID NO:1.

Images