Method for constructing CDKL5 deficiency humanized mutation animal model and application of CDKL5 deficiency humanized mutation animal model
By knocking in the human CDKL5 gene R550X mutation in experimental animals using CRISPR-Cas9 gene editing technology, a humanized mutation model of CDKL5 deficiency was constructed, which solved the problem that existing models could not accurately simulate human CDKL5 deficiency and enabled the testing of disease simulation and treatment strategies.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-23
- Publication Date
- 2026-03-10
AI Technical Summary
Existing CDKL5 deficiency mouse models cannot accurately mimic the genetic changes in human CDKL5 deficiency, and therefore cannot be used to develop human genome-specific precision gene therapy strategies.
Using the CRISPR-Cas9 gene editing method, the human CDKL5 gene R550X mutation and its upstream and downstream genomic sequences were knocked into the CDKL5 gene locus of experimental animal genomes to construct a humanized mutant animal model of CDKL5 deficiency, simulating the disease mutation of the C-terminal domain of the CDKL5 protein.
The constructed animal model exhibits CDKL5 deficiency-like behavioral abnormalities, which can be used for disease simulation, pathogenesis analysis, and testing of human genome-specific gene editing repair strategies and therapeutic drugs.
Smart Images

Figure CN121628979A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology and relates to a method for constructing a humanized mutant animal model of CDKL5 deficiency and its application. Background Technology
[0002] The cyclin-dependent kinase-like 5 (CDKL5) gene belongs to the serine / threonine protein kinase family and encodes a phosphorylated protein with protein kinase activity that is highly expressed in the brain. It is crucial for normal brain development and function, regulating cell proliferation, neuronal migration, axonal growth, dendritic morphogenesis, and synaptic development. CDKL5 gene mutations, initially classified as a variant of Rett syndrome, are now considered an independent, severe developmental and epileptic encephalopathy—CDKL5 deficiency—characterized by early-onset epilepsy and other clinical symptoms including intellectual disability, autistic features, motor disorders, and generalized developmental delay. More than 265 pathogenic mutations have been reported in the CDKL5 gene, including insertions / deletions, frameshift mutations, and nonsense mutations. Currently, treatment options for these patients are limited to supportive measures aimed at alleviating their symptoms; there are no therapies that can correct CDKL5 gene mutations or effectively replace their deficiencies. Developing animal models of CDKL5 deficiency is of great significance for further elucidating its pathogenesis and developing potential therapeutic approaches.
[0003] Currently, CDKL5 gene knockout mouse models of CDKL5 deficiency have been reported, but there are still some bottlenecks. For example, there is a lack of mutation knock-in mouse models that accurately simulate the genetic information changes in CDKL5 deficiency patients. The specific mechanisms, pathological and behavioral abnormalities caused by mutations at different sites / domains may differ, and more disease mutation knock-in models need to be established to reveal these differences. Currently developed CDKL5 disease mutation knock-in mice usually only knock in single-base mutations of the disease. Due to the differences in gene sequences near the disease mutation sites between humans and mice, they cannot be used to develop human genome-specific precision gene therapy strategies.
[0004] In conclusion, how to construct an effective animal model that simulates human CDKL5 deficiency remains one of the most pressing problems to be solved in the field of CDKL5 deficiency. Summary of the Invention
[0005] In view of the shortcomings of existing technologies and practical needs, this invention provides a method for constructing a humanized mutant animal model of CDKL5 deficiency and its application, in order to obtain an animal model that can realistically and effectively simulate human CDKL5 deficiency.
[0006] To achieve this objective, the present invention adopts the following technical solution:
[0007] In a first aspect, the present invention provides a method for constructing a humanized mutant animal model of CDKL5 deficiency, the method comprising:
[0008] The human CDKL5 gene R550X mutation and its upstream and downstream genomic sequences were knocked into the CDKL5 gene locus of experimental animal genomes to obtain the humanized mutant animal model of CDKL5 deficiency.
[0009] This invention employs a novel construction strategy to knock the human CDKL5 gene R550X mutation and its upstream and downstream genomic sequences into the CDKL5 gene locus of experimental animal genomes. This effectively simulates disease mutations in the C-terminal domain of the CDKL5 protein, and the model possesses humanized mutation sites and nearby genomic sequences, meaning it has the same gene sequence to be repaired as clinical patients. This model can be used for disease simulation of CDKL5 deficiency, pathogenesis analysis, and to directly test human genome-specific gene editing repair strategies and therapeutic drugs in vivo, which is of great significance to the treatment of CDKL5 deficiency.
[0010] Preferably, the length of the human CDKL5 gene R550X mutation and its upstream and downstream genomic sequences is 18 to 30 bp, including but not limited to 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29 bp.
[0011] Preferably, the human CDKL5 gene R550X mutation and its upstream and downstream genomic sequences include the sequence shown in SEQ ID NO.1.
[0012] SEQ ID NO. 1: 5'-TCTGGAAGAAATAACTGAAA-3'.
[0013] Preferably, the experimental animals include any one of mice, rats, rabbits, pigs, or non-human primates.
[0014] It is understood that all gene knock-in methods commonly used in this field are theoretically applicable to this invention, and can be selected according to the actual situation.
[0015] Preferably, the knock-in method includes the CRISPR-Cas9 gene editing method.
[0016] Preferably, the CRISPR-Cas9 gene editing method specifically includes: introducing Cas9 protein, guide RNA, and homologous recombination repair template into the pronucleus of a fertilized egg via microinjection. Preferably, the nucleic acid sequence of the guide RNA used in the CRISPR-Cas9 gene editing method includes the sequence shown in SEQ ID NO.2.
[0017] Preferably, the nucleic acid sequence of the homologous recombination repair template used in the CRISPR-Cas9 gene editing method includes the sequence shown in SEQ ID NO.3.
[0018] SEQ ID NO. 2: 5'-TTCTATTATTTCGACCGGAA-3'.
[0019] SEQ ID NO.3:
[0020] 5'-GGCACACTGATACGAGAACTTTGCTCAGCCCTTCTGGAAGAAATA ACTGAAATGAAGGCACTCTGGACTCACGGCGAACCACCACTAGACACTC AAAAAC-3'.
[0021] As a preferred technical solution, the method for constructing a humanized mutant animal model of CDKL5 deficiency includes the following steps:
[0022] (1) A CRISPR-Cas9 gene editing system was prepared, comprising guide RNA, Cas9 enzyme and homologous recombination repair template, wherein the nucleic acid sequence of the guide RNA comprises the sequence shown in SEQ ID NO.2 and the nucleic acid sequence of the homologous recombination repair template comprises the sequence shown in SEQ ID NO.3;
[0023] (2) The CRISPR-Cas9 gene editing system was introduced into the fertilized eggs of experimental animals, and the fertilized eggs were transplanted into pseudopregnant experimental animals until they became pregnant and gave birth.
[0024] (3) Select the correct knock-in offspring to obtain a humanized mutant animal model of CDKL5 deficiency.
[0025] The animal models constructed in this invention exhibited CDKL5 deficiency-like behavioral abnormalities in behavioral experiments. Taking the mouse model as an example, in the hind-limb clasping test (reflecting motor function), compared to the control group, the mouse model showed CDKL5 deficiency-like motor impairment; in the three-chamber test (reflecting social interaction behavior), the mouse model also showed behavioral abnormalities. These CDKL5 deficiency-like behavioral manifestations indicate that this model can be used for disease simulation, pathogenesis analysis, and intervention strategy research of CDKL5 deficiency.
[0026] In a second aspect, the present invention provides the application of animal models prepared by the method for constructing humanized mutant animal models of CDKL5 deficiency as described in the first aspect in analyzing the pathogenesis of CDKL5 deficiency or in preparing diagnostic and monitoring products for CDKL5 deficiency.
[0027] The humanized mutant animal model of CDKL5 deficiency constructed based on this invention can be used to further analyze the pathogenesis of CDKL5 deficiency, or to develop and test diagnostic and monitoring products for CDKL5 deficiency.
[0028] Thirdly, the present invention provides the use of animal models prepared by the method for constructing humanized mutant animal models of CDKL5 deficiency as described in the first aspect in evaluating and / or screening treatment methods or therapeutic drugs for CDKL5 deficiency.
[0029] The humanized mutant animal model of CDKL5 deficiency constructed based on this invention can be used to further evaluate and / or screen treatment methods or drugs for CDKL5 deficiency. By testing the effects of the treatment methods or drugs to be screened on the animal model, effective treatment plans can be developed.
[0030] Compared with the prior art, the present invention has at least the following beneficial effects:
[0031] This invention employs a novel construction strategy and a gene-editing system to knock the human CDKL5 gene R550X mutation and its upstream and downstream genomic sequences into the CDKL5 gene locus of experimental animals. This effectively simulates disease mutations in the C-terminal domain of the CDKL5 protein, and the model possesses humanized mutation sites and nearby genomic sequences, meaning it has the same gene sequence to be repaired as clinical patients. The constructed animal model exhibits CDKL5 deficiency-like behavioral abnormalities and can be used for disease simulation of CDKL5 deficiency, pathogenesis analysis, and direct testing of human genome-specific gene-editing repair strategies and therapeutic drugs in vivo. This has significant implications for the treatment of CDKL5 deficiency. Attached Figure Description
[0032] Figure 1 Design strategy diagram for humanized CDKL5 R550X knock-in mice;
[0033] Figure 2 A schematic diagram of the mouse model identification strategy;
[0034] Figure 3 Maps of wild-type and humanized mutant knock-in genome sequences;
[0035] Figure 4A Genotyping diagram of a mouse model;
[0036] Figure 4BA graph showing the phosphorylation levels of CDKL5 protein and its substrates in the brain of a mouse model.
[0037] Figure 5 This is a graph showing the results of the hindlimb clamping test in a mouse model.
[0038] Figure 6 Figure A shows the social behavior detection results of a mouse model. Figure B shows the detection process, Figure C shows the results of the second stage of detection, and Figure C shows the results of the third stage of detection. Detailed Implementation
[0039] The technical solution of the present invention will be further described below with reference to the accompanying drawings and specific embodiments. However, the following examples are merely simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention is determined by the claims.
[0040] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased from legitimate channels.
[0041] This invention designs an animal model for knocking in humanized disease mutations in CDKL5 and its construction method. The CDKL5R550X disease mutation (c.1648C>T(p.Arg550Ter)) and its nearby human genomic sequence are knocked into the endogenous site of the CDKL5 gene in experimental animals to construct a model. This model can be used for disease modeling and pathogenesis research related to CDKL5. Furthermore, this model simultaneously carries the CDKL5 R550X mutation and the nearby human genomic sequence, which can be directly used to test and evaluate human genome-specific precision gene editing therapeutic strategies. The specific principle is as follows: Guide RNA binds to the target DNA using sequence complementarity, guiding a nuclease (Cas9) to locate the target genomic site (Cdkl5 R550) for DNA double-strand cleavage. Combined with the humanized R550X mutation homologous recombination repair template, the precise knock-in of the humanized R550X mutation is achieved in experimental animal fertilized eggs / embryos through the DNA homologous recombination repair mechanism.
[0042] In a specific embodiment of the present invention, mice are used as experimental animals to verify the solution of the present invention.
[0043] Example 1
[0044] This embodiment constructs a CDKL5 humanized disease mutant mouse model.
[0045] (1) Constructing a Cdkl5 R550 targeted gene editing system and a humanized mutation repair template
[0046] Based on the genomic sequence near amino acid position 550 of exon 12 in the mouse Cdkl5 transcript Cdkl5-201 (ENSMUST00000087104.11), a CRISPR guide RNA system targeting the R550 site was designed (guide RNA sequence SEQ ID NO. 2). Simultaneously, a homologous recombination repair single-stranded DNA template for R550X humanized mutation knock-in was designed (during homologous recombination repair, the single-stranded DNA template uses the flanking homologous arms to replace the c.1633-1652 sequence of mouse Cdkl5-201 with the TCTGGAAGAAATAACTGAAA sequence; the repaired mouse genome will simultaneously contain the nearby base sequences of both the R550X mutation and the humanized sequence, thus directly applicable for the development and evaluation of precision gene editing therapies for CDKL5 R550X mutant patients). Related plasmids were constructed, and guide RNA was transcribed in vitro. The homologous recombination repair single-stranded DNA template (Donor) was synthesized. The design strategy diagram is shown below. Figure 1 As shown.
[0047] The sequence of the homologous recombination repair single-stranded DNA template is shown in SEQ ID NO.3.
[0048] (2) Microinjection
[0049] The CRISPR / Cas9 system and homologous recombination repair template sample were microinjected into mouse zygotes with a C57BL / 6JGpt background; the surviving zygotes after injection were transplanted into pseudopregnant female mice, and the mice were allowed to become pregnant and give birth.
[0050] (3) Identification of F0 generation mice
[0051] F0 generation pups born to recipient mice were tail-cropped and toes-cropped at 5-7 days of age for numbering. Genomic DNA was extracted for PCR and sequencing identification to confirm genotype. A schematic diagram of the identification strategy is shown below. Figure 2 As shown in Table 1, the PCR and sequencing primer information is shown in Table 2, and the PCR reaction conditions are shown in Table 2.
[0052] Table 1
[0053]
[0054] Table 2
[0055]
[0056] (4) Breeding of positive F0 generation mice
[0057] After reaching sexual maturity, positive F0 generation mice were mated with wild-type background mice. The resulting F1 generation mice were tail-cropped and toe-cropped at 5-7 days of age for numbering. Genomic DNA was extracted for PCR and sequencing to confirm genotype. The identification protocol follows step (3). Wild-type and humanized mutant knock-in genome sequences are as follows: Figure 3 As shown, in the wild-type genome sequence, Exon12 is blue, the guide RNA target base sequence is red, and the sequence to be humanized is underlined; in the humanized mutant knock-in genome sequence, Exon12 is red, and the humanized mutant sequence is blue and underlined; it can be seen that the genome sequence at the underlined location has been successfully replaced by the humanized mutant sequence, indicating that the present invention has successfully constructed a CDKL5 humanized mutant mouse model.
[0058] Example 2
[0059] This embodiment further validates the CDKL5 humanized mutant mouse model constructed in Example 1.
[0060] Sanger sequencing revealed that the model mice carried the humanized knock-in Cdkl5 R550X mutation. Figure 4A Furthermore, the phosphorylation levels of Cdkl5 protein and its substrates in the brains of mutant mice were abnormally reduced. Figure 4B ).
[0061] Mouse motor and autism-like behavioral tests, including relevant routine behavioral testing methods:
[0062] Hind-limb clasping test: The mouse is held by its tail and suspended in the air for observation and scoring. The criteria are as follows: 0 = both legs spread outwards; 1 = hind limbs pull towards each other (but do not touch) or one leg is drawn inwards towards the body; 2 = both legs are tightly tucked in.
[0063] The Three Chambers Test: The experiment consists of two phases. In the first phase, a mouse is placed on one side of the three chambers, and an empty cage is placed on the other side. The social interest of the experimental mouse towards a familiar mouse and an empty cage is observed, and the interaction time between the experimental mouse and the familiar mouse is recorded. In the second phase, another unfamiliar mouse of the same species is placed on the other side of the three chambers. The social interest and memory of the experimental mouse towards the familiar mouse and the unfamiliar mouse are observed, and the interaction time between the experimental mouse and the familiar mouse and the unfamiliar mouse is recorded respectively.
[0064] The results of the hindlimb clamping test are as follows: Figure 5 As shown, the mouse model exhibited CDKL5 deficiency-like behavioral abnormalities, compared to wild-type (CDKL5) mice. + / y Compared to the control group, CDKL5 mutant male mice (CDKL5) hR550X / y) exhibited CDKL5 deficiency-like motor dysfunction; in the three-box test reflecting social interaction behavior, such as Figure 6 As shown, CDKL5 mutant male mice (CDKL5) hR550X / y They also exhibited behavioral abnormalities. These CDKL5 deficiency-like behavioral manifestations suggest that the model can be used for disease simulation, pathogenesis analysis, and intervention strategy research of CDKL5 deficiency.
[0065] In summary, this invention presents a novel strategy for constructing an animal model of CDKL5 deficiency. It designs a CDKL5 R550 gene editing system and a humanized mutation repair template, enabling the knock-in of a humanized CDKL5 R550X disease mutation (c.1648C>T(p.Arg550Ter)) into the genome of experimental animals. This mutation can be used for CDKL5 disease modeling and pathogenesis research. Furthermore, carrying the CDKL5 R550X mutation and nearby human genome sequences allows for direct testing and evaluation of human genome-specific treatment strategies.
[0066] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention fall within the protection and disclosure scope of the present invention.
Claims
1. A method of constructing a CDKL5 deficiency disorder humanized mutant animal model, characterized in that, The method comprises: The human CDKL5 gene R550X mutation and its upstream and downstream genomic sequences are knocked into the CDKL5 gene site of the genome of the experimental animal to obtain the CDKL5 deficiency syndrome humanized mutant animal model.
2. The method of claim 1, wherein the CDKL5 deficiency disorder humanized mutant animal model is constructed by, The length of the human CDKL5 gene R550X mutation and its upstream and downstream genomic sequences is 18-30 bp.
3. The method of claim 1 or 2, wherein the method comprises the steps of: The human CDKL5 gene R550X mutation and its upstream and downstream genomic sequences comprise the sequence shown in SEQ ID NO.
1.
4. The method of claim 1-3 for constructing a CDKL5 deficiency disorder humanized mutant animal model, wherein, The experimental animal includes any one of a mouse, a rat, a rabbit, a pig, or a non-human primate.
5. The method of claim 1-4 for constructing a CDKL5 deficiency disorder humanized mutant animal model, wherein the CDKL5 gene is replaced by the human CDKL5 gene. The method of knocking in comprises a CRISPR-Cas9 gene editing method. 6. The method of claim 5, wherein the CDKL5 deficiency disorder humanized mutant animal model is constructed by, The nucleic acid sequence of the guide RNA used in the CRISPR-Cas9 gene editing method comprises the sequence shown in SEQ ID NO.
2.
7. The method of claim 5 or 6, wherein the CDKL5 deficiency disorder animal model is a mouse model. The nucleic acid sequence of the homologous recombination repair template used in the CRISPR-Cas9 gene editing method comprises the sequence shown in SEQ ID NO.
3.
8. The method of claim 1-7, wherein the method of constructing a CDKL5 deficiency disorder humanized mutant animal model is characterized by, The method comprises the following steps: (1) preparing a CRISPR-Cas9 gene editing system, including a guide RNA, a Cas9 enzyme, and a homologous recombination repair template, the nucleic acid sequence of the guide RNA comprising the sequence shown in SEQ ID NO. 2, and the nucleic acid sequence of the homologous recombination repair template comprising the sequence shown in SEQ ID NO. 3; (2) introducing the CRISPR-Cas9 gene editing system into a fertilized egg of an experimental animal, and transplanting the fertilized egg into a pseudopregnant experimental animal, and waiting for it to become pregnant and give birth to a baby; (3) screening the correct knock-in baby to obtain the CDKL5 deficiency syndrome humanized mutant animal model.
9. Use of the animal model prepared by the method of any one of claims 1-8 for analyzing the pathogenesis of CDKL5 deficiency syndrome or preparing a CDKL5 deficiency syndrome diagnosis and monitoring product.
10. Use of the animal model prepared by the method of any one of claims 1-8 for evaluating and / or screening a CDKL5 deficiency syndrome treatment method or therapeutic drug.