Molecular marker for alveolar rhabdomyosarcoma and application thereof

By discovering and utilizing the circPAX3 R-loop site as a molecular marker for alveolar rhabdomyosarcoma, the problem of lack of effective diagnosis and treatment in existing technologies has been solved, early diagnosis and effective treatment of alveolar rhabdomyosarcoma have been achieved, and the malignant biological behavior of tumor cells has been inhibited.

CN120648797APending Publication Date: 2025-09-16SHIHEZI UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510680803.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-26
Publication Date
2025-09-16

AI Technical Summary

Technical Problem

The existing technology lacks effective molecular markers for the diagnosis and treatment of alveolar rhabdomyosarcoma, resulting in poor prognosis for patients.

Method used

A molecular marker for alveolar rhabdomyosarcoma, circPAX3 R-loop site, was provided. Its specific location in the human genome was determined by DRIP-seq and circRNA-seq analysis. Primer sets and probes were designed for detecting circPAX3 (circ_0007333). This molecular marker can regulate the malignant biological behavior of tumor cells.

Benefits of technology

By inhibiting the circPAX3 R-loop structure, it is possible to effectively diagnose and prevent alveolar rhabdomyosarcoma, inhibit the proliferation, invasion and migration of tumor cells, promote cell apoptosis, and provide a new direction for targeted therapy and immunotherapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120648797A_ABST
    Figure CN120648797A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biological medicine, in particular to a molecular marker of alveolar rhabdomyosarcoma and application of the molecular marker, the molecular marker is a circPAX3R-loop site, and a DNA-RNA hybridization region of the molecular marker is located on chr2: 2230 94913-2230 95853 of a human genome. According to the application disclosed by the invention, a large number of R-loop structures exist in an alveolar rhabdomyosarcoma cell through DRIP-seq, a plurality of circRNAs exist in a cell nucleus of the alveolar rhabdomyosarcoma through circRNA sequencing, the existence of circPAX3R-loop is proved through qPCR after a DRIP product is subjected to RNase R and RNase H treatment, and the result shows that circPAX3R-loop exists in the cell nucleus of the alveolar rhabdomyosarcoma in the cell nucleus of the alveolar rhabdomyosarcoma in the cell nucleus of the alveolar rhabdomyosarcoma. The important clinical application value is realized on developing a reagent or a kit for diagnosing the alveolar rhabdomyosarcoma, a medicine for preventing and / or treating the alveolar rhabdomyosarcoma or a gene treatment strategy aiming at the target spot.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine, and in particular to a molecular marker for alveolar rhabdomyosarcoma and an application thereof. Background Art

[0002] Rhabdomyosarcoma (RMS) is the most common soft tissue sarcoma in children and adolescents, accounting for approximately 4-5% of pediatric malignancies and less common in adults. Based on pathological features, RMS is primarily classified as embryonal rhabdomyosarcoma, alveolar rhabdomyosarcoma, pleomorphic rhabdomyosarcoma, and spindle cell / sclerosing rhabdomyosarcoma. Embryonal rhabdomyosarcoma (ERMS) is the most common, accounting for 60-70% of pediatric RMS and has a relatively good prognosis. Alveolar rhabdomyosarcoma (ARMS) is prone to metastasis and is highly invasive, accounting for 20-30% of RMS cases and has a poor prognosis.

[0003] Studies have shown that the molecular genetic characteristics of rhabdomyosarcoma are closely associated with various gene mutations, fusions, and epigenetic alterations. Most notably, in alveolar rhabdomyosarcoma, approximately 70–80% of cases harbor specific fusion genes: PAX3-FOXO1 (t(2;13)) or PAX7-FOXO1 (t(1;13)). The fusion proteins encoded by these fusion genes exert biological functions, driving tumor formation and closely associated with poor prognosis. No specific fusion genes have been identified in embryonal rhabdomyosarcoma, pleomorphic rhabdomyosarcoma, or spindle cell / sclerosing rhabdomyosarcoma, although RAS or TP53 mutations may be observed in some cases. Currently, treatment for rhabdomyosarcoma primarily relies on surgery combined with chemoradiotherapy, but the 5-year survival rate remains low. Therefore, targeted therapy and immunotherapy have become new research hotspots. Molecular biology has revealed the driving role of the PAX3 / 7-FOXO1 fusion gene in RMS. A deeper understanding of its molecular mechanisms is crucial for the diagnosis and treatment of RMS, the development of targeted drugs, and prognostic assessment.

