DNA molecular marker related to rice cold-tolerant gene haplotype and application of DNA molecular marker

Abstract

The invention relates to the technical field of functional molecular markers, in particular to a DNA molecular marker related to rice cold-tolerant gene haplotype and application of the DNA molecular marker. The haplotype of the rice cold-resistant gene COLD1 is composed of SNP145938700 and SNP145938916, and the haplotype of the rice cold-resistant gene COLD1 is composed of When corresponding basic groups of the two SNPs are detected to be AG, the two SNPs are favorable haplotypes (Hap2) of the COLD1 gene, and the cold resistance in the bud stage is high. The molecular marker provided by the invention can be used for haplotype analysis of COLD1 genes with the cold resistance in the bud stage of different rice materials, breeding materials with the cold resistance in the bud stage are screened through the molecular marker, and compared with traditional phenotype screening, time and labor are saved, efficiency is high, and cost is saved; the method can be applied to molecular breeding, and the breeding efficiency is improved.

Description

Technical Field

[0001] The invention relates to the technical field of functional molecular markers, and in particular to a DNA molecular marker related to a haplotype of a rice cold-resistance gene and an application thereof. Background Art

[0002] At present, low temperature and cold damage has become a common agricultural meteorological disaster throughout the country. It often occurs in the early rice planting areas in the middle and lower reaches of the Yangtze River, the rice areas in the northeast and northwest, the double-season early rice areas in Sichuan, and the single-season rice areas in the Yunnan-Guizhou Plateau. Especially in the early rice production process in the south, frequent "late spring cold" weather leads to the reduction of rice seedling quality, causing rotten seeds, rotten seedlings, and dead seedlings. However, with global climate change, the breeding time of early rice and double-season rice in the middle and lower reaches of the Yangtze River and South my country has generally moved forward in recent years, and even the seedling raising time in some areas has been advanced from mid-April to early March, further increasing the possibility of low temperature stress during rice sowing and seedling raising. Production practice shows that cultivating and planting early rice or regenerated rice varieties that are cold-resistant in the bud stage and cold-resistant in the seedling stage is the most economical and effective way to solve the above problems.

[0003] Cold tolerance at the bud stage and seedling stage are complex traits controlled by multiple genes, which are easily affected by environmental conditions and show complex interactions. Currently, multiple related QTLs have been located and multiple cold tolerance genes have been cloned, such as OsFAD2, OsSAP1, OsRZFP1, CBF1, OsDREB1A, OsCBL1, OsP5CS1, OsABF1, OsCYP20-2, OsPIL1, OsHSP101, OsCPI1, OsTLP1, OsICE1, LTT7, LTG1, COLD1, bZIP73 and HAN1. Among them, COLD1 gene is an important cold-resistance gene in rice, located on chromosome 4; COLD1 is a receptor that mediates cold stress perception in rice, controlling its resistance to cold stress (0-15℃); COLD1 can interact with the α-subunit RGA1 of the G protein heterotrimer in plants, promote the activity of G protein GTPase, and activate Ca2+ in response to low temperature. 2+ The COLD1 gene is a gene that regulates the growth of rice and enhances its ability to survive under low temperature conditions. This mechanism may play a role in different growth stages of rice, such as the bud stage and the seedling stage. Studies have shown that overexpression of the COLD1 gene can significantly improve the cold tolerance of rice, while rice strains that lack or underexpress the COLD1 gene are more sensitive to low temperatures. There is a single nucleotide mutation in the fourth exon region of the COLD1 gene (CDS region 1091), which is T or C in indica rice and A in japonica rice, which causes the amino acid it encodes to change from methionine / threonine to lysine, thus giving japonica rice a stronger cold tolerance trait than indica rice at the seedling stage.

[0004] Although the function and mechanism of action of the COLD1 gene have been studied in recent years, there are few reports on the differences in cold resistance of different materials caused by SNP differences in the regulatory region of the COLD1 gene in rice, which lead to changes in the expression of the COLD1 gene and thus cause differences in cold resistance. There is a lack of further exploration of the favorable haplotypes of the COLD1 gene. Summary of the invention

[0005] In view of the above-mentioned deficiencies in the prior art, the purpose of the present invention is to provide a DNA molecular marker associated with an excellent haplotype of the rice cold-tolerant gene COLD1. This molecular marker can be used to create new rice germplasms that are cold-tolerant at the bud stage and cultivate new varieties through MAS (molecular marker-assisted breeding) technology to solve the problem of cold stress at the bud stage in the production of early rice and regenerated rice.

