Primer, probe group and detection system for detecting mononucleotide polymorphism molecular marker related to liver cancer susceptibility and prognosis

Abstract

The invention belongs to the field of molecular biology and medicine, and discloses a primer, a probe group and a detection system for detecting a single nucleotide polymorphism (SNP) molecular marker related to liver cancer susceptibility and prognosis. The SNP molecular marker rs6903C / T is located in a 3 'UTR region of an MRPL34 gene, and the expression and protein level of the MRPL34 gene are influenced due to the change of m6A modification. Through screening of more than 48,000,000 SNPs of 1161 liver cancer cases and 1353 contrast cases and verification in 3157 liver cancer cases and 4795 contrast cases, the rs6903 is found to be significantly associated with the susceptibility of the liver cancer; meanwhile, through analysis of 451 liver cancer cases and 147 liver cancer cases, the rs6903 is found to be a molecular marker for prognosis of the liver cancer. The primer disclosed by the invention is used for amplifying a gene segment containing a human genome rs6903 site; the probe is used for identifying whether cytosine nucleotide at the rs6903 site in the amplified gene segment is mutated into thymine nucleotide or not; meanwhile, the invention also provides a reaction system for detecting the rs6903 site.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology and medicine, and in particular relates to a primer and probe set and a detection system for detecting single nucleotide polymorphism molecular markers related to liver cancer susceptibility and prognosis. Background Art

[0002] Liver cancer is one of the most common malignant tumors, with a high degree of malignancy and a poor prognosis. Due to the lack of sensitive and specific early diagnostic markers, most liver cancers are already in the late stage when they are discovered. Common risk factors for liver cancer include hepatitis B virus (HBV) or hepatitis C virus (HCV) infection. More than 80% of liver cancer patients in China have a history of hepatitis B. Genetic susceptibility is an important risk factor for the development of hepatitis B into liver cancer. Compared with hepatitis B patients without a family history of liver cancer, the relative risk (RR) of hepatitis B patients with a family history of liver cancer developing liver cancer is as high as 2.41. The RR of hepatitis B patients with two or more relatives with liver cancer developing liver cancer is as high as 5.55.

[0003] Research on the genetic level of liver cancer can be roughly divided into three directions:

[0004] Technology 1: Screening and application of single nucleotide polymorphism sites

[0005] Single nucleotide polymorphism (SNP) is one of the most common types of genetic variation in humans. It refers to the polymorphism of deoxyribonucleic acid (DNA) sequence caused by the variation of a single nucleotide at the genome level. It is the most common type of heritable genomic variation in humans, accounting for more than 90% of all known polymorphisms. Dozens or even hundreds of genetic susceptibility gene sites have been identified in other common cancers such as lung cancer, gastric cancer, and colorectal cancer, and some have been put into clinical use for susceptibility and prognosis detection.

[0006] At the same time, SNPs are widely present in the human genome, with an average of 1 in every 300 base pairs, and the total number is estimated to be 10 million or even more. SNPs are a dimorphic marker caused by the conversion or transversion of a single base. SNPs may be within the gene sequence or in non-coding sequences outside the gene. This means that screening out SNPs that can predict liver cancer susceptibility and / or prognosis requires a lot of work.

[0007] Current status and shortcomings of technology 1: Unlike other common tumor types, due to the complex occurrence environment and development mechanism of liver cancer, there are very few genetic susceptibility gene loci for liver cancer identified so far, and they urgently need to be further identified through various strategies.

[0008] Related technologies can be found in the following documents:

[0009] CN112176063A AFB1 / HBV dual-exposed hepatocellular carcinoma p53 gene codon 249 mutation susceptibility SNP site and its application (SNP: rs9930984, rs75218075, rs8022091);

[0010] CN111748630A SNP loci, primer pairs, kits and applications associated with liver cancer survival rate (SNP: rs2237492);

[0011] CN110093424A Primers, probes and kits for detecting HBV-related liver cancer susceptibility (SNPs: HLA-DQrs9275319G>A, HLA-DQ rs9272105G>A, STAT4 rs7574865T>G, XRCC3 rs861539C>T, TP53rs1042522G>C and MDM2 rs2279744T>G)

[0012] CN108531601A A primer and detection method for detecting SNP sites associated with liver cancer susceptibility (SNP: rs230496, rs200842482, rs4939827, rs7240004, rs7229639);

[0013] CN107365844A A SNP site rs2235546 associated with susceptibility to primary liver cancer and its application (SNP: rs2235546);