[0004] In 2023, Conn et al. discovered that circRNAs in acute myeloid leukemia form circular RNA:DNA hybrids (circR-loops) with their cognate DNA. These loops promote transcriptional pausing, proteasome inhibition, chromatin reorganization, and DNA double-strand breaks, inducing the formation of the MLL-MLLT1 fusion gene and thus promoting the development of leukemia. This discovery provides new research ideas for the formation of the PAX3-FOXO1 fusion gene in alveolar rhabdomyosarcoma. Is it possible that circPAX3, circFOXO1, and their cognate DNA form circR-loops that drive PAX3-FOXO1 formation and promote the development of rhabdomyosarcoma?

[0005] Current research on rhabdomyosarcoma focuses primarily on circRNAs. CircRNAs, as specialized noncoding RNA molecules, form closed loops through reverse cleavage, resulting in a stable structure that is resistant to degradation by ribonucleases. Studies have reported that circZNF609, by adsorbing miR-145-5p, relieves repression of downstream oncogenes, promoting rhabdomyosarcoma cell proliferation and metastasis. Animal models have also demonstrated that targeting the circZNF609 / miR-145-5p axis may inhibit rhabdomyosarcoma progression. CircRNAs are relatively understudied in rhabdomyosarcoma, but with further research, circRNAs hold promise as biomarkers for disease treatment. CircR-loops, as unique triple-stranded nucleic acid structures formed by circRNA and its cognate DNA, play key regulatory roles in both plant and animal systems. In plants, circR-loops can participate in centromere regulation; in animals, circR-loops can promote transcriptional pausing, proteasome inhibition, and DNA fragmentation through DNA damage mechanisms, leading to cancer development. CircR-loops play an important role in maintaining genome stability and are closely related to the occurrence of diseases, but their specific roles and regulatory mechanisms are still unclear.

[0006] In view of this, the present invention is proposed. Summary of the Invention

[0007] In order to make up for the deficiencies of the prior art, the object of the present invention is to provide a molecular marker for alveolar rhabdomyosarcoma, which can be used as a biomarker for the diagnosis and / or prevention of alveolar rhabdomyosarcoma.

[0008] In a first aspect of the present invention, a molecular marker for alveolar rhabdomyosarcoma is provided. The molecular marker is a circPAX3 R-loop site, and its DNA-RNA hybridization region is located at chr2:223094913-223095853 of the human genome (hg19).

[0009] Specifically, the circPAX3 R-loop site screening was performed by combining DRIP-seq with circRNA-seq analysis to align the chromosome sequence, thereby clarifying the specific sequence position as chr2:223094913-223095853, with a length of approximately 941 bp, and the specific sequence is shown in SEQ ID No:7.

[0010] Specifically, the circRNA that forms the circPAX3 R-loop is circPAX3 (circ_0007333).

[0011] Specifically, the molecular marker is formed by hybridization of circPAX3 (circ_0007333) and the PAX3 gene.

[0012] Specifically, the circRNA forming the circPAX3 R-loop, circPAX3 (circ_0007333), is more stable than its parental gene PAX3.

[0013] Specifically, the circPAX3 R-loop promotes the malignant biological behavior of tumor cells by upregulating circPAX3 (circ_0007333), mainly manifested by promoting tumor cell proliferation, invasion / migration and tumorigenicity in vivo, and inhibiting cell apoptosis.

[0014] In a second aspect of the present invention, a primer set for detecting the molecular markers of the alveolar rhabdomyosarcoma is provided. The sequences of the primer set are shown in SEQ ID No: 1 and SEQ ID No: 2.

[0015] In a third aspect of the present invention, a primer set for detecting circPAX3 (circ_0007333) is provided, wherein the sequences of the primer set are shown in SEQ ID No: 3 and SEQ ID No: 4.

[0016] In a fourth aspect of the present invention, a probe for detecting circPAX3 (circ_0007333) is provided, the sequence of the probe being shown in SEQ ID No: 5.

[0017] The fifth aspect of the present invention provides the use of the above-mentioned molecular markers for alveolar rhabdomyosarcoma, and the use of the molecular markers in regulating the malignant biological behavior of tumor cells.

