SSR (Simple Sequence Repeat) core primer combination and kit for identifying tea tree variety 'Wuyan Dancong' and application of SSR core primer combination and kit

Abstract

The invention discloses an SSR (Simple Sequence Repeat) core primer combination for identifying a tea tree variety'black-leaf single cluster ', a kit and application. According to the invention, two pairs of SSR core primers are screened by utilizing an SSR fluorescence labeling detection technology, and the two pairs of SSR core primers can be used for rapidly identifying and detecting'black leaf single cluster 'from other tea tree varieties. The SSR core primer combination disclosed by the invention can be used for identifying the variety of the 'Wuyan Dancong', the uncertainty of identification based on external morphological characteristics is overcome, the result is reliable and visual, the detection efficiency is high, the operation is simple and convenient, and meanwhile, the popularization, utilization and protection of the variety of the 'Wuyan Dancong' are also facilitated.

Description

Technical Field

[0001] The present invention relates to the technical field of variety resource identification and germplasm innovation, and in particular to an SSR core primer combination, a kit and an application thereof for identifying the tea variety "Wuyedancong". Background Art

[0002] "Wuye Dancong" is systematically selected from the natural variants of the Fenghuang Narcissus tea tree community. It is a small tree type, medium-leaf type, late-maturing species. The tree is open and densely branched. The leaves are obliquely arranged, oblong, dark green, slightly raised and inward-folded, with wavy edges, blunt and shallow teeth, gradually pointed tips, cuneate bases, thick and brittle leaves. There are 3 to 5 petals, the ovary is hairless, the style is 3-lobed, the stamens and pistils are of equal height, and the fruit is spherical. It is suitable for making high-end oolong tea and black tea, with a strong gardenia fragrance and honey charm. The produced oolong tea has tight, straight and uniform strips, dark brown in color, glossy and shiny, high and sharp aroma, obvious gardenia fragrance, mellow and refreshing taste, strong aftertaste, obvious honey flavor, and can be brewed with ease. The soup color is golden and bright, clear, the bottom of the leaves is uniform, soft and bright, with red edging. The produced high-end black tea has a tight and dark appearance, rich and long-lasting floral fragrance, strong, fresh and sweet taste, the soup color is dark red and bright with gold ring, and the bottom of the leaves is uniform and bright red.

[0003] Currently, the identification of the tea variety "Wuye Dancong" is based on the identifier's personal understanding of "Wuye Dancong" and its external morphological characteristics. The identification result is easily affected by factors such as the developmental stage, cultivation measures, the identifier's personal ability and the growth environment of "Wuye Dancong", and there is great uncertainty.

[0004] Molecular marker technology can identify varieties quickly, accurately and efficiently. Simple sequence repeat (SSR) has the advantages of co-dominance, good repeatability, easy detection and simple operation. Therefore, SSR molecular markers have good application prospects in variety-specific evaluation and protection. Summary of the invention

[0005] In order to overcome the above-mentioned defects and shortcomings in the prior art, the present invention provides an SSR core primer combination, a kit and an application for identifying the tea variety "Wuyedancong".

[0006] The first object of the present invention is to provide a SSR core primer combination for identifying the tea variety "Wuyedancong".

[0007] The second object of the present invention is to provide the use of the above-mentioned SSR core primer combination in the preparation of an identification product of the tea variety "Wuyedancong".

[0008] The third object of the present invention is to provide a product comprising the above-mentioned SSR core primer combination for use in identifying the tea variety "Wuyedancong".

[0009] The fourth object of the present invention is to provide a kit for identifying the tea variety "Wuyedancong".

[0010] A fifth object of the present invention is to provide a method for identifying the tea variety "Wuyedancong".

[0011] To achieve the above-mentioned purpose, the present invention provides an SSR core primer combination for identifying the tea variety "Wuye Dancong", wherein the SSR core primer combination comprises SSR core primers represented by nucleotide sequences WY.SSR-1-F, WY.SSR-1-R, WY.SSR-2-F and WY.SSR-2-R; wherein: the primer sequence of WY.SSR-1-F is: GGCGAATGTTGAAGGTGCTG; the primer sequence of WY.SSR-1-R is: ATCGCCACTTTTGGGATCGA; the primer sequence of WY.SSR-2-F is: GCAATCTGGAGACCGAAGCT; the primer sequence of WY.SSR-2-R is: TTGTCGTCTGAGGAGCAACC.