[0014] CN106834453A A kit and method for detecting whether chronic hepatitis B or HBV carriers are susceptible to liver cancer (SNP: rs2304204);

[0015] CN106480212A A kit for detecting susceptibility to liver cancer and its SNP markers (SNPs: rs9267673, rs4678680, rs12100561, rs4444903, rs455804, rs1800562, rs2596542, rs9275319, rs9275572, rs17401966, rs28362491, rs230496, rs7574865 and rs1800629);

[0016] CN103834639B A single nucleotide polymorphism site rs9275319 associated with liver cancer susceptibility and application thereof (SNP: rs9275319);

[0017] CN103834638A Single nucleotide polymorphism site rs7574865 associated with liver cancer susceptibility and application thereof (SNP: rs7574865);

[0018] For the few genetic susceptibility gene loci for liver cancer that have been identified so far, the molecular mechanisms underlying their association with liver cancer susceptibility and their role in the occurrence and development of liver cancer have not yet been revealed, which hinders their translational application in clinical practice.

[0019] Technology 2: Study on m6A modification and regulation of target genes

[0020] m6A (N6-methyladenosine) refers to methylation at the 6th nitrogen (N) atom of adenine (A). It is the most common chemical modification of messenger ribonucleic acid (mRNA). It is currently known that there is an average of one modification site for every 2,000 nucleotides. The biological effects of m6A are very extensive. It can regulate growth and development, gametogenesis, cell reprogramming, biological rhythms and cell division. Its abnormal effects may affect the occurrence and development of cancer. Some teams have reported that genetic variation sites associated with pancreatic cancer prognosis regulate PIK3CB expression by affecting m6A modification, thereby promoting pancreatic cancer progression. Studies have shown that there are abnormal m6A modifications in liver cancer, and many m6A regulatory factors are dysregulated.

[0021] Current status and shortcomings of technology 2: Although the role of m6A modification in liver cancer has become a hot topic, its mechanism of action in the occurrence and development of liver cancer is far from being fully and clearly revealed. In particular, people are currently focusing on m6A regulatory factors, while there are few studies on target genes regulated by m6A modification.

[0022] Technology 3: Commonly used clinical technology for detecting tumor-related genetic variation sites

[0023] ① Sanger sequencing: a traditional sequencing method used to detect specific regions of a single gene, suitable for diagnosing known single-gene diseases. ② Next-generation sequencing (NGS): a high-throughput sequencing technology that can quickly and efficiently sequence the entire genome or specific genomic regions, and is widely used in the study of complex diseases and screening for polygenic diseases. ③ Gene Chips: also known as genomic chips or SNP chips, used to detect a large number of SNPs and changes in gene expression levels.

[0024] Current status and limitations of technology three: Although these traditional technologies for detecting tumor-related genetic variation sites have been used clinically, they each have their limitations and disadvantages. Sanger sequencing is only suitable for diagnosing known single-gene diseases, with a relatively limited diagnostic range and relatively low efficiency. Although NGS and gene chips have high detection efficiency, they are expensive and are not an economical detection and identification option.

[0025] The problem that this program needs to solve is: how to screen out new SNP sites related to liver cancer susceptibility and prognosis, and use appropriate means to perform specific and efficient detection. Summary of the invention

[0026] The purpose of the present invention is to provide a primer and probe set for detecting single nucleotide polymorphism molecular markers related to liver cancer susceptibility and prognosis, and the primer and probe set are used to detect the SNP molecular marker rs6903C / T located in the 3′UTR region of the MRPL34 gene. By screening more than 4.8 million SNPs of 1161 liver cancer cases and 1353 controls, and verifying in 6 independent cohorts totaling 3157 liver cancer cases and 4795 controls, it was found that rs6903 was significantly associated with the risk of liver cancer; at the same time, through the analysis of two groups of liver cancer cases, 451 and 147 cases, respectively, which were treated by surgical resection of liver tumors and followed up for a long time, it was found that rs6903 was a molecular marker for liver cancer prognosis. At the same time, the present invention also proposes a detection system.

[0027] To achieve the above purpose, the present application discloses a primer and probe set, including primers and probes; the primers are used to amplify a gene fragment containing the rs6903 site of the human genome; the probe is used to identify whether the cytosine nucleotide at the rs6903 site in the amplified gene fragment has mutated into a thymine nucleotide.

[0028] In the above primer and probe set, the sequences of the primers are shown as SEQ ID NO.1 and SEQ ID NO.2; the sequences of the probes are shown as SEQ ID NO.3 and SEQ ID NO.4.