[0018] Specifically, the malignant biological behaviors include: cell proliferation, invasion / migration and cell apoptosis capabilities.

[0019] The sixth aspect of the present invention provides the use of the above-mentioned molecular markers for alveolar rhabdomyosarcoma, and the use of the molecular markers in the preparation of products for diagnosing and / or preventing and treating alveolar rhabdomyosarcoma.

[0020] Preferably, the product is a reagent or kit for diagnosing alveolar rhabdomyosarcoma.

[0021] Preferably, the product is a drug for preventing and / or treating alveolar rhabdomyosarcoma; more preferably, the drug is siRNA, a vector, a biological inhibitor, etc.

[0022] Specifically, the drug may act through any of the following mechanisms:

[0023] a) Inhibit the circularization of circPAX3;

[0024] b) Degradation of circR-loop structures;

[0025] c) Blocking circR-loop-mediated DNA damage.

[0026] The seventh aspect of the present invention provides the use of the above-mentioned molecular markers for alveolar rhabdomyosarcoma, and the use of the molecular markers in screening drugs for preventing and / or treating alveolar rhabdomyosarcoma.

[0027] In an eighth aspect of the present invention, a kit for diagnosing alveolar rhabdomyosarcoma is provided, comprising the above-mentioned primer set for detecting molecular markers of alveolar rhabdomyosarcoma, wherein the sequences of the primer set are shown in SEQ ID No: 1 and SEQ ID No: 2.

[0028] The ninth aspect of the present invention provides an application of the above-mentioned molecular marker for alveolar rhabdomyosarcoma, and the application of the molecular marker in screening drugs for preventing and / or treating alveolar rhabdomyosarcoma.

[0029] In a tenth aspect, the present invention provides a drug screening system comprising a primer set for detecting molecular markers of alveolar rhabdomyosarcoma and a reagent for evaluating the effect of a candidate compound on R-loop levels.

[0030] In an eleventh aspect of the present invention, a method for identifying circPAX3 R-loop for non-diagnostic purposes is provided, comprising the steps of confirming that the circPAX3 R-loop is a circR-loop by treating the circPAX3 R-loop with RNase R and RNase H and applying the S9.6 antibody.

[0031] The present invention has at least the following beneficial effects:

[0032] The present invention discovered a target associated with the formation of the PAX3-related fusion gene in alveolar rhabdomyosarcoma: an R-loop site where circPAX3 (circ_0007333) hybridizes with PAX3. DRIP-seq revealed the presence of numerous R-loop structures in alveolar rhabdomyosarcoma cells. CircRNA sequencing revealed the presence of multiple circRNAs in the nuclei of alveolar rhabdomyosarcoma cells. RNase R and RNase H treatment of the DRIP products followed by qPCR confirmed the presence of circPAX3 R-loops. This target has important clinical application value in developing diagnostic reagents or kits for alveolar rhabdomyosarcoma, as well as drugs or gene therapy strategies for the prevention and / or treatment of alveolar rhabdomyosarcoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0034] Figure 1 Figure 3 shows the gene distribution and staining localization of 37,146 R-loops detected by DRIP-seq in RH30 cells. Figure A shows the distribution of 37,416 R-loops in RH30 cells in gene coding, intergenic, terminator, and promoter regions. Figure B shows the distribution percentage and fragment length of 37,416 R-loops in different gene regions. Figure C shows the read distribution of DRIP products in the gene start sequence (TSS) and end sequence (TES). Figure D shows the length distribution of DRIP products. Figure E shows the gene distribution of 37,416 R-loops on 23 chromosomes.

[0035] Figure 2 1146 circRNAs were detected in the nucleus of RH30 cells; Figure A is a three-dimensional schematic diagram of the circRNA composition of coding genes and non-coding genes; Figure B is a schematic diagram of circRNA length and number; Figures C and D are schematic diagrams of circRNA gene coverage; and Figure E is a chromosomal distribution map of the 1146 circRNAs.

[0036] Figure 3 Figure 2 is a distribution diagram of R-loops and circR-loop sites near the PAX3 gene; Figure A is a distribution diagram of 16 R-loops near the PAX3 gene detected by DRIP-seq; Figure B is a diagram of the circPAX3 R-loop formation site.