[0012] The 5' end of the SSR core primer shown in the nucleotide sequence WY.SSR-1-F and / or the 5' end of the SSR core primer shown in the nucleotide sequence WY.SSR-2-F are labeled with a fluorescent reporter group.

[0013] The fluorescent reporter group is FAM, HEX, TAMRA or ROX.

[0014] The application of the above-mentioned SSR core primer combination in the preparation of the identification product of the tea variety "Wuye Dancong".

[0015] The application of the above-mentioned SSR core primer combination products in identifying the tea variety "Wuye Dancong".

[0016] A kit for identifying the tea variety "Wuyedancong", comprising the above-mentioned SSR core primer combination.

[0017] The kit also includes HSTaq DNA polymerase, dNTPs, 10×Buffer, a positive control reference substance, a negative control reference substance, and ultrapure water.

[0018] A method for identifying the tea variety "Wuye Dancong" using the above-mentioned SSR core primer combination or the above-mentioned kit for identification.

[0019] A method for identifying the tea variety "Wuye Dancong" comprises the following steps: S1. Extracting genomic DNA from the tea tree sample to be tested; S2. Using the genomic DNA extracted in step S1 as a template, PCR amplification was performed using the above-mentioned SSR core primer combination; S3. Typing the PCR amplification product obtained in step S2, and performing band discrimination on the typing result: When the SSR core primers shown by the nucleotide sequences WY.SSR-1-F and WY.SSR-1-R amplify two characteristic bands of 145bp and 160bp, and the SSR core primers shown by the nucleotide sequences WY.SSR-2-F and WY.SSR-2-R amplify two characteristic bands of 146bp and 149bp, it indicates that the tea tree sample to be tested is "Wuye Dancong"; the appearance of other bands indicates that the tea tree sample to be tested is not "Wuye Dancong".

[0020] The typing method described in the above step S3 is to perform capillary electrophoresis on the PCR amplification product; wherein the PCR amplification, the total reaction system is 10μL, including: 1μL of 10×Buffer I, 0.8μL of 2.5 mM dNTPs, 0.6μL of 2.5μM upstream primer, 0.6μL of 2.5μM downstream primer, 0.1μL of TAKARA HSTaq, 1μL of DNA, and 10μL of ddH2O; the PCR amplification reaction conditions are: pre-denaturation at 95℃ for 5min; denaturation at 94℃ for 30s; annealing at 60℃ for 30s for 35 cycles; extension at 72℃ for 30s; and finally extension at 60℃ for 30min.

[0021] Advantages and effects of the present invention: The present invention discloses an SSR core primer combination, a kit and an application for identifying the tea variety "Wuye Dancong". The present invention utilizes SSR fluorescent marker detection technology to screen and obtain two pairs of SSR core primers, which can quickly identify and detect "Wuye Dancong" from other tea varieties. The SSR core primer combination disclosed in the present invention can perform variety identification on "Wuye Dancong", overcomes the uncertainty of identification based on external morphological characteristics, has reliable and intuitive results, high detection efficiency, and is easy to operate. It is also beneficial to the promotion, utilization and protection of the variety "Wuye Dancong". BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Capillary electrophoresis bands of 28 tea varieties / lines amplified by the specific SSR core primers WY.SSR-1-F and WY.SSR-1-R in Example 1.

[0023] Figure 2Capillary electrophoresis bands of 28 tea varieties / lines amplified by the specific SSR core primers WY.SSR-2-F and WY.SSR-2-R in Example 1.

[0024] Figure 3 Capillary electrophoresis bands of 30 tea varieties / lines amplified by the specific SSR core primers WY.SSR-1-F and WY.SSR-1-R in Example 2.

[0025] Figure 4 Capillary electrophoresis bands of 30 tea varieties / lines amplified by the specific SSR core primers WY.SSR-2-F and WY.SSR-2-R in Example 2. DETAILED DESCRIPTION

[0026] The present invention is further described below with reference to specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0027] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0028] Example 1 Screening and obtaining of specific primer sequences of “Wuyedancong” 1. Experimental Methods 1. SSR primer design The genome sequence of the tea plant genome database (http: / / tpia.teaplants.cn / ) was searched using MISA software to retrieve the SSR sites in the genome sequence. Primer 5.0 was used to batch design 200 pairs of SSR primers, which were synthesized by Beijing Reader Gene Technology Co., Ltd.