[0029] In the above primer and probe set, the gene fragment is shown as SEQ ID NO.5.

[0030] At the same time, the present invention also discloses a detection method for detecting whether the cytosine nucleotide at the rs6903 site in the human genome has mutated into a thymine nucleotide, which is prepared by using the primer and probe set as described above.

[0031] Finally, the present invention also discloses a kit comprising the primer and probe set as described above.

[0032] In the above-mentioned kit, the kit also includes 5 μL of 2×TaqMan Fast qPCR premix, which is made up to 10 μL with sterile double distilled water.

[0033] Beneficial effects of this application

[0034] 1. Significant correlation: The detected SNP loci showed significant correlation with liver cancer susceptibility and prognosis in a large-scale hepatitis B and liver cancer patient cohort, which has never been reported before.

[0035] 2. Fast and convenient: Using SNP sites as specific targets to establish qPCR detection methods greatly shortens the time required to detect related SNPs and reduces their detection costs. Only one-step fluorescence observation is required, without sequencing, to accurately distinguish specific SNP sites.

[0036] 3. Establishing an identification method based on SNP sites provides a new option for detecting liver cancer susceptibility and prognosis, and has broader application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1A The frequency distribution of rs6903 genotypes in liver cancer cases and non-liver cancer control samples during the whole genome screening stage, as well as the association between rs6903 and the risk of liver cancer;

[0038] Figure 1B This is a graph showing the association between all genetic variation sites in the 80kb region before and after rs6903 and the risk of liver cancer during the whole genome screening stage;

[0039] Figure 1C This is the result of a joint analysis of the data from the screening phase and the validation phase, showing that rs6903 is significantly associated with the risk of liver cancer;

[0040] Figure 2A This is a graph showing the association between rs6903 genotype and overall survival of liver cancer patients in liver cancer cases from Qidong, Jiangsu;

[0041] Figure 2B This is a graph showing the association between rs6903 genotype and progression-free survival of liver cancer patients in liver cancer cases from Qidong, Jiangsu;

[0042] Figure 2C This is the association result diagram between rs6903 genotype and overall survival of liver cancer patients in TCGA_LIHC_Asian data;

[0043] Figure 2D This is the association result diagram between rs6903 genotype and progression-free survival of liver cancer patients in TCGA_LIHC_Asian data;

[0044] Figure 3 This is the result of using the qPCR method to detect the rs6903 CC homozygous, CT heterozygous or TT homozygous genotype in the genomic DNA of clinical patients. DETAILED DESCRIPTION

[0045] The present invention will be described clearly and completely below in conjunction with the embodiments of the present invention. In the description of the present invention, it should be noted that, if no specific conditions are specified in the embodiments, the conditions are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0046] Part I Target Screening

[0047] The present invention provides a single nucleotide polymorphism molecular marker associated with liver cancer susceptibility and prognosis, the single nucleotide polymorphism molecular marker is rs6903C / T, located in the 3′UTR region of the MRPL34 gene. According to the sequence information provided by the SNP database at the website https: / / www.ncbi.nlm.nih.gov / , the partial sequence upstream and downstream of the rs6903 site of the MRPL34 gene is as follows:

[0048] CTGTAAATATTTCAGAATGTATCTCTCCAAGATGAGAGCTCATTAAAAG A N AATTACAAAGCTTATCACATCCAAAAGAATTATCAATAATTTTGAAATATT AT(SEQ ID NO:5)

[0049] Among them, the base of nucleotide N in the above nucleotide sequence is C / T, that is, the rs6903 mutation site.

[0050] In the present invention, more than 4.8 million SNPs were first filtered out from genome-wide association study (GWAS) data containing 1161 liver cancer cases and 1353 controls through genotype data filling and quality control.

[0051] The additive model was used for association analysis, and SNPs with P<0.05 entered the next screening process. Combined with the RMVar database (https: / / www.rmvar.renlab.org), a SNP significantly associated with liver cancer susceptibility and located in the m6A modification site, rs6903, was analyzed; at the same time, the SRAMP online software (http: / / www.cuilab.cn / sramp) analysis further confirmed the presence of m6A modification in the region where rs6903 was located. Furthermore, by analyzing the GTEx database (https: / / www.gtexportal.org / home / ) and the data of TCGA_LIHC samples (https: / / portal.gdc.cancer.gov), rs6903 was associated with MRPL34 expression. That is, through screening, it was found that the single nucleotide mutation of rs6903 would cause changes in m6A modification, affect the expression and protein level of MRPL34, and then affect mitochondrial energy metabolism, and ultimately affect the occurrence, development and prognosis of liver cancer.