[0037] Figure 4 The following are the results of the verification and cell distribution of circPAX3 (circ_0007333) in alveolar rhabdomyosarcoma cells RH30; A is the RT-PCR verification of the existence of circPAX3 (circ_0007333); B is the junction site of circPAX3 (circ_0007333) successfully amplified by Sanger sequencing; C is the distribution of circPAX3 (circ_0007333) in RH30 cells detected by RNAFISH; D is the expression of circPAX3 (circ_0007333) in RH30 cells detected by qPCR experiment of cytoplasmic nuclear separation.

[0038] Figure 5 Figure 2 is the result of circPAX3 (circ_0007333) stability identification; A is the gDNA-cDNA amplification experiment verifying the circularization of circPAX3 (circ_0007333); BC is the RNase R experiment and actinomycin D experiment detecting that circPAX3 (circ_0007333) is more stable than the PAX3 gene.

[0039] Figure 6 Identification of circPAX3 R-loop in alveolar rhabdomyosarcoma RH30 cells; A is a statistical graph of DRIP-qPCR results after RNase H and RNase R digestion; B is a statistical graph of CUT&Tag-qPCR results after RNase H and RNase R digestion.

[0040] Figure 7 Figure 3: The successful construction of circPAX3-overexpressing RD and 293T stable cells; A is a schematic diagram of the lentiviral plasmid overexpressing circPAX3; B is qRT-PCR detection of circPAX3 overexpression efficiency in 293T and RD cells; C is fluorescence imaging showing the transfection efficiency of circPAX3 overexpression plasmid in RD cells; D is fluorescence imaging showing the transfection efficiency of circPAX3 overexpression plasmid in 293T cells.

[0041] Figure 8Figure 3: Overexpression of circPAX3 promotes the malignant biological behavior of ERMS cells. A is a plate clone showing that circPAX3 promotes RD cell proliferation; B is flow cytometry showing that circPAX3 inhibits RD cell apoptosis; C is CCK8 showing that circPAX3 promotes RD cell proliferation; D is Transwell showing that circPAX3 promotes RD cell invasion and migration; E is TUNEL-647 showing that circPAX3 inhibits RD cell apoptosis; F is EDU-647 showing that circPAX3 promotes RD cell proliferation.

[0042] Figure 9 Figure 3: Overexpression of circPAX3 promotes the malignant biological behavior of HEK293T cells. A is a plate clone showing that circPAX3 promotes 293T cell proliferation; B is a Transwell display showing that circPAX3 promotes 293T cell migration; C is CCK8 display showing that circPAX3 promotes 293T cell proliferation; D is flow cytometry display showing that circPAX3 inhibits 293T cell apoptosis; E is EDU-647 display showing that circPAX3 promotes 293T cell proliferation; F is TUNEL-647 display showing that circPAX3 inhibits 293T cell apoptosis.

[0043] Figure 10 Figure 3: Overexpression of circPAX3 promotes ERMS transplant tumor formation. A is the gross and fluorescent in vivo imaging of the RD nude mouse transplant tumor model overexpressing circPAX3. B is the growth volume curve of the nude mouse transplant tumor. C is the statistical graph of the nude mouse transplant tumor quality.

[0044] Figure 11 Figure 3: Overexpression of circPAX3 promotes subcutaneous tumor formation of HEK293T cells in nude mice. A is the gross and fluorescent in vivo imaging of the 293T nude mouse xenograft tumor model overexpressing circPAX3. B is the growth volume curve of the nude mouse xenograft tumor. C is the statistical graph of the nude mouse xenograft tumor quality. DETAILED DESCRIPTION

[0045] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present application belongs.

[0046] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular also includes the plural. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof.

[0047] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0048] Example 1 Screening of circPAX3 R-loop in alveolar rhabdomyosarcoma cells

[0049] R-loop, as a special three-stranded nucleic acid structure, is widely distributed in yeast, human cells and plants. Both linear RNA and circular RNA can form R-loop. In this example, the S9.6 antibody is used to specifically bind to the DNA: RNA hybrid chain in the R-loops structure. The R-loops in RH30 cells are first immunoprecipitated by DRIP experiment, and then the DNA in the DNA: RNA hybrid chain is extracted for second-generation sequencing. The results showed that 14256 genes in RH30 cells formed 37146 R-loops, which were distributed in gene coding regions (48.93%), intergenic regions (41.13%), terminator regions (5.61%), and promoter regions (4.33%) ( Figure 1 ). Subsequently, RH30 cells were subjected to nuclear-cytoplasmic separation, nuclear RNA was extracted, and circRNA sequencing was performed. A total of 1146 circRNAs were detected in the RH30 cell nucleus ( Figure 2 ), including 3 PAX3 gene-related circRNAs (Table 1). DRIP-seq data were further analyzed to determine whether there were R-loops near the PAX3 gene on chromosome 2. IGB software aligned the R-loops signals of DRIP-seq with the PAX3 gene position (chr2:223,062,606-223,165,717). The results showed that there were 16 R-loops signals near the PAX3 gene (Table 2, Figure 3By jointly analyzing the DRIP-seq data and circRNA-seq data, the R-loops signal sequence near the PAX3 gene was aligned with the sequence of the PAX3 gene-related circRNA, and finally a circPAX3 R-loop that may be formed near the PAX3 gene was screened (Table 3, Figure 3B), the sequence position is chr2:223094913-223095853, the length is about 941bp,The specific sequence is as follows: TGTTTTGAGGAAGTTCAAACAGCTTTCCTTACCAGTAT CTTGCAACAATGGCGAGAGAAGACAAAACTCTTTTCAGACAAATGCTTGGGTGAGTACCAAAAGTTTGAGCAAATCCCTCGGCAAAGGATTTATTAAATTGAGCTTCTTCTCCAGAAAAATCTTTTCCTCCGCTCTTAAATGATCTGACTTTAAGAATTACAATTAAGTTGCAAAATTGTTAACATTGCTCTGTAAGGAAATCAATTCTCATCTTCTCTTAAGCTGGCCTCCTGTAACAAGCTGCATCTGCCTGCCCTGTAGGACAGGATGGATGTCACTTCCATCTCAAGCGATCGCTCGTCGAAATTAGAATCAAATTTTAAAATGAGCTGAAACTTTTTGCTTCCACTTTAGAGTTTTCCTGATTCTCTGTGCTTCCAAATGTGAAGTTTCTACCTCTAGCGAGCAATTATTTTGGTCTCCTTGACTGCTCTGTGAATCCCATGAGGACAAGGCATCAAACTACCAGAGTGCAGAGATCCTACTTGATTCCCTTTATATCCTTCCAACCCCAAACACAGTGCTTTCCTCCATATTAAGTTTCAATGGGTGGCTCACGCCTGTAATCCCAGCACTTTGGGAGGTCGAGGCGGGTGGATCACCTGAGCTTAGGAGTTCAAGACCCACATGGTGAAACCCCGTCTCTACTAAGAATACAAAAATTAGCTGGGCATGGTGGCGGGTGCCTGTAATCATAGCTACTGGGGAGGCTGAGGCAAGAGAATCCCTTGAACCTGGGAGGCGGAGGTTGGGTTGAACTGAGATCCCGCCATTGCACTCCAGACTGGGCGACAGAGCAAGACTGTCTCAAAAAAAAAAAAAAAAGTTTCAATGAACTTTTGATGTAGGAATTAGAATATCTTTAGTTGGTAGAAATCCTCTCTCATTTTAGGGGAAACATC(SEQ ID No:7).,

[0050] Table 1 List of PAX3 gene-related circRNA information in RH30 cell nuclei

[0051]

[0052] Table 2 Summary of R-loops near the PAX3 gene in RH30 cells

[0053]

[0054] Table 3 circPAX3 R-loop information summary

[0055] name circR-loopsDNA hybrid chain fragment region circPAX3R-loop chr2:223094913-223095853(941bp)

[0056] Example 2 Verification of circRNAs that form circPAX3 R-loop in alveolar rhabdomyosarcoma

[0057] Based on the circPAX3 R-loop site screened in Example 1, the circPAX3 that may hybridize with PAX3 to form a circR-loop is circ_0007333, and this example conducted molecular identification and detection. First, primers for circPAX3 (circ_0007333) were designed (Table 4). RT-PCR verified the presence of circPAX3 (hsa_circ_0007333) ( Figure 4 A in the figure), and Sanger sequencing confirmed the successful amplification of its junction site ( Figure 4 B in the figure). The distribution of circPAX3 (hsa_circ_0007333) in RH30 cells was further detected by RNA FISH (sequence information of FISH probe is shown in Table 5) and cytoplasm and nucleus separation experiments. The results showed that circPAX3 (hsa_circ_0007333) was distributed in both the cytoplasm and nucleus ( Figure 4 To further identify the circularization and stability of circPAX3 (hsa_circ_0007333), gDNA-cDNA, RNase R assay, and actinomycin D assay confirmed that circPAX3 (hsa_circ_0007333) was more stable than its parent gene PAX3 ( Figure 5 ), with a longer half-life.

[0058] Table 4 circPAX3 (circ_0007333) primer information list

[0059]

[0060] Table 5. List of sequence information of FISH probes

[0061]

[0062] Example 3 Identification of circPAX3 R-loop in alveolar rhabdomyosarcoma cells

[0063] Based on the screening of circPAX3R-loop in alveolar rhabdomyosarcoma cells in Example 1 above, this example further identifies circPAX3R-loop. RH30 cells were treated with DRIP technology and CUT&TAG technology, and RNase R group (to digest linear RNA to exclude linear R-loop) and RNase H group (to digest R-loop structure) were set up. DNA was extracted from the immunoprecipitated products, and PAX3 gene-related primers were designed based on the circPAX3 R-loop fragment (Table 6). qPCR amplified the PAX3 fragments in the three groups of DNA samples. The results of DRIP-qPCR and CUT&TAG-qPCR both showed that: compared with the S9.6 group, after RNaseH treatment, PAX3 expression decreased significantly, indicating that R-loops structure did exist near PAX3DNA; while RNase R treatment had no effect on PAX3 expression, indicating that the R-loops formed near PAX3DNA were mainly circR-loops ( Figure 6 ).

[0064] Table 6 PAX3 R-loop primer information list

[0065]

[0066] Example 4 circPAX3 R-loop promotes malignant biological behavior of embryonal rhabdomyosarcoma (ERMS) and human embryonic kidney 293T cells

[0067] Based on the verification and identification of circPAX3 R-loop in Examples 2 and 3, in order to further confirm that circPAX3 can form a circR-loop structure and explore the effect of circPAX3 R-loop on the PAX3 gene, this example selected two human-derived cell lines with negative PAX3-FOXO1 fusion gene: embryonic rhabdomyosarcoma cell line (RD) and human embryonic kidney 293T cell line, and constructed stable cell lines overexpressing circPAX3 respectively. The circPAX3 mentioned subsequently is all circPAX3 (circ_0007333).

[0068] The circPAX3 overexpression lentiviral vector was purchased from Suzhou Gene Gene Co., Ltd. The circPAX3 overexpression lentiviral vector (LV-OE-circPAX3) and its control empty lentiviral vector (LV-OE-NC) carried GFP fluorescent protein and puro resistance gene ( Figure 7 A).

[0069] The sequence of the lentiviral vector overexpressing circPAX3 (LV-OE-circPAX3) is: CCTC (SEQ ID No: 8).

[0070] Embryonic rhabdomyosarcoma cells (RD) and human embryonic kidney 293T cells in the logarithmic growth phase were digested, counted, and plated. The cells were incubated in a 37°C incubator containing 5% CO2 for 24 hours until the cell confluence reached 50%-60%, and then lentiviral infection was performed. 8TU / mL, MOI=10 was added to the corresponding wells of RD and HEK293T cells, and then 40uL HirianGP infection reagent was added to each well and cultured in a 37℃, 5% CO2 incubator. After 72 hours of infection, the fluorescence of the cells was observed under a fluorescence microscope, and puromycin (10μg / mL) was added to the complete culture medium for selection. The medium was changed every two days. When the cell growth was stable and almost no dead cells appeared, the puromycin selection concentration was reduced by half and the cells were cultured at this concentration for one week. When the fluorescence infection efficiency under the microscope reached 90% ( Figure 7 Total RNA was extracted and reverse transcribed into cDNA, and qPCR amplification was performed to detect its overexpression efficiency ( Figure 7 The results showed that the circPAX3 overexpression efficiency was significantly increased compared with the blank control, indicating that the stable transfection cells were successfully constructed.