[0029] 2. Extraction of DNA from tea varieties A preliminary screening was conducted using 28 tea varieties / lines with similar genetic and phenotypical characteristics, including “Wuye Dancong”, “Lingtou Dancong”, “Dancong No. 1” and “Huangjingui”, as well as the hybrid offspring of Wuye Dancong and Yinghong No. 9 (numbered A16-A28). The tea varieties / lines used in the preliminary screening are shown in Table 1 (taken from the Guangdong Tea Germplasm Resource Bank).

[0030] Table 1 28 tea varieties / lines used in the preliminary screening

[0031] DNA was extracted from the 28 tea varieties / lines (Table 1) used in the preliminary screening. The specific steps of DNA extraction were as follows: a) Take tea leaves and add liquid nitrogen to grind them thoroughly, and weigh about 100 mg of the ground powder.

[0032] b) Quickly add 400 μL of GPS buffer and 10 μL of RNase A to the ground powder, vortex quickly to mix, and place the centrifuge tube in a 65°C water bath for 15 min. Invert the centrifuge tube several times to mix the sample during the water bath.

[0033] c) Add 100 μL of buffer GPA, vortex for 1 min, centrifuge at 12,000 rpm for 5 min, transfer the supernatant to the filter column CS, then centrifuge at 12,000 rpm for 1 min, and transfer the filtrate to a new centrifuge tube.

[0034] d) Add an equal volume of anhydrous ethanol and mix thoroughly. Flocculent precipitation may appear at this time.

[0035] e) Transfer the solution and flocculent precipitate obtained in the previous step to RNase-Free adsorption column CR2, centrifuge at 12000 rpm for 1 min, discard the waste liquid, and place the RNase-Free adsorption column CR2 in a collection tube.

[0036] f) Add 550 μL of deproteinizing solution RD to the RNase-Free adsorption column CR2, centrifuge at 12,000 rpm for 1 min, discard the waste liquid, and place the RNase-Free adsorption column CR2 in a collection tube.

[0037] g) Add 700 μL of rinse solution PW to the RNase-Free adsorption column CR2, centrifuge at 12,000 rpm for 1 min, discard the waste liquid, and place the RNase-Free adsorption column CR2 in a collection tube.

[0038] h) Repeat step g.

[0039] i) Place the RNase-Free adsorption column CR2 back into the collection tube, centrifuge at 12,000 rpm for 2 min, discard the collection tube, and then transfer the RNase-Free adsorption column CR2 to a new centrifuge tube and dry it at room temperature for 5-10 min.

[0040] j) Add 50-100 μL of elution buffer TB to the RNase-Free adsorption column CR2, place at room temperature for 3-5 minutes, centrifuge at 12000 rpm for 2 minutes, collect the solution into a centrifuge tube, and obtain the tea tree genomic DNA.

[0041] 3. PCR Amplification The tea tree genomic DNA extracted in step 2 is used as a template, and PCR amplification is performed using the SSR fluorescent marker detection technology, wherein the primers include an upstream primer with a fluorescent reporter group (the fluorescent reporter group is FAM, HEX, TAMRA, or ROX, and the FAM fluorescent marker is used in the present invention) labeled at the 5' end, and a downstream primer. The PCR amplification guided by the upstream primer with a fluorescent reporter group labeled at the 5' end produces a PCR product with fluorescence.

[0042] For PCR amplification, the total reaction system was 10 μL, including: 10×Buffer I 1 μL, 2.5 mM dNTPs 0.8 μL, 2.5 μM upstream primer 0.6 μL, 2.5 μM downstream primer 0.6 μL, TAKARA HSTaq 0.1 μL, DNA 1 μL, and ddH2O to make up 10 μL.

[0043] The PCR amplification reaction conditions were as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s for 35 cycles; extension at 72°C for 30 s; and finally extension at 60°C for 30 min.

[0044] 4. Typing test Capillary electrophoresis detection: 9 μL of molecular weight internal standard and formamide mixture (volume ratio of 0.5:8.5) and 1.0 μL of PCR product were added to each well of a 96-well plate; denaturation was performed at 95°C for 3 min, and typing was performed using a 3730XL DNA analyzer.

[0045] 5. Data Analysis The raw data files obtained by 3730XL DNA analyzer were imported into the analysis software genemapper ID 3.2 for band discrimination analysis.