[0052] Next, through a two-stage analysis of a large-scale liver cancer case-control sample of 6 independent cohorts (including 3157 liver cancer cases and 4795 controls), rs6903 was again verified as a liver cancer susceptibility genetic variation site; at the same time, the relationship between rs6903 and liver cancer prognosis was analyzed in two other independent liver cancer cohorts (including 451 and 147 liver cancer patients who underwent surgical resection of liver tumors and long-term follow-up, respectively), and it was found that the rs6903 site was significantly associated with the overall survival and progression-free survival of liver cancer patients.

[0053] Analysis results: SNP-rs6903, which is significantly associated with the risk and prognosis of liver cancer, was screened out. Specifically, when an individual carries the rs6903 T allele, their risk of liver cancer increases, and if they have liver cancer, their prognosis is also poor; while carriers of the C allele have a lower risk of liver cancer, and if they have liver cancer, their prognosis is better. This may be due to the single nucleotide mutation of the SNP site rs6903, which leads to changes in m6A modification, affects the expression level of MRPL34, and then affects mitochondrial energy metabolism, and ultimately affects the occurrence, development and prognosis of liver cancer.

[0054] Figure 1 shows the statistical data of the association between the MRPL34 rs6903 locus and liver cancer susceptibility. From the results in the figure, it can be seen that rs6903 is significantly correlated with the risk of liver cancer. Compared with rs6903 T allele carriers, rs6903 C allele carriers have a lower risk of liver cancer.

[0055] Figure 1AThe frequency distribution of rs6903 genotypes in liver cancer cases and non-liver cancer control samples during the whole genome screening stage, as well as the association between rs6903 and the risk of liver cancer;

[0056] Figure 1B This is a graph showing the association between all genetic variation sites in the 80kb region before and after rs6903 and the risk of liver cancer during the whole genome screening stage;

[0057] Figure 1C This is the result of a joint analysis of the data from the screening phase and the validation phase, showing that rs6903 is significantly associated with the risk of liver cancer.

[0058] FIG. 2A to FIG. 2D The figure shows the statistical data of the association between the MRPL34 rs6903 locus and the prognosis of liver cancer. From the results in the figure, we can see that rs6903 is significantly associated with the prognosis of liver cancer patients. Compared with rs6903 T allele carriers, rs6903 C allele homozygotes have a better prognosis of liver cancer.

[0059] Figure 2A and Figure 2B This is a graph showing the association between rs6903 genotype and overall survival and progression-free survival of liver cancer patients in liver cancer cases from Qidong, Jiangsu;

[0060] Figure 2C and Figure 2D This is a graph showing the association between rs6903 genotype and overall survival and progression survival of liver cancer patients in the TCGA_LIHC_Asian data.

[0061] Part II: qPCR detection method based on SNP sites

[0062] Based on the nucleotide sequences of the upstream and downstream of SNP site rs6903 and its C→T single nucleotide mutation, upstream and downstream primers and probes were designed, and the sequences are shown in Table 1. The following materials were used to establish the basic system of the qPCR method: 2×TaqMan Fast qPCR premix 5μL, 10μM upstream primer 0.25μL, 10μM downstream primer 0.25μL, 10μM probe 0.2μL+0.2μL, 50-100ng of sample DNA to be tested, and sterilized double distilled water was made up to 10μL. Reaction procedure: denaturation at 94℃ for 3 minutes; denaturation at 94℃ for 5 seconds, annealing at 60℃ for 30 seconds, and 40 cycles; finally kept at 4℃. The PCR reaction was performed using a LightCycler480 fluorescent quantitative PCR instrument, and the results were analyzed using Roche 480Gene Scanning software.

[0063] Table 1 Primer probe sequence information

[0064]

[0065] Part III Clinical Testing

[0066] The present invention provides a method for detecting a single nucleotide polymorphism molecular marker rs6903C / T, comprising the following steps:

[0067] (1) 2 mL of peripheral venous blood was drawn from the subjects, and then the QIAamp Blood Mini Kit 250 (purchased from QIAGEN) was used to extract the genomic DNA of the subjects according to the instructions. The concentration and purity of the extracted DNA were measured using a Nano Drop spectrophotometer to determine whether it met the extraction standard (A260 / A280>1.8), and the DNA was stored in a -20°C refrigerator for use.