[0071] The successfully constructed stable cell lines overexpressing circPAX3 were digested and counted, and CCK8, plate cloning, EDU-647, TUNEL-647, Transwell, and flow cytometry experiments were performed to analyze the effects of circPAX3 (hsa_circ_0007333) on embryonal rhabdomyosarcoma and human embryonic kidney 293T cells. The results showed that after overexpression of circPAX3, the growth activity and proliferation ability of RD and HEK293T cells were significantly increased, the invasion / migration ability was significantly enhanced, and the level of cell apoptosis was significantly decreased ( Figure 8-9 ).

[0072] Twelve male BALB / c nude mice aged 4-6 weeks (purchased from Beijing Sibeifu Co., Ltd.) were randomly selected and housed in a sterile barrier environment in an SPF-level animal experiment center. The experimental procedures adhered to animal ethics and the experimental protocol was approved by the Animal Experiment Ethics Committee. RD and HEK293T stably transfected cells overexpressing circPAX3 in the logarithmic growth phase and their blank control cells were digested and centrifuged, and 1×10 7 / 200μL / mouse and 5×10 6 The cells were added to the matrix gel in equal proportions (200 μL / mouse) and mixed thoroughly. The cells were then inoculated subcutaneously in the groin of nude mice. The blank control cells were inoculated in the left groin, and the cells stably overexpressing circPAX3 were inoculated in the right groin. The tumor formation was observed. The tumor size was 1 cm. 3 The nude mice were then anesthetized and killed by cervical dislocation, and the tumor tissues were removed and photographed. In the nude mouse subcutaneous tumor model, upregulation of circPAX3 levels significantly promoted the subcutaneous growth of rhabdomyosarcoma cells and human embryonic kidney cells ( Figure 10-11 ).

[0073] In summary, the present invention discovered a target associated with the formation of the PAX3-related fusion gene in alveolar rhabdomyosarcoma: an R-loop site where circPAX3 (circ_0007333) hybridizes with PAX3. DRIP-seq revealed the presence of numerous R-loop structures in alveolar rhabdomyosarcoma cells. CircRNA sequencing revealed the presence of multiple circRNAs in the nuclei of alveolar rhabdomyosarcoma cells. RNase R and RNase H treatment of the DRIP products followed by qPCR confirmed the presence of the circPAX3 R-loop. This target has important clinical application value in developing diagnostic reagents or kits for alveolar rhabdomyosarcoma, as well as drugs or gene therapy strategies for the prevention and / or treatment of alveolar rhabdomyosarcoma.

[0074] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A molecular marker for alveolar rhabdomyosarcoma, characterized in that: The molecular marker is the circPAX3 R-loop site, and its DNA-RNA hybridization region is located at chr2:223094913-223095853 of the human genome.

2. The molecular marker for alveolar rhabdomyosarcoma according to claim 1, characterized in that It is formed by hybridization of circPAX3 (circ_0007333) and PAX3 gene.

3. The molecular marker for alveolar rhabdomyosarcoma according to claim 2, characterized in that: The circPAX3R-loop promotes the malignant biological behavior of tumor cells by upregulating circPAX3 (circ_0007333).

4. A primer set for detecting the molecular marker of alveolar rhabdomyosarcoma according to any one of claims 1 to 3, characterized in that: The sequences of the primer set are shown in SEQ ID No: 1 and SEQ ID No:

2.

5. A primer set for detecting circPAX3 (circ_0007333), characterized in that: The sequences of the primer set are shown in SEQ ID No: 3 and SEQ ID No:

4.

6. A probe for detecting circPAX3 (circ_0007333), characterized in that The sequence of the probe is shown in SEQ ID No:

5.

7. Use of the molecular marker for alveolar rhabdomyosarcoma according to any one of claims 1 to 3, characterized in that: The molecular marker is used in the preparation of products for diagnosing and / or preventing and treating alveolar rhabdomyosarcoma.

8. The use according to claim 7, characterized in that The product is a reagent or kit for diagnosing alveolar rhabdomyosarcoma, or a drug for preventing and / or treating alveolar rhabdomyosarcoma.

9. Use of the molecular marker for alveolar rhabdomyosarcoma according to any one of claims 1 to 3, characterized in that: The molecular marker is used in screening drugs for preventing and / or treating alveolar rhabdomyosarcoma.

10. A kit for diagnosing alveolar rhabdomyosarcoma, characterized in that: A primer set comprising the molecular marker for detecting alveolar rhabdomyosarcoma according to claim 4.