[0046] 2. Experimental Results Two pairs of specific SSR core primers were screened out from 200 pairs of SSR primers, namely WY.SSR-1-F, WY.SSR-1-R, WY.SSR-2-F and WY.SSR-2-R. The primer sequences are shown in Table 2.

[0047] Table 2 Specific SSR core primer sequences

[0048] The statistical results of capillary electrophoresis bands of 28 tea varieties / lines (Table 1) amplified by these two pairs of specific SSR core primers are shown in Tables 3 and Figures 1-2 As shown in the results, the "Wuyedancong" has characteristic bands, specifically: (1) The specific SSR core primers WY.SSR-1-F and WY.SSR-1-R amplified two characteristic bands of 145 bp and 160 bp respectively; (2) The specific SSR core primers WY.SSR-2-F and WY.SSR-2-R amplified two characteristic bands of 146 bp and 149 bp respectively.

[0049] The above results showed that the two pairs of specific SSR core primers could amplify characteristic bands for the tea variety "Wuye Dancong", so "Wuye Dancong" could be distinguished from the other 27 related and phenotypically similar tea varieties / lines.

[0050] Table 3 Statistics of capillary electrophoresis bands of 28 tea varieties / lines using two pairs of specific SSR core primers

[0051] Example 2 2 Further verification of specific SSR core primers 1. Experimental Methods The two pairs of specific SSR core primers WY.SSR-1-F and WY.SSR-1-R, WY.SSR-2-F and WY.SSR-2-R for identifying "Wuye Dancong" were further verified, and 29 tea varieties currently promoted and used in production were selected for amplification detection simultaneously with "Wuye Dancong". The specific information of the 30 tea varieties is shown in Table 4.

[0052] Table 4 30 tea varieties currently being promoted and applied in production

[0053] The extraction method, PCR amplification, typing detection and data analysis method of tea variety DNA are carried out according to Example 1.

[0054] 2. Experimental Results The statistical results of capillary electrophoresis bands of 30 tea varieties (Table 4) amplified by two pairs of specific SSR core primers are shown in Tables 5 and Figures 3-4 As shown, the results show that only "Wuye Dancong" has characteristic bands, specifically: (1) The specific SSR core primers WY.SSR-1-F and WY.SSR-1-R amplified two characteristic bands of 145 bp and 160 bp respectively; (2) The specific SSR core primers WY.SSR-2-F and WY.SSR-2-R amplified two characteristic bands of 146 bp and 149 bp respectively; The above results indicate that the two pairs of specific SSR core primers can amplify specific alleles for the tea variety "Wuye Dancong", and therefore can distinguish "Wuye Dancong" from the other 29 tea varieties currently promoted and applied in production.

[0055] Table 5 Statistics of capillary electrophoresis bands of 30 tea varieties promoted and applied

[0056] Example 3 A method for identifying "Wuyedancong" using specific SSR core primer combinations 1. Extract DNA from the tea variety "Wuyedancong" according to the method of Example 1; 2. Using the DNA extracted in step 1 as a template, PCR amplification was performed using two pairs of specific SSR core primers WY.SSR-1-F and WY.SSR-1-R, WY.SSR-2-F and WY.SSR-2-R. The sequences of the two pairs of specific SSR core primers are as follows, wherein the 5' end of the upstream primer is labeled with a fluorescent reporter group (the fluorescent reporter group can be FAM, HEX, TAMRA or ROX, and the HEX fluorescent label is used in the present invention): WY.SSR-1-F:GGCGAATGTTGAAGGTGCTG; WY.SSR-1-R: ATCGCCACTTTTGGGATCGA; WY.SSR-2-F: GCAATCTGGAGACCGAAGCT; WY.SSR-2-R: TTGTCGTCTGAGGAGCAACC; 3. PCR amplification method was carried out according to Example 1: The PCR product obtained in step 2 is subjected to typing detection and data analysis, and the typing detection and data analysis methods are both performed in accordance with Example 1.

[0057] 4. Interpretation of results: If the amplification products of the two pairs of specific SSR core primers show the following characteristic bands, it indicates that the tea variety to be tested is "Wuye Dancong"; if the following characteristic bands do not appear, it indicates that the tea variety to be tested is not "Wuye Dancong": (1) The specific SSR core primers WY.SSR-1-F and WY.SSR-1-R amplified two characteristic bands of 145 bp and 160 bp respectively; (2) The specific SSR core primers WY.SSR-2-F and WY.SSR-2-R amplified two characteristic bands of 146 bp and 149 bp respectively.