[0068] (2) PCR reaction system was prepared. The genomic DNA of the subjects, the corresponding upstream and downstream primers and probes were added to the system. The specific configuration of the PCR reaction system is shown in Table 2. Among them, 2×TaqMan Fast qPCR premix, primers and probes were purchased and synthesized from Sangon Biotechnology Co., Ltd.

[0069] Table 2 PCR reaction system

[0070]

[0071] (3) Using the above PCR reaction system, the reaction program was set on a LightCycler 480 fluorescence quantitative PCR instrument to perform PCR amplification. The cycle parameters are shown in Table 3:

[0072] Table 3 Reaction procedure

[0073]

[0074] Experimental results: In this example, 48 samples of patient blood were used as test samples. Each sample was set with a secondary well. The above method was used for testing. The Roche 480Gene Scanning software was used to analyze the results and record the corresponding genotypes to determine whether the test sample MRPL34 rs6903 contained a heterozygous or homozygous mutation. The test results were as follows: Figure 3 As shown in the figure, although the majority of the 48 patients' blood samples were homozygous for C genotype, a certain proportion of patients were still detected to have C→T mutation at the rs9603 site, and even patients with homozygous genotype T were detected, which further proves the clinical application value of the rs9603 site, and the detection method is economical, fast and easy to promote and use.

[0075] Part IV Results Analysis

[0076] 1. The specificity of the site

[0077] 1.1 The particularity of screening difficulty

[0078] The loci of the present invention are SNP loci, which have the characteristics of being difficult to screen and a small number of sites that meet the requirements; at the same time, there are many SNPs sites in the human genome, and it is not easy to screen millions of SNPs to obtain SNPs that initially meet the requirements, which requires repeated screening and verification; in addition, further screening is performed from the initially screened SNPs to obtain candidate SNPs that change the m6A modification, and finally a candidate SNP that meets the requirements is obtained, which further highlights the difficulty of screening the SNPs sites detected by the present invention.

[0079] 1.2 Peculiarities of site properties

[0080] The SNPs site obtained by the screening of the invention is not only a SNPs mutation, but the mutation also has the characteristic of changing the m6A modification, and the site has a very prominent specificity.

[0081] In the prior art reports, no more than 40 SNPs mutations related to liver cancer susceptibility or prognosis were reported in total; among them, no more than 5 SNPs mutations were related to liver cancer prognosis, and there were no candidate SNPs that changed m6A modification. These data show that the SNPs mutations screened by the present invention have strong specificity.

[0082] 2. Significant correlation: The detected SNP loci showed significant correlation with liver cancer susceptibility and prognosis in multiple independent large-scale hepatitis B and liver cancer patient cohorts, and this has never been reported before. The significant association of this SNP with liver cancer susceptibility has been repeatedly verified in 7 independent liver cancer and control samples, and its association with liver cancer prognosis has obtained significant results in 2 independent liver cancer cases. These results demonstrate that the significant association of this SNP with liver cancer susceptibility and prognosis has a very strong reliability.

[0083] 3. Fast and convenient: The detection method of specific SNP sites is established based on the qPCR experimental platform, which greatly shortens the time required for detecting related SNPs and reduces the detection cost. Only one-step fluorescence observation is required, without sequencing, to accurately distinguish the genotype of specific SNP sites. The establishment of a qPCR-based identification method for liver cancer susceptibility and prognosis sites - rs6903 provides a new option for the detection of liver cancer susceptibility and prognosis, and has a broader application prospect.

Claims

1. A primer and probe set for detecting single nucleotide polymorphism molecular markers associated with liver cancer susceptibility and prognosis, characterized in that: The method comprises primers and probes; the primers are used to amplify a gene fragment containing the rs6903 site of the human genome; and the probe is used to identify whether the cytosine nucleotide at the rs6903 site in the amplified gene fragment is mutated into a thymine nucleotide.

2. The primer and probe set according to claim 1, characterized in that: The sequences of the primers are shown in SEQ ID NO.1 and SEQ ID NO.2; the sequences of the probes are shown in SEQ ID NO.3 and SEQ ID NO.

4.

3. The primer and probe set according to claim 2, characterized in that: The gene fragment is shown as SEQ ID NO.

5.

4. Use of the primer and probe set as claimed in claims 1 to 3 to prepare a kit for detecting whether the cytosine nucleotide at the rs6903 site in the human genome has mutated into a thymine nucleotide.

5. A kit, characterized in that: Contains the primer and probe set as described in claim 1 or 2.

6. The kit according to claim 5, characterized in that The kit also includes 5 μL of 2×TaqMan FastqPCR premix, which is made up to 10 μL with sterile double distilled water.

Images