InDel4 molecular marker for identifying cold resistance of rice in bud stage and application of InDel4 molecular marker

Abstract

The invention discloses an InDel4 molecular marker for identifying cold resistance of rice in a bud stage and application thereof, and relates to the field of gene engineering, the InDel4 molecular marker is located in a rice gene CTS4 coding region as shown in SEQ ID No.1; the InDel4 molecular marker comprises three sites, namely a first site located at 283rd-331th sites of a sequence SEQ ID No.1, a second site located at 283rd-331th sites of the sequence SEQ ID No.1, and a The first site is located at the 389th-391th site of the sequence SEQ ID No.1; and the molecular marker is located at the third site from the 482th site to the 484th site of the sequence SEQ ID No.1. The primer provided by the invention is used for identifying rice with different cold resistance in the bud stage, a result shows that a rice material with strong cold resistance in the bud stage and a rice material with weak cold resistance in the bud stage have specific difference, and the rice material with strong cold resistance in the bud stage has a larger strip than the rice material with weak cold resistance in the bud stage; the primer designed by the invention can effectively amplify specific gene segments of rice, and the specific gene segments are distinguished through agarose gel electrophoresis.

Description

Technical Field

[0001] The invention relates to the field of genetic engineering, and in particular to an InDel4 molecular marker for identifying cold tolerance of rice at bud stage and an application thereof. Background Art

[0002] Rice (Oryza sativa L.) originated in tropical and subtropical regions and is very sensitive to low temperatures. Low temperature disasters can seriously affect rice yield and quality. With the promotion and application of direct seeding technology for rice, low temperature damage during the budding period has become one of the important abiotic stresses restricting rice production. Rice materials with strong cold tolerance during the budding period can resist low temperature stress, which is of great significance for reducing rice cold damage losses and promoting direct seeding of rice. Therefore, it is very important to predict the cold tolerance of rice during the budding period during the variety breeding process.

[0003] At present, researchers often have to determine the cold tolerance of a new rice variety or breeding material at the bud stage through long and complex low-temperature culture experiments to identify the cold tolerance traits under appropriate low-temperature conditions; the whole process takes at least 2-3 weeks and requires professional technicians to conduct cold tolerance phenotype identification. Therefore, in breeding practice, it is necessary to find a method to quickly identify the cold tolerance of rice at the bud stage. Summary of the invention

[0004] In view of the above-mentioned deficiencies of the prior art, the present invention provides an InDel4 molecular marker for identifying cold tolerance of rice during the budding period and its application. The molecular marker can identify rice materials with different cold tolerance during the budding period. In practical applications, only PCR combined with electrophoresis experiments are required, which has low cost, high throughput, good specificity, and is suitable for breeding and production practices.

[0005] In order to achieve the above-mentioned object of the invention, the technical solution adopted by the present invention is:

[0006] Provided is a rice InDel4 molecular marker, which is located in a rice gene CTS4 coding region as shown in SEQ ID No.1; the InDel4 molecular marker comprises three positions, which are respectively a first position located at positions 283-331 of the sequence SEQ ID No.1; a second position located at positions 389-391 of the sequence SEQ ID No.1; and a third position located at positions 482-484 of the sequence SEQ ID No.1.

[0007] Provided is a primer pair for amplifying the above-mentioned InDel4 molecular marker, comprising a forward primer as shown in SEQ ID No.2: 5'-CCTGAGTCACAAGCACGAAA-3'; and a reverse primer as shown in SEQ ID No.3: 5'-AACCGGTTGCACAGGTAGTC-3'.

[0008] Provided is an application of the InDel molecular marker or the primer pair in detecting the cold tolerance of rice during the bud stage.

[0009] Provided is a kit for detecting the cold tolerance of rice during the bud stage, the kit containing the above primer pair.

[0010] A method for detecting the cold tolerance of rice during the bud stage is provided, comprising the following steps:

[0011] S1: Extract genomic DNA of rice samples to be tested;

[0012] S2: Using the extracted genomic DNA as a template, PCR amplification was performed using the above primer pairs;

[0013] S3: Performing electrophoresis detection on the PCR amplification product. If an electrophoresis band identical to the above-mentioned InDel4 molecular marker appears, the rice sample to be detected is a rice with cold tolerance during the budding period; otherwise, the rice sample to be detected is a rice without cold tolerance during the budding period.

[0014] Furthermore, the PCR amplification system in step S2 is: 2×Phanta Max Mix 5 μL, forward primer 0.5 μL, reverse primer 0.5 μL, template DNA 1 μL, double distilled water 3 μL.

[0015] Furthermore, the PCR amplification program was: preheating at 95°C for 3 min; 34 cycles: denaturation at 95°C for 30 s, annealing at 58°C for 40 s, and extension at 72°C for 30 s; and finally extension at 72°C for 5 min.

[0016] Furthermore, the electrophoresis procedure was: 4% agarose gel electrophoresis, constant voltage 250V, 500A, and electrophoresis time 15min.

