Application of phosphatidylcholine 36: 1 in prevention and treatment of senescence cognitive impairment

Abstract

The invention provides an application of phosphatidylcholine 36: 1 in prevention and treatment of senescence cognitive impairment, and particularly relates to an application of phosphatidylcholine 36: 1 or a pharmaceutical composition containing phosphatidylcholine 36: 1 in preparation of drugs for prevention and / or treatment of senescence cognitive impairment. The phosphatidylcholine 36: 1 can improve the level of superoxide dismutase and glutathione peroxidase in the brain of the mouse and reduce the lipid oxidation level at the same time. After the phosphatidylcholine 36: 1 is used for treatment, the levels of inflammatory factors interleukin 1 beta, interleukin 6 and tumor necrosis factor alpha in the brain are obviously reduced. Meanwhile, neurotransmitter disorder in brains of senescent mice can be remarkably improved. After qRT-PCR analysis is carried out in the brain of a mouse, it is found that after phosphatidylcholine 36: 1 treatment, the senescence gene level is remarkably reduced, the pro-apoptosis gene level is remarkably reduced, and the anti-apoptosis gene level is remarkably increased. And after in vitro administration of phosphatidylcholine 36: 1 to mouse hippocampal neuronal cells, no cytotoxicity is found. Therefore, the phosphatidylcholine 36: 1 can be used for preventing and treating senescence cognitive impairment.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to the application of phosphatidylcholine 36:1 in preventing and treating aging-related cognitive impairment. Background Art

[0002] The global population is aging rapidly. This trend has raised multiple challenges to social, economic, and healthcare systems, especially as the risk of cognitive impairment, including dementia and mild cognitive impairment (MCI), increases with age. Therefore, it is crucial to develop drugs that can improve or maintain cognitive abilities in the elderly. Although the FDA has approved four drugs for improving cognition in Alzheimer's disease, potential drugs for age-related cognitive impairment are still under active development. Current drugs cannot cure aging-related cognitive impairment, but can only temporarily relieve symptoms, and patient responses vary significantly. In addition, drug treatment may bring side effects such as nausea, vomiting, loss of appetite, etc., which affect patients' treatment compliance.

[0003] In recent years, a large number of studies have shown that phosphatidylcholine is closely related to the development of aging-related cognitive impairment. The brain is rich in lipids, which increase in the first 20 years of human life and then begin to gradually decrease after the age of 50. Lipid dysregulation is considered to be the basis of several cognitive impairments. It is reported that the content of docosahexaenoic acid (DHA) and arachidonic acid (ARA) in the cerebral cortex decreases significantly with age. Phospholipids are the main components of membranes, and the disorder of lipid composition during aging may affect membrane fluidity, leading to impaired transport, release and reception of neurotransmitters. The composition of triglycerides, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, sphingomyelin and sterols changes in AD or aging brains, and these changes may lead to changes in membrane fluidity and integrity. Subtle changes in lipid composition can affect brain function, including structural development, nerve impulse transmission, neurogenesis, synaptogenesis and myelination. Since lipids are mainly absorbed through diet, lipid supplementation is a promising intervention for preventing brain aging-related diseases.

[0004] At present, the clinical treatment of age-related cognitive impairment has the following defects: 1) The treatment plan is relatively simple and there are few clinically approved drugs; 2) Current drugs cannot cure age-related cognitive impairment and can only temporarily relieve symptoms; 3) Drug treatment may bring side effects, such as nausea, vomiting, loss of appetite, etc., which may affect patients' treatment compliance; 4) Individual differences: There are obvious individual differences between patients, so there may be differences in the efficacy of the same treatment plan; 5) Lack of effective treatment methods.

[0005] Therefore, it is urgent to seek new methods and new ideas for treating aging-related cognitive impairment. Summary of the invention

[0006] In view of the above-mentioned existing technologies, the preventive and therapeutic effects of phosphatidylcholine 36:1 on aging-related cognitive impairment are investigated, the development of drugs for the prevention and treatment of aging-related cognitive impairment by phosphatidylcholine 36:1 is promoted, and effective intervention methods for the treatment of aging-related cognitive impairment are provided.

[0007] The first object of the present invention is to provide the use of phosphatidylcholine 36:1 in the preparation of drugs for preventing and / or treating senile cognitive impairment.

[0008] The structural formula of phosphatidylcholine 36:1 of the present invention is:

[0009]

[0010] The second object of the present invention is to provide a use of a pharmaceutical composition comprising phosphatidylcholine 36:1 in the preparation of a drug for preventing and / or treating senile cognitive impairment.

[0011] Furthermore, the drug prevents and / or treats aging-related cognitive impairment by reducing oxidative stress in the brain, reducing inflammatory response in the brain, increasing neurotransmitter levels in the brain, and reducing brain aging and neuronal apoptosis.

[0012] The beneficial effects of the present invention are:

[0013] Behavioral experiments have shown that administration of phosphatidylcholine 36:1 can significantly improve age-related cognitive impairment in mice. Age-related cognitive impairment in mice is also accompanied by brain aging, oxidative stress, chronic low-grade inflammation, and neurotransmitter level disorders.

[0014] The results of the oxidative stress and inflammatory factor kit test showed that phosphatidylcholine 36:1 can increase the levels of superoxide dismutase and glutathione peroxidase in the mouse brain, while reducing the level of lipid oxidation. After treatment with phosphatidylcholine 36:1, the levels of inflammatory factors interleukin 1β, interleukin 6 and tumor necrosis factor α in the brain were significantly reduced. After LC-MS / MS determination, it was found that phosphatidylcholine 36:1 can significantly improve neurotransmitter disorders in the brains of aging mice. After qRT-PCR analysis of the mouse brain, it was found that after treatment with phosphatