SNP site for identifying high-temperature-resistant germplasm of upland cotton and application of SNP site

Abstract

The invention discloses SNP sites for identifying high-temperature-resistant germplasm of upland cotton and application of the SNP sites, belongs to the technical field of molecular biological detection, and provides the SNP sites for identifying the high-temperature-resistant germplasm of the upland cotton, the SNP sites are SNP1 and SNP2; sNP1 is located at the 42577154 site on the upland cotton D12 chromosome, and the nucleotide is T / C; sNP2 is located at the 42577814th site on the upland cotton D12 chromosome, and the nucleotide is A / T. The invention further provides application of the SNP site in preparation of a product for identifying high-temperature-resistant germplasm of upland cotton. The invention provides the two SNP sites linked with the upland cotton pollen high-temperature-resistant phenotype and the PCR primer for detection, so that the upland cotton high-temperature-resistant gene resources are enriched, and the high-temperature-resistant breeding process of the upland cotton is accelerated.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biological detection, and in particular relates to SNP sites for identifying high temperature resistant germplasm of upland cotton and applications thereof. Background Art

[0002] Upland cotton (Gossypium hirsutum.L) produces more than 90% of natural spinnable fibers. The production of cotton is affected by frequent extreme high temperatures exceeding 35°C in summer, which leads to high-temperature male sterility and causes a large number of buds and bolls to fall off during the concentrated boll-forming period. However, due to the complex phenotype of cotton's resistance to high temperatures and the difficulty in screening genetic identification germplasm, there is a practical bottleneck in the current breeding of cotton for resistance to high temperatures. In order to solve the above-mentioned industrial problems, a scheme for rapid identification of cotton pollen vitality under high temperatures has been established, and four high-temperature resistance sites have been identified in the upland cotton breeding population, namely qPV-A01, qPV-D01, qPV-D05 and qPV-D12, and it is expected to analyze the genetic variation and effects in the high-temperature resistance sites and then determine the high-temperature resistance genes (CN118186135A). An existing invention has published a high-temperature resistance gene in the qPV-D12 block, with a gene ID of Ghir_D12G013040. The Ghir_D12G013040 gene encodes a 3-methyl-2-oxobutyrate hydroxymethyltransferase gene, named GhKPHMT according to the English abbreviation and species origin. The GhKPHMT gene positively regulates pollen high temperature resistance, and can be used to create high temperature resistant genetic materials and germplasm in upland cotton, rice and model plants. However, the gene has developmental defects after functional loss, so the use of it to create upland cotton high temperature resistant germplasm requires transgenic operation, which is difficult to implement and promote. Summary of the invention

[0003] In order to solve the above technical problems, the present invention proposes SNP sites and applications for identifying high temperature resistant germplasm of upland cotton, provides an upstream expression regulatory sequence of the GhKPHMT gene, two SNP sites linked to the high temperature resistance phenotype of upland cotton powder and PCR primers for detection, enriches the high temperature resistance gene resources of upland cotton and accelerates the breeding process of upland cotton with high temperature resistance.

[0004] To achieve the above object, the present invention provides SNP sites for identifying high temperature resistant germplasm of upland cotton, wherein the SNP sites are SNP1 and SNP2;

[0005] The SNP1 is located at position 42577154 on chromosome D12 of upland cotton, and the nucleotide sequence is T / C;

[0006] The SNP2 is located at position 42577814 on chromosome D12 of upland cotton, and the nucleotide is A / T.

[0007] The present invention also provides primers for detecting the SNP site, wherein the primers include a forward primer and a reverse primer for amplifying the SNP1 site, and a forward primer and a reverse primer for amplifying the SNP2 site;

[0008] The nucleotide sequence of the forward primer for amplifying the SNP1 site is shown in SEQ ID NO.5;

[0009] The nucleotide sequence of the reverse primer for amplifying the SNP1 site is shown in SEQ ID NO.7;

[0010] The nucleotide sequence of the forward primer for amplifying the SNP2 site is shown in SEQ ID NO.8;

[0011] The nucleotide sequence of the reverse primer for amplifying the SNP2 site is shown in SEQ ID NO.10.

[0012] The present invention also provides the use of the SNP site in the preparation and identification of high temperature resistant germplasm products of upland cotton.

[0013] Preferably, the product includes reagents, kits and chips.

[0014] The present invention also provides the use of the primers in preparing and identifying high temperature resistant germplasm products of upland cotton.

[0015] Preferably, the product includes reagents, kits and chips.

[0016] The present invention also provides a method for identifying high temperature resistant germplasm of upland cotton using the SNP locus, comprising the following steps:

[0017] (1) obtaining the whole genome DNA of the upland cotton to be tested, and performing PCR amplification using the whole genome DNA as a template;

[0018] (2) After PCR amplification, agarose gel electrophoresis is performed to determine the genotype of the corresponding SNP based on whether the amplification is successful or not. Preferably, the PCR amplification uses the primers described above.

[0019] Preferably, the reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 53-56°C for 30 s, extension at 72°C for 30 s, 32-35 cycles; extension at 72°C for 5 min.

[0020] Compared with the prior art, the present invention has the following advantages and technical effects:

[0021] According to the results of candidate gene and haplotype analysis, the present invention determines the natural variation information of the core germplasm of upland cotton at the GhKPHMT gene locus and the pollen vigor of the corresponding genotype. Based on the information of the TM-1 (HZAUv1.1) reference genome, amplification primers were designed to amplify two potential regulatory sequences, and the positions and authenticity of SNP1 and SNP2 were determined. According to the SNP variation information, annealing competitive KASP markers were developed in a targeted manner and genotype typing could be performed in high temperature resistant and high temperature sensitive upland cotton germplasms through random selection experiments.

[0022] The present invention discloses annealing specific markers SNP1 and SNP2 for the natural variation of the upstream regulatory sequence of the GhKPHMT gene. The two markers are highly linked and can be used for the rapid identification and screening of high temperature resistant germplasm. The high temperature resistance of upland cotton germplasm can be preliminarily judged according to the typing result of any SNP. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0024] Figure 1 The results of the analysis of natural variations in the GhKPHMT gene locus;

[0025] Figure 2 The results of amplification, cloning and sequence analysis of the GhKPHMT upstream regulatory sequence in Example 1, wherein A is the result of PCR amplification, lane 1 is the band pattern of the fragment amplified using the primers shown in SEQ ID NO.1 and SEQ ID NO.3, lane 2 is the band pattern of the fragment amplified using the primers shown in SEQ ID NO.2 and SEQ ID NO.3, and B is the assembly error in the reference genome and the situation of the cloned sequence;

[0026] Figure 3 The optimal annealing temperature for the variation of SNP1 and SNP2 sites was determined for Example 2;

[0027] Figure 4 The statistical results of genotyping and pollen viability of SNP1 C / T and SNP2 T / A markers for different high temperature resistance germplasms, where A is genotyping and B is pollen viability determination. DETAILED DESCRIPTION

[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0029] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0030] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0031] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to the skilled artisan. The present invention description and examples are exemplary only.

[0032] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0033] Example 1

[0034] Natural variation mining and analysis of the GhKPHMT gene locus

[0035] Among more than 3,000 publicly available upland cotton germplasms (He, S., G. Sun, X. Geng, W. Gong, P. Dai, Y. Jia, W. Shi, Z. Pan, J. Wang, L. Wang, S. Xiao, B. Chen, S. Cui, C. You, Z. Xie, F. Wang, J. Sun, G. Fu, Z. Peng, D. Hu, L. Wang, B. Pang & X. Du (2021) The genomic basis of geographic differentiation and fiber improvement in cultivated cotton. Nat Genet, 53, 916-924.), 517 were selected, and four heat resistance gene loci (CN118186135A) were identified using pollen viability under high temperature stress, and named qPV-A01, qPV-D01, qPV-D05 and qPV-D12 according to the chromosome names. The causal genes at the qPV-A01 and qPV-D12 loci have been disclosed, namely GhHRKs (CN118345099A) and GhKPHMT (linked to the case of the GhKPHMT gene). Molecular markers have been developed for genotyping and screening of high temperature resistant germplasm for natural variations related to high temperature resistance at the GhHRKs locus (CN116790806A). In order to broaden the screening methods for high temperature resistance genetic lineage and high temperature resistance phenotype, the present invention analyzes the natural variation of the GhKPHMT gene and studies the upstream regulatory sequence of GhKPHMT (SEQ ID NO.4) to develop molecular markers related to the high temperature resistance phenotype.