[0006] In order to achieve the above-mentioned object of the invention, the technical solution adopted by the present invention is:

[0007] In the first aspect, a DNA molecular marker related to a haplotype of a cold-tolerant gene of rice is provided. The haplotype of the cold-tolerant gene COLD1 of rice is composed of SNP145938700 and SNP145938916 located in the upstream regulatory region of the gene, wherein the SNP145938700 detection molecular marker is Cold1-1-kasp, which is used to distinguish between T or A bases at physical position 30316708 (SNP145938700); the SNP145938916 detection molecular marker is Cold1-2-kasp, which is used to distinguish between G or T bases at physical position 30316924 (SNP145938916); or complementary bases at the above-mentioned sites.

[0008] The detection primer sequences of molecular markers Cold1-1-kasp and Cold1-2-kasp are:

[0009] 1)Cold1-1-kasp

[0010] 708FAM:GAAGGTGACCAAGTTCATGCTGTGCTGCGTGCGTTCCT,

[0011] 708HEX:GAAGGTCGGAGTCAACGGATTGTGCTGCGTGCGTTCCA,

[0012] 708C:TCTCCTGTAGCTTCCTCTTC;

[0013] 2) Cold1-2-kasp

[0014] 924FAM:GAAGGTGACCAAGTTCATGCTGCGCGCGCGACGCTAAACTTGCTTG,

[0015] 924HEX:GAAGGTCGGAGTCAACGGATTGCGCGCGCGACGCTAAACTTGCTTT,

[0016] 924C:CGTGGTCTCGCATCTCCCG.

[0017] In a second aspect, a method for identifying haplotypes of rice cold-tolerance genes based on the above-mentioned DNA molecular markers is provided, wherein the kasp molecular marker is used, and the kasp molecular marker primer combination includes 2 specific primers and 1 universal primer; wherein the 5′ end of one specific primer is connected to a fluorescent label FAM, and the product carrying the FAM sequence after PCR amplification displays red under fluorescent irradiation; the 5′ end of the other specific primer is connected to a fluorescent label HEX, and the product carrying the HEX sequence after PCR amplification displays blue under fluorescent irradiation; if the product displays superimposed colors under fluorescent irradiation, the genotype of the rice material to be tested is heterozygous;

[0018] Cold1-1-kasp marker detection 30316708 position, PCR product is subjected to fluorescence signal scanning, if the product shows red after fluorescence irradiation, the genotype of the rice kasp marker Cold1-1-kasp to be tested is TT; if the product shows blue after fluorescence irradiation, the genotype of the rice kasp marker Cold1-1-kasp to be tested is AA; if the product shows superimposed colors after fluorescence irradiation, the genotype of the rice kasp marker Cold1-1-kasp to be tested is AT heterozygous;

[0019] The Cold1-2-kasp marker was detected at position 30316924, and the PCR product was scanned for fluorescence signals. If the product showed red after fluorescence irradiation, the genotype of the rice kasp marker Cold1-2-kasp to be tested was GG; if the product showed blue after fluorescence irradiation, the genotype of the rice kasp marker Cold1-2-kasp to be tested was TT; if the product showed superimposed colors after fluorescence irradiation, the genotype of the rice kasp marker Cold1-2-kasp to be tested was GT heterozygous.

[0020] Furthermore, when the base detected by SNP145938700 and SNP145938916 is TT or the corresponding complementary base AA, the haplotype is Hap1; when the base detected by SNP145938700 and SNP145938916 is AG or the corresponding complementary base TC, the haplotype is Hap2; when the base detected by SNP145938700 and SNP145938916 is AT or the corresponding complementary base TA, the haplotype is Hap3; among them, haplotype Hap2 has the strongest cold resistance in the bud stage.

[0021] The third aspect provides the application of the above-mentioned DNA molecular markers related to the haplotype of rice cold-resistance gene in the detection of excellent haplotypes of the COLD1 gene for rice cold-resistance seedling formation ability during the bud stage, germplasm purification or variety improvement.

[0022] In a fourth aspect, the invention provides the use of the above-mentioned DNA molecular markers related to the haplotype of the rice cold-resistance gene in the preparation of tools for detecting excellent haplotypes of the COLD1 gene for cold-resistance and seedling formation in rice bud stage, purifying germplasm or improving varieties.