[0058] Example 4

[0059] A kit for identifying the tea variety "Wuyedancong" 1. Composition (1) Two pairs of specific SSR core primers, wherein the 5' end of the upstream primer is labeled with a fluorescent reporter group (the fluorescent reporter group can be FAM, HEX, TAMRA or ROX, and the HEX fluorescent label is used in the present invention): WY.SSR-1-F:GGCGAATGTTGAAGGTGCTG; WY.SSR-1-R: ATCGCCACTTTTGGGATCGA; WY.SSR-2-F: GCAATCTGGAGACCGAAGCT; WY.SSR-2-R: TTGTCGTCTGAGGAGCAACC; (2) HSTaq DNA polymerase, dNTPs, 10×Buffer, positive control reference, negative control reference, and ultrapure water.

[0060] 2. Usage The detection and result interpretation were performed according to the method of Example 3.

[0061] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A SSR core primer combination for identifying the tea variety "Wuyedancong", characterized in that: The SSR core primer combination comprises SSR core primers represented by nucleotide sequences WY.SSR-1-F, WY.SSR-1-R, WY.SSR-2-F and WY.SSR-2-R; wherein: the primer sequence of WY.SSR-1-F is: GGCGAATGTTGAAGGTGCTG; the primer sequence of WY.SSR-1-R is: ATCGCCACTTTTGGGATCGA; the primer sequence of WY.SSR-2-F is: GCAATCTGGAGACCGAAGCT; the primer sequence of WY.SSR-2-R is: TTGTCGTCTGAGGAGCAACC.

2. The SSR core primer combination according to claim 1, characterized in that The 5' end of the SSR core primer shown in the nucleotide sequence WY.SSR-1-F and / or the 5' end of the SSR core primer shown in the nucleotide sequence WY.SSR-2-F are labeled with a fluorescent reporter group.

3. The SSR core primer combination according to claim 2, characterized in that The fluorescent reporter group is FAM, HEX, TAMRA or ROX.

4. Use of the SSR core primer combination described in any one of claims 1 to 3 in preparing an identification product of the tea variety "Wuyedancong".

5. Use of a product comprising the SSR core primer combination described in any one of claims 1 to 3 in identifying the tea variety "Wuyedancong".

6. A kit for identifying the tea variety "Wuyedancong", characterized in that: Comprising the SSR core primer combination described in any one of claims 1 to 3.

7. The kit according to claim 6, characterized in that The kit also includes HSTaq DNA polymerase, dNTPs, 10×Buffer, a positive control reference substance, a negative control reference substance, and ultrapure water.

8. A method for identifying the tea variety "Wuye Dancong", characterized in that: The identification is performed using the SSR core primer combination described in any one of claims 1 to 3 or the kit described in any one of claims 6 to 7.

9. The method according to claim 8, characterized in that The following steps are involved: S1. Extracting genomic DNA from the tea tree sample to be tested; S2. Using the genomic DNA extracted in step S1 as a template, using the SSR core primer combination described in any one of claims 1 to 3 Perform PCR amplification; S3. Typing the PCR amplification product obtained in step S2, and performing band discrimination on the typing result: When the SSR core primers shown by the nucleotide sequences WY.SSR-1-F and WY.SSR-1-R amplify two characteristic bands of 145bp and 160bp, and the SSR core primers shown by the nucleotide sequences WY.SSR-2-F and WY.SSR-2-R amplify two characteristic bands of 146bp and 149bp, it indicates that the tea tree sample to be tested is "Wuye Dancong"; the appearance of other bands indicates that the tea tree sample to be tested is not "Wuye Dancong".

10. The method according to claim 9, characterized in that The typing method in step S3 is to perform capillary electrophoresis on the PCR amplification product; For PCR amplification, the total reaction system was 10 μL, including: 10×Buffer I 1 μL, 2.5 mM dNTPs 0.8 μL, 2.5 μM upstream primer 0.6 μL, 2.5 μM downstream primer 0.6 μL, TAKARA HSTaq 0.1 μL, DNA 1 μL, and ddH2O 10 μL; the PCR amplification reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s for 35 cycles; extension at 72°C for 30 s; and finally extension at 60°C for 30 min.

Images