[0017] Provided is an application of the InDel4 molecular marker or the primer set in rice germplasm resource analysis or molecular marker-assisted breeding.

[0018] The beneficial effects of the present invention are:

[0019] The primers provided by the present invention are used to identify rice with different cold tolerance at the bud stage. The results show that rice materials with strong cold tolerance at the bud stage and rice materials with weak cold tolerance at the bud stage have specific differences, and the bands of rice materials with strong cold tolerance at the bud stage are larger than those of rice materials with weak cold tolerance at the bud stage. The primers designed by the present invention can effectively amplify specific gene fragments of rice and distinguish them through agarose gel electrophoresis.

[0020] In practical applications, the InDel molecular marker provided by the present invention only requires PCR amplification combined with agarose gel electrophoresis, has low cost, high throughput, and high specificity, and is suitable for rice breeding and production practice. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The electrophoresis result of the PCR amplification product of Example 1 is shown;

[0022] Figure 2 This is the electrophoresis result of the PCR amplification product of Example 2. DETAILED DESCRIPTION

[0023] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0024] If the specific conditions are not specified in the examples, the conventional conditions or the conditions recommended by the manufacturer shall be followed. The reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially. The indica rice variety 9311 used in the examples is deposited in the Rice Research Center of the College of Agriculture, China Agricultural University; the cold-tolerant introgression rice Ra17 is recorded in "Wang Shanshan, Positioning of QTLs Related to Cold Tolerance in Bud and Seedling Stages of Annual Wild Rice, Master's Thesis, 2016"; the annual wild rice TK212 is deposited in the Rice Research Center of the College of Agriculture, China Agricultural University; Yuanjiang common wild rice, Chaling common wild rice, rice GC2, and rice Teqing are all deposited in the Rice Research Center of the College of Agriculture, China Agricultural University.

[0025] Example 1

[0026] The CTS4 genome sequences of indica rice variety 9311 and annual wild rice TK212 were downloaded from the Plant Genome Database (https: / / phytozome-next-jm6g.jgi.doe.gov);

[0027] Comparison revealed that there was a 49 bp insertion and two 3 bp insertions in the annual wild rice TK212. Based on the insertion sequence, a forward primer as shown in SEQ ID NO.2: 5'-CCTGAGTCACAAGCACGAAA-3'; and a reverse primer as shown in SEQ ID NO.3: 5'-AACCGGTTGCACAGGTAGTC-3' were designed.

[0028] The genomic DNA of annual wild rice TK212, cold-sensitive indica rice variety 9311 and cold-tolerant introgression line Ra17 were amplified using the designed primer pairs. In the specific implementation, when each rice plant has two leaves and one heart, the leaves are collected and the genomic DNA is extracted using the modified CTAB method;

[0029] The amplification system was: 2×Phanta Max Mix 5μL, forward primer 0.5μL, reverse primer 0.5μL, template DNA 1μL, double distilled water 3μL.

[0030] The PCR amplification program was as follows: preheating at 95°C for 3 min; 34 cycles of denaturation at 95°C for 30 s, annealing at 58°C for 40 s, and extension at 72°C for 30 s; and finally extension at 72°C for 5 min.

[0031] The amplified products were subjected to Sanger sequencing, and the cold-sensitive indica rice variety 9311 had a band of 537 bp as shown in SEQ ID NO.4, and the cold-tolerant introgression line Ra17 had a band of 592 bp as shown in SEQ ID NO.1.

[0032] The differential InDel molecular markers determined between the cold-tolerant introgression line Ra17 and the indica rice variety 9311 include the first position located at positions 283-331 of sequence SE Q ID NO.1: GCTTTTTTTTTTCGAGCTATTAATAAG CTGGATTTAACAATAAAAATTC; the second position located at positions 389-391 of sequence SEQ ID No.1: CCT; and the third position located at positions 482-484 of sequence SEQ ID No.1: AGG.

[0033] The amplified product was subjected to 4% agarose gel electrophoresis. The electrophoresis procedure was: 4% agarose gel electrophoresis, constant voltage 250v, 500A, electrophoresis time 15min. The results are as follows Figure 1 As shown by Figure 1 It can be seen that the product of indica rice variety 9311 is a smaller band. The cold-tolerant introgression line Ra17 and annual wild rice TK212 both have a larger band. If the size of the electrophoresis bands is consistent with the difference, the specific bands of the cold-tolerant gene can be distinguished by electrophoresis.

[0034] Example 2

[0035] One-year-old wild rice TK212, indica rice 9311, Yuanjiang common wild rice, Chaling common wild rice, rice GC2, and rice Teqing were used for verification.

[0036] The above rice plants were cultured until they had two leaves and one heart, and the leaves were collected to extract genomic DNA using the modified CTAB method.