[0023] The beneficial effects of the present invention are:

[0024] By using the kasp molecular marker corresponding to the two SNPs of the COLD1 gene developed in the present invention, a large number of germplasm resources and new breeding germplasms can be genotyped to determine the cold-resistant materials at the bud stage carrying the excellent haplotype COLD1, which is time-saving, labor-saving, efficient and cost-saving compared with traditional phenotypic screening; in addition, through hybridization, backcrossing and other technologies, MAS (molecular marker assisted breeding) is used to track the genotypes of SNP145938700 and SNP145938916, so as to achieve targeted improvement of breeding materials, improve the cold-resistant ability of the backbone parent materials at the bud stage, and then cultivate new varieties of early rice or regenerated rice with cold-resistant bud stage. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The physical locations of the four SNPs of the COLD1 gene in the embodiment;

[0026] Figure 2 This is the difference analysis of cold-resistance seedlings of 493 3K germplasms Hap1-Hap3 tested in the example;

[0027] Figure 3 The proportion of different haplotypes of 2840 3K germplasms in the embodiment;

[0028] Figure 4 The distribution of Hap1-Hap3 among different subspecies in 2840 3K germplasms in the example;

[0029] Figure 5To detect the genotyping of SNP145938700 for the molecular marker Cold1-1-kasp;

[0030] Figure 6 To detect the genotyping of SNP145938916 for the molecular marker Cold1-2-kasp;

[0031] Figure 7 It is the verification of the molecular detection results of the molecular markers Cold1-1-kasp and Cold1-2-kasp in the embodiment;

[0032] Figure 8 The results of the difference significance analysis of cold tolerance seedlings at the bud stage of 35 rice parents (conventional rice) Hap1 to Hap3 in the example;

[0033] Fig. 9 These are the results of Sanger sequencing verification of the molecular markers Cold1-1-kasp and Cold1-2-kasp in the examples. DETAILED DESCRIPTION

[0034] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0035] Example

[0036] (1) Identification of cold-tolerant phenotypes of test materials. 529 materials of the rice 3K population and 35 rice parents (conventional rice) were placed in a constant temperature oven and treated at 45°C for 2 days to reduce water content and break dormancy. 500 seeds were selected for each material, treated with 1.5% (v / v) sodium hypochlorite solution for 20 min and washed with ultrapure water. After soaking for 2 days, the seeds were germinated in a constant temperature oven at 32°C for about 1 day. When the buds were about 5 mm long, 200 seeds with consistent germination were selected for each material and placed in a seed bag and spread flat. They were transferred to a low-temperature incubator and treated at 4°C for 7 days. After the treatment, the seeds of each material were spread flat in a 9 cm diameter culture dish lined with filter paper, with 30 seeds per dish, and each material was repeated 3 times. Water was added to make 1 / 2 of the volume of the seeds submerge the culture dish. The dish was placed at 28°C and under normal light. The rice buds were allowed to resume normal growth for 10 days. The number of surviving seedlings was investigated and the seedling rate was calculated.

[0037] (2) Extraction of COLD1 gene SNP information. Log in to the National Rice Data Center Gene Bank (RiceData) to search for COLD1 gene information, the Gene ID is LOC_Os04g51180, and use the Gene ID to search for the COLD1 gene sequence information of Nipponbare (genome version number IRGSP-1.0) (Rice Genome Annotation The positive strand sequence of COLD1 gene CDS region was 30316303~30311519; the genomic SNP information of rice 3K data (3024 germplasms) was downloaded (snp-seek.irri.org / _download.zul), and the SNP information of COLD1 gene CDS region and 2kb upstream and 1kb downstream of 529 3K germplasm resources used in the experiment was extracted by Plink software, and filtered. The filtering conditions were: delete SNPs with deletion rate>0.2, delete individuals with deletion rate>0.2, and remove SNPs with low MAF frequency (<0.05). After filtering, 4 3K germplasms used in the experiment were left. 93 copies; 4 SNP sites were obtained in the CDS region of COLD1 gene and the upstream 2kb and downstream 1kb intervals, with physical positions of Chr4-30313615 (SNP145935607, G / A), Chr4-30314997 (SNP145936989, A / G), Chr4-30316708 (SNP145938700, T / A), and Chr4-30316924 (SNP145938916, T / G), of which 30313615 and 30314997 were mutation sites in the intron region of COLD1 gene CDS, and 30316708 and 30316924 were physical positions of 2 SNPs in the upstream of COLD1 gene (Up stream gene variant) ( Figure 1 ). The above conditions were also used to filter 3024 3K germplasm materials and SNPs, and after filtering, 2840 3K germplasms remained.