[0036] SEQ ID NO.4: ACGGTCCGTAATAACCGGTAAGAAGCCGTTGAACGAGCACCTAAAAAACGGCACCGTTCAAAGGATGATGATGGAGCGGTGACACTGGTTTGAGTTTGCAAAGATAA CAGATCGGAGGTGAAAGAAAATTTTTGAATACACTCGCGGGTTTTACAGTTGAAGAGCTTTTTGTTTCTTTAAATAAATAATTAATTATAATTATAATTATTATTGTTGCCTGTTGGGCATATGGCCGGTGGTGGTCGGAAATGAGGAGAGAAGAGTAAGGGGCCGGTGGTAAGTATACTTTGGATAAGGAAATTTGGCTTGGCCCAGTATTGTTTGAATTTATCGCTTTCTTTCTTTTTTTTTTTAAGGAATCGCTTTATTTTCTTGGTTGTTAATAATTTGTAATTTTAATGTTTCGTCTAAAATTAAAATATATACATATTGCAGTCTTGATGCCACGTCGTTTTAATATAACT GTGAATATTATTTTTTCAATAAATTTAAATTGAAAATTTATTGAAAATAATAAAATTAAAGGTAAACTATTAAAATAGTCACTTTTATTTATCTTAAATTATATTTTAGTCACTTATGTTTGGAAATGTTGCGTTTTAGTCACTTACATTATCACATTGTAACATTTTAGTCATTGAGCCGTTAATTGTCGGTGTAACGGTAAGCTGACGTGGCACGTTAAATCATCATTTCAAACAAAAATTTTAGATTAATTTATACAACCGGTCCCCATGTTTTTTCGTTTTAAGCAATTTAATTTTTTTTTCTTTTATGTTCTTTTAACTTCATTTTTTCTTTATTTTTCACTCTCTTCTGCATC CCCTCTGTTTTTCTCCCTTCTTTATTTCTTTTAATGTAAATTTTCTATGTTTTCCATTTGTTAAAACTAATCCCTATACTTTTATTTTCTTGAACAATTTAATTTTTTCGAGTGAGGCGAGCTTAGTCCAAGCCATGTGGAATGGCCCAGCTCGTGTGGCTCCTGTAACTAGTTTTGATTTTTCAGTTTTCGCTCCTTTTACTCCCAAATGCTCTCCTAAGTATAAAAACATGAATTTAAAGGATTAGGAGCATAAAAATTCACTATTAACCTTGAATAATCACCCAAAAATGCATTAAGAATGAGACTAAAAACATGTTATTTTTAACACCTACCATATATATATTATTT TTAA AATTTCAATCCTATCCAAATTGCAATAGTTAAATGCATTTGGTTAAATTTTGCCAATAGTCCTATTCCATCAGTAAAATTGTATATTTAGTTTATATTTTT TAAT TTTTTTCATTATTAATTTTTATATTTTTTGAATTTTTAGAAATTTTGATTTTTATGCAACAACAATCATTAAATTCATTAATTTTTTTTTGTGAATGTTATTTGAAAACAACAAATTAACATGACCCTCCCAAATTTGGAAATTTAAAATTTGGCCCTTTAAAATTTATGATTTTTTAAATTAGTACATGATAAAATTACACTTT GCCCCTAAAATGAT AAAAA。

[0037] The bold and underlined "CAT" in SEQ ID NO.4 is the start codon, the bold and shaded "T" is the SNP1 site (C / T), and the bold and shaded "A" is the SNP2 site (T / A).

[0038] The analysis results are as follows Figure 1 As shown in the figure, through the genetic map of 517 upland cotton germplasms, three variations were identified at the GhKPHMT locus, including a thymine insertion (+12-CT / C) 12 bp downstream of the stop codon (the insertion of thymine is downstream of the stop codon and the effect is not evaluated, it is not within the scope of SEQ ID NO.4, and it is an explanation of the big data analysis results); there is a C / T single base variation at 716 bp upstream of the start codon, which is the SNP1 site (-716-C / T); 1376 bp upstream of the start codon (according to Figure 2 From the actual cloned regulatory sequences of B and SEQ.ID.NO.4, it can be seen that there are 3 assembly errors in the reference genome sequence, resulting in a quantitative difference of 5 bases. Therefore, in all subsequent results, it is adjusted to 1381bp according to the actual situation. There is a T / A single base variation at the SNP2 site (-1376-T / A). The above three natural variations constitute different haplotypes in the germplasm bank. According to the comparison of pollen vigor under different haplotypes, the variation of the upstream regulatory region of the start codon contributes more to pollen vigor. Among them, there are 123 germplasms with SPN1 site and SNP2 site of -716-C / -1376-T haplotype, and the pollen vigor is generally high. The rank sum test shows that the P value is 7.12E-10, which reaches a significant level. Therefore, the experiment is designed to clone the upstream regulatory sequence of the GhKPHMT gene and develop markers.