[0037] The rice genomic DNA to be tested was used as a template, and PCR amplification was performed using the primer pairs, amplification system and program designed in Example 1 to obtain an amplified product. The amplified PCR product was subjected to agarose gel electrophoresis and then detected using a gel imaging system. The electrophoresis results are shown in Figure 2 Among them, 1 to 6 are the electrophoresis results of Yuanjiang common wild rice, Chaling common wild rice, one-year wild rice, 9311, GC2, and Teqing. Figure 2 It can be seen that the bands of Yuanjiang common wild rice, Chaling common wild rice and annual wild rice TK212 are similar and all larger than those of indica rice 9311, rice GC2 and rice Teqing. The bands of indica rice 9311, rice GC2 and rice Teqing are similar.

[0038] The six types of rice were subjected to a low temperature test. The specific steps were as follows: select full seeds and place them in a 42°C oven for 2 days to break dormancy. The dormant seeds were immersed in a 20% sodium hypochlorite solution for 30 minutes for disinfection, and then rinsed with deionized water several times until there was no odor. The seeds were placed in a 37°C incubator and soaked for 2 days. After the seeds turned white, they were moved to a disposable plastic culture dish with a diameter of 90 mm (with a layer of sterilized filter paper and 15-20 mL of sterilized deionized water), and placed in a light incubator (temperature of 28°C, humidity of 70%, and light conditions set to 16h light / 8h dark) and cultured until the bud length was about 5 mm. 30 seeds with a bud length of about 5 mm were selected from each culture dish and treated in a 4°C low-temperature incubator at low temperature and darkness for 4 days. After the low-temperature treatment was completed, the seeds resumed growth at 28°C for 7 days, the number of seedlings with good growth was investigated, and the seedling rate was calculated. The statistical results are shown in Table 1.

[0039] Table 1

[0040] Yuanjiang wild rice Chaling wild rice TK212 9311 GC2 Teqing Seedling rate (%) 93.3 94.1 96.9 15.4 14.8 18.5

[0041] According to Table 1 and Figure 2 It can be seen that Yuanjiang common wild rice, Chaling common wild rice and TK212, which have larger bands in the electrophoresis results, have a seedling rate of more than 90% after the low temperature test, while 9311, GC2 and Teqing, which have smaller bands in the electrophoresis results, have a seedling rate of less than 20% after the low temperature test. The low temperature experiment results are consistent with the molecular marker identification results, and can specifically identify the cold tolerance of rice during the bud stage.

[0042] In summary, the molecular markers, primers and identification methods provided by the present invention can specifically identify the cold tolerance of rice at the bud stage, providing practical value for rice breeding.

Claims

1. A rice InDel4 molecular marker, characterized in that: The InDel4 molecular marker is located in the rice gene CTS4 coding region as shown in SEQ ID No.1; the InDel4 molecular marker includes three positions, namely, a first position located at positions 283-331 of the sequence SEQ ID No.1; a second position located at positions 389-391 of the sequence SEQ ID No.1; and a third position located at positions 482-484 of the sequence SEQ ID No.

1.

2. A primer pair for amplifying the InDel4 molecular marker according to claim 1, characterized in that: It includes a forward primer as shown in SEQ ID No. 2: 5'-CCTGAGTCACAAGCACGAAA-3'; and a reverse primer as shown in SEQ ID No. 3: 5'-AACCGGTTGCACAGGTAGTC-3'.

3. Use of the InDel molecular marker according to claim 1 or the primer pair according to claim 2 in detecting the cold tolerance of rice during the bud stage.

4. A kit for detecting the cold tolerance of rice during the bud stage, characterized in that: The kit contains the primer pair according to claim 2.

5. A method for detecting the cold tolerance of rice during the bud stage, characterized in that: The steps include: S1: Extract genomic DNA of rice samples to be tested; S2: using the extracted genomic DNA as a template, and performing PCR amplification using the primer pair described in claim 2; S3: Performing electrophoresis detection on the PCR amplification product. If an electrophoresis band identical to the InDel4 molecular marker described in claim 1 appears, the rice sample to be detected is a rice with cold tolerance during the budding period; otherwise, the rice sample to be detected is a rice without cold tolerance during the budding period.

6. The method according to claim 5, characterized in that The PCR amplification system in step S2 is: 5 μL of 2×Phanta Max Mix, 0.5 μL of forward primer, 0.5 μL of reverse primer, 1 μL of template DNA, and 3 μL of double distilled water.

7. The method according to claim 6, characterized in that The PCR amplification program is: preheating at 95°C for 3 min; 34 cycles: denaturation at 95°C for 30 s, annealing at 58°C for 40 s, extension at 72°C for 30 s; and finally extension at 72°C for 5 min.

8. The method according to claim 5, characterized in that The electrophoresis procedure is: 4% agarose gel electrophoresis, constant voltage 250v, 500A, electrophoresis time 15min.

9. Use of the InDel4 molecular marker according to claim 1 or the primer set according to claim 2 in rice germplasm resource analysis or molecular marker-assisted breeding.

Images