[0038] (3) Haplotype analysis of COLD1 gene. The geneHapR package of R language was used to perform haplotype analysis on two SNPs (SNP145938700 and SNP145938916) in the upstream regulatory region of COLD1 gene in 493 3K germplasms after filtering. The results showed that the 493 germplasms were divided into three haplotypes, Hap1 accounted for 62.27%, of which indica rice accounted for 73.29% and japonica rice accounted for 22.48%, which was the main haplotype of COLD1 gene; Hap2 accounted for 27.99%, of which indica rice accounted for 47.10% and japonica rice accounted for 52.17%; Hap3 accounted for 9.74%, and the main rice type was Aus rice, accounting for 79.17%, followed by indica rice, accounting for 14.58% (Table 1). The seedling rate under cold stress at the bud stage was Hap2 (62.76%) > Hap1 (55.88%) > Hap3 (48.25%); the significant difference analysis of the three haplotypes showed that there was no significant difference in cold tolerance at the bud stage between haplotypes Hap1 and Hap3, while the cold tolerance at the bud stage of Hap2 was significantly higher than that of Hap1 and Hap3, indicating that Hap2 is a favorable haplotype of the COLD1 gene and can be used for molecular breeding applications such as the creation of new rice germplasm with cold tolerance at the bud stage or the selection of new varieties ( Figure 2 ).

[0039] Table 1 Three haplotypes of COLD1 gene

[0040]

[0041]

[0042] (4) Haplotype distribution of COLD1 gene. Haplotype analysis of two SNPs (SNP145938700 and SNP145938916) of COLD1 gene in 2840 filtered 3K germplasms was performed using the geneHapR package of R language. The results showed that the haplotype ratio was Hap1 (61.76%) > Hap2 (30.21%) > Hap3 (8.03%) ( Figure 3 ). Hap1 is the main haplotype of COLD1 gene, and the main rice types are indica rice and indica-biased types (Indica III, Indadx, Indica II, Indica I), followed by japonica rice and japonica-biased types (TRJ, TEJ, Japadx), and all rice types are distributed; Hap2 mainly includes indica rice and japonica rice; Hap3 mainly includes Aus and indica-biased types, with less japonica rice ( Figure 4 ).

[0043] (5) Development of kasp molecular markers. The kasp detection markers for two SNPs of the COLD1 gene were developed using Primer5 software (Table 2). The two kasp molecular marker primer combinations include two specific primers and one universal primer, respectively; one of the specific primers is connected to a fluorescent label FAM at the 5′ end, and the product carrying the FAM sequence after PCR amplification will display red under fluorescent irradiation; the other specific primer is connected to a fluorescent label HEX at the 5′ end, and the product carrying the HEX sequence after PCR amplification will display blue under fluorescent irradiation. The SNP145938700 detection molecular marker is Cold1-1-kasp, which is used to distinguish between T or A bases at position 30316708. After PCR amplification, it will display red (FAM) for AA type, blue (HEX) for TT type, and green for TA type (heterozygous type) under fluorescent irradiation ( Figure 5 ); SNP145938916 detection molecular marker Cold1-2-kasp, used to distinguish the 30316924 G or T base, after PCR amplification, red (FAM) is displayed for GG type, blue (HEX) is displayed for TT type, and green is displayed for GT type (heterozygous type) ( Figure 6 ). The two kasp molecular markers were used to perform genotyping on the two SNP loci of the test materials. The test results of 30316708 (SNP145938700) and 30316924 (SNP145938916) were haplotype Hap1 when TT, haplotype Hap2 when AG, and haplotype Hap3 when AT; Hap2 was a rice material with cold tolerance in the bud stage.

[0044] Table 2 Two SNP molecular markers of COLD1 gene

[0045]

[0046] (6) Molecular marker verification of the haplotype kasp of the COLD1 gene. The DNA of the test materials was extracted by the CTAB method, and 15 germplasms (3K materials) of Hap1 to Hap3 of the COLD1 gene haplotype analysis were used for molecular marker verification. PARMS 2X Master Mix was provided by Wuhan Jingpeptide Biotechnology Co., Ltd. PARMS2X Master Mix contains 2 fluorescent universal primers FAM and HEX. The FAM fluorescent sequence is GAAGGTGACCAAGTTCATGCT, and the HEX fluorescent sequence is GAAGGTCGGAGTCAACGGATT; molecular marker Cold1-1-kasp and Cold1-2-kasp primers were synthesized by Beijing Qingke Xinye Biotechnology Co., Ltd. The PCR amplification system was 10 μL, and the system composition was PARMS2X Master Mix 5 μL, 10 μmol·L-1 0.15 μL of 924FAM, 924HEX (or 708FAM, 708HEX) primers, 0.4 μL of 924C (or 708C) primers, 1 μL of DNA (concentration 10-100 ng), 3.3 μL of ddH2O; using Archimed TM Version 2.0 real-time fluorescence quantitative PCR was used for amplification and fluorescence capture; the reaction procedure was 94℃ pre-denaturation for 15min; 94℃ denaturation for 20s, 65℃ (-0.8℃ per cycle) for 1min, 10 cycles; 94℃ denaturation for 20s, 57℃ annealing for 1min, 30 cycles; 37℃ fluorescence capture for 1min. The kasp analysis results showed that the genotyping results of molecular markers Cold1-1-kasp and Cold1-2-kasp were completely consistent with the SNP information of the test materials (snp-seek.irri.org / _download.zul) (Table 3, Figure 7 ), indicating that the molecular markers Cold1-1-kasp and Cold1-2-kasp can be used for the molecular detection of two SNPs (SNP145938700 and SNP145938916) in the upstream regulatory region of the COLD1 gene.

[0047] Table 3 Kasp typing results of 45 3K germplasm resources

[0048]

[0049]

[0050] (7) Haplotype analysis of COLD1 gene in 35 rice parents (conventional rice). Molecular markers Cold1-1-kasp and Cold1-2-kasp were used to perform kasp typing on two SNP loci of the 35 rice parents (conventional rice) tested. Among them, 21 materials such as Guanghui 398, Meishanzhan 2, and Nanjing 5718 were Hap2, and the cold-resistant seedling rate at the bud stage was between 42.2% and 100.0%; 14 materials such as Minghui 63, R9311, and Jingguizhan were Hap3, and the cold-resistant seedling rate at the bud stage was 0.00% to 32.2%; while Hap1 was not detected (Table 5); the cold-resistant ability of haplotype Hap2 at the bud stage was significantly higher than that of haplotype Hap3, and the average seedling rate was 78.2% ( Figure 8); In order to further verify the accuracy of molecular markers Cold1-1-kasp and Cold1-2-kasp for genotyping SNP145938700 and SNP145938916, sequencing primers 567f / 567r were developed (Table 4); 7 DNAs of 21 materials detected as Hap2 were mixed in equal amounts, and 7 DNAs of 14 materials detected as Hap3 were mixed in equal amounts, and the mixed samples were amplified by PCR using primers 567f / 567r (the PCR amplification band size was 567 bp), and the amplified PCR stock solution was entrusted to Beijing Qingke Biotechnology Co., Ltd. for Sanger first-generation sequencing. The sequencing results showed that the molecular marker Cold1-1-kasp detected SNP145938700 as a FAM tag (corresponding to the genotype of TT), and the sequencing result was base T; the molecular marker Cold1-1-kasp detected SNP145938700 as a HEX tag (corresponding to the genotype of AA), and the sequencing result was base A ( Fig. 9 ). The molecular marker Cold1-2-kasp detected SNP145938916 as a FAM tag (corresponding genotype is GG), and the sequencing result was base C (complementary base); the molecular marker Cold1-1-kasp detected SNP145938916 as a HEX tag (corresponding genotype is TT), and the sequencing result was base A (complementary base) ( Fig. 9 The above research results indicate that Hap2 is a favorable haplotype of COLD1 gene, which can be used for molecular breeding such as molecular screening of cold-resistant seedling materials in rice bud stage, creation of new germplasm or breeding of new varieties.

[0051] Table 4 COLD1 gene SNP sequencing primers

[0052]

[0053] Table 5 Haplotypes of COLD1 gene in 35 rice parents (conventional rice)

[0054]

[0055] In summary, the present invention has studied the haplotype of the rice cold-tolerant gene COLD1 and found that the mutation of two SNPs (SNP145938700, SNP145938916) at the physical positions of 30316708 and 30316924 in the upstream regulatory region of the COLD1 gene on rice Chr4 constitutes three haplotypes, among which Hap2 (AG) is an excellent haplotype of the COLD1 gene, which can significantly improve the ability of rice to tolerate cold and establish seedlings during the bud stage. The present invention has developed two kasp molecular markers to perform genotyping and haplotype analysis on two SNPs of the COLD1 gene, which can effectively detect and distinguish the excellent and non-excellent haplotypes of the COLD1 gene for the ability of rice to tolerate cold and establish seedlings during the bud stage, and by testing existing rice varieties, it is proved that the excellent haplotype material screened by the molecular marker has a significantly higher ability of bud stage cold and establish seedlings than the non-excellent haplotype. Therefore, the molecular markers provided by the present invention can be used for detection of excellent haplotypes of the COLD1 gene for cold-resistance and seedling-forming ability in rice bud stage and molecular breeding, thereby improving breeding efficiency.

[0056] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the present invention can be implemented in other specific forms without departing from the spirit or essential features of the present invention. Therefore, the embodiments should be considered exemplary and non-restrictive in all respects, and the scope of the present invention is defined by the appended claims rather than the above description, and it is intended that all changes falling within the meaning and scope of the equivalent elements of the claims be included in the present invention.

Claims

1. A DNA molecular marker associated with a rice cold tolerance gene haplotype, characterized in that: The rice cold tolerance gene COLD1 haplotype consists of SNP145938700 and SNP145938916, wherein the SNP145938700 detection molecular marker is Cold1-1-kasp, which is used to distinguish the T or A base at the physical position 30316708; the SNP145938916 detection molecular marker is Cold1-2-kasp, which is used to distinguish the G or T base at the physical position 30316924; or the complementary bases of the above SNP sites; The detection primer sequences of molecular markers Cold1-1-kasp and Cold1-2-kasp are: 1)Cold1-1-kasp 708FAM:GAAGGTGACCAAGTTCATGCTGTGCTGCGTGCGTTCCT, 708HEX:GAAGGTCGGAGTCAACGGATTGTGCTGCGTGCGTTCCA, 708C:TCTCCTGTAGCTTCCTCTTC; 2) Cold1-2-kasp 924FAM:GAAGGTGACCAAGTTCATGCTGCGCGCGCGACGCTAAACTTGCTTG, 924HEX:GAAGGTCGGAGTCAACGGATTGCGCGCGCGACGCTAAACTTGCTTT, 924C:CGTGGTCTCGCATCTCCCG.

2. A method for identifying haplotypes of rice cold-tolerance genes based on the DNA molecular markers of claim 1, characterized in that: The kasp molecular marker was used. The kasp molecular marker primer combination included 2 specific primers and 1 universal primer. The 5′ end of one specific primer was connected to a fluorescent label FAM. After PCR amplification, the product carrying the FAM sequence was displayed red under fluorescent irradiation. The 5′ end of the other specific primer was connected to a fluorescent label HEX. After PCR amplification, the product carrying the HEX sequence was displayed blue under fluorescent irradiation. Cold1-1-kasp marker detects Chr4-30316708 position, and the PCR product is scanned for fluorescence signals. If the product shows red after fluorescence irradiation, the genotype of the rice kasp marker Cold1-1-kasp to be tested is TT; if the product shows blue after fluorescence irradiation, the genotype of the rice kasp marker Cold1-1-kasp to be tested is AA; if the product shows superimposed colors after fluorescence irradiation, the genotype of the rice kasp marker Cold1-1-kasp to be tested is AT heterozygous; The Cold1-2-kasp marker detects Chr4-30316924, and the PCR product is scanned for fluorescent signals. If the product shows red after fluorescent irradiation, the genotype of the rice kasp marker Cold1-2-kasp to be tested is GG; if the product shows blue after fluorescent irradiation, the genotype of the rice kasp marker Cold1-2-kasp to be tested is TT; if the product shows superimposed colors after fluorescent irradiation, the genotype of the rice kasp marker Cold1-2-kasp to be tested is GT heterozygous.

3. Use of the DNA molecular marker associated with the haplotype of the rice cold-tolerant gene according to claim 1 in the detection of excellent haplotypes of the COLD1 gene for cold-tolerant seedling formation in the budding period of rice, germplasm purification or variety improvement.

4. Use of the DNA molecular marker associated with the haplotype of the rice cold-tolerant gene according to claim 1 in the preparation of a tool for detecting excellent haplotypes of the COLD1 gene for cold-tolerant seedling formation during the bud stage of rice, purifying germplasm or improving varieties.

Images