[0039] To ensure the correct amplification of the regulatory sequence, two forward primers shown in SEQ ID NO.1 and SEQ ID NO.2 were designed in this embodiment, and the reverse primer shown in SEQ ID NO.3 was used for amplification. Among them, SEQ ID NO.2 is located 1 bp before the start codon of the upstream regulatory sequence of GhKPHMT, and is used to directly amplify the upstream regulatory sequence, and the expected product band is 2000bp; while SEQ ID NO.1 is located 110bp after the start codon of the upstream regulatory sequence of GhKPHMT, and the amplified product will span the start codon, which is matched with the cloning sequence of SEQ ID NO.2, and the cloning sequence can be ensured to be correct.

[0040] SEQ ID NO. 1: ACGGTCCGTAATAACCGGTAAGAA.

[0041] SEQ ID NO. 2: CAGATCGGAGGTGAAAGAAAATT.

[0042] SEQ ID NO. 3: CCAAAACAAATTTATGCTAAGGGTATTC.

[0043] After designing the primers, the genomic DNA of upland cotton TM-1 was used as a template, the PCR system was configured according to the formula in Table 1, and two amplification experiments were performed using the PCR program in Table 2. The results are shown in FIG. Figure 2 As shown in A, the product fragment obtained using SEQ ID NO.1 is greater than 2000 bp, and the product fragment amplified using SEQ ID NO.2 is about 2000 bp. Since the banding pattern of the PCR product is single and specific, the PCR products were connected using the system in Table 3 and then sequenced to obtain the clone sequence, and the result is shown in SEQ ID NO.3.

[0044] In the TM-1 genome, the haplotype composed of the SNP1 site and the SNP2 site is T / A. At the same time, compared with the actual clone, the upstream regulatory sequence of the GhKPHMT gene in the reference genome has an assembly error at -1068bp, -1171bp and -1391bp, respectively, which are 2bp missing (TTAA assembled as TA), 2bp missing (TAAT assembled as AA), and 1bp missing (AAAAA assembled as AAAA). The specific results are as follows: Figure 2 As shown in B.

[0045] The upstream regulatory sequence of the GhKPHMT gene was successfully cloned, the haplotypes of the SNP1 and SNP2 sites in the TM-1 genome were confirmed to be T / A, and three reference genome errors were corrected.

[0046] Table 1 PCR amplification system

[0047] Components Dosage DNA template (75-100ng / μL) 1μL 2×Buffer 20μL Forward primer F (10mM) 0.5μL Reverse primer R (10mM) 0.5μL dNTP(10mM) 0.6μL DNA polymerase (10U / μL) 0.4μL Double distilled water Make up to 40 μL

[0048] Note: In Table 1, the reagent used is Vazyme Phanta DNA polymerase kit #P505, purchased from Nanjing Novozyme Biotechnology Co., Ltd.

[0049] Table 2 PCR amplification program

[0050]

[0051] Table 3 PCR product ligation system

[0052] Components volume 5×Ultra-UniversalTOPOCloningMix 1μL PCR products 1.5μL Double distilled water Make up to 5 μL (react at 25℃ for 10-15 min)

[0053] Note: In Table 3, the reagents used were the Ultra Universal Topoisomerase Cloning Kit #C603, purchased from Nanjing Novozyme Biotech Co., Ltd.

[0054] Example 2

[0055] Development of molecular markers for upstream regulatory sequence variation of GhKPHMT gene and its application in screening of heat-resistant upland cotton germplasm

[0056] After determining that the genotype of -716 (SNP1) and -1381 (SNP2) in the TM-1 genome is T / A, this embodiment designs 6 primers for annealing competitive molecular marker development. The 6 primer sequences are shown in SEQ ID NO.5 to SEQ ID NO.10, wherein the primer sequences shown in SEQ ID NO.5 to SEQ ID NO.7 are used for -716-C / T typing, the 3' end of SEQ ID NO.5 is a C base, the 3' end of SEQ ID NO.6 is a T base, and SEQ ID NO.7 is a specific reverse primer; the primer sequences described in SEQ ID NO.8 to SEQ ID NO.10 are used for -1381-T / A typing, the 3' end of SEQ ID NO.8 is a T base, the 3' end of SEQ ID NO.9 is an A base, and SEQ ID NO.10 is a specific reverse primer.

[0057] Primer F for GhKPHMT-716 genotype C SEQ ID NO.5: ATTTTTCACTCTCTTCTGCATCC.

[0058] Primer F for GhKPHMT-716 typing T SEQ ID NO.6: ATTTTTCACTCTCTTCTGCATCT.

[0059] Primer R for GhKPHMT-716 typing: SEQ ID NO. 7: TGATGGAATAGGACTATTGGCAAAA.

[0060] Primer F for GhKPHMT-1381 typing T SEQ ID NO.8: AATTAGTACATGATAAAATTACACT TTT.

[0061] Primer F for GhKPHMT-1381 genotype A SEQ ID NO.9: AATTAGTACATGATAAAATTACACT TTA.

[0062] Primer R for GhKPHMT-1381 typing: SEQ ID NO.10: CAAAGCCCTTCAACTGCTAAAATCA.

[0063] After the primers were synthesized, the PCR system shown in Table 1 of Example 1 was configured, and the PCR program shown in Table 2 of Example 1 was used. The TM-1 genomic DNA was used as a template, and the annealing temperature option of 50 to 61° C. was used to perform 12 PCR amplification experiments.

[0064] The amplification results are as follows Figure 3 As shown, according to the amplification results, when the annealing temperature is 56°C, the forward primer with a C base at the 3' end cannot normally bind to the A base on the antisense strand at -716 on the genomic DNA of TM-1, while the forward primer with a T base at the 3' end can still bind normally, so the optimal detection annealing temperature at -716 is determined to be 56°C. When the annealing temperature is 53°C, the forward primer with a T base at the 3' end cannot normally bind to the T base on the antisense strand at -1381 on the genomic DNA of TM-1, while the forward primer with an A base at the 3' end can still bind normally, so the optimal detection annealing temperature at -1381 is determined to be 53°C.

[0065] Furthermore, among the 517 core germplasms, 24 high-temperature resistant germplasms and 24 high-temperature sensitive germplasms were randomly selected based on the pollen viability data after high-temperature stress. The PCR system shown in Table 1 in Example 1 and the PCR program shown in Table 2 in Example 1 were used to perform genotyping of the -716 and -1381 haplotypes, respectively. The selected germplasm sources and pollen viability data to be tested are shown in Table 4 below.

[0066] Table 4 Information on selected upland cotton germplasm

[0067]

[0068]

[0069]

[0070] Genotyping results are as follows Figure 4 Middle A and Figure 4 As shown in B, among the 24 heat-resistant upland cotton germplasms, 21 amplified the -716-C / -1381-T heat-resistant genotype, and 3 amplified the -716-T / -1381-A heat-sensitive genotype; among the 24 heat-sensitive upland cotton germplasms, 5 amplified the -716-C / -1381-T heat-resistant genotype, and 19 amplified the -716-T / -1381-A heat-sensitive genotype, and the chi-square test P value was 3.57E-6, reaching a significant level. The above results show that the linkage degree of C / T and T / A haplotypes at -716 / -1381 is high, and they can be used as molecular markers for screening heat-resistant upland cotton germplasms.

[0071] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A SNP locus for identifying high temperature resistant germplasm of upland cotton, characterized in that: The SNP sites are SNP1 and SNP2; The SNP1 is located at position 42577154 on chromosome D12 of upland cotton, and the nucleotide sequence is T / C; The SNP2 is located at position 42577814 on chromosome D12 of upland cotton, and the nucleotide is A / T.

2. The primer for detecting the SNP site according to claim 1, characterized in that: The primers include a forward primer and a reverse primer for amplifying the SNP1 site, and a forward primer and a reverse primer for amplifying the SNP2 site; The nucleotide sequence of the forward primer for amplifying the SNP1 site is shown in SEQ ID NO.5; The nucleotide sequence of the reverse primer for amplifying the SNP1 site is shown in SEQ ID NO.7; The nucleotide sequence of the forward primer for amplifying the SNP2 site is shown in SEQ ID NO.8; The nucleotide sequence of the reverse primer for amplifying the SNP2 site is shown in SEQ ID NO.

10.

3. Use of the SNP locus as claimed in claim 1 in the preparation and identification of high temperature resistant germplasm products of upland cotton.

4. The use according to claim 3, characterized in that: The products include reagents, kits and chips.

5. Use of the primers as claimed in claim 2 in preparing and identifying high temperature resistant germplasm products of upland cotton.

6. The use according to claim 5, characterized in that: The products include reagents, kits and chips.

7. A method for identifying high temperature resistant germplasm of upland cotton using the SNP locus as claimed in claim 1, characterized in that: The following steps are involved: (1) obtaining the whole genome DNA of the upland cotton to be tested, and performing PCR amplification using the whole genome DNA as a template; (2) After PCR amplification, agarose gel electrophoresis is performed to determine the genotype of the corresponding SNP based on whether the amplification is successful or not.

8. The method for identifying high temperature resistant germplasm of upland cotton according to claim 7, characterized in that: The PCR amplification uses the primers as claimed in claim 2.

9. The method for identifying high temperature resistant germplasm of upland cotton according to claim 7, characterized in that: The reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 53-56°C for 30 s, extension at 72°C for 30 s, 32-35 cycles; extension at 72°C for 5 min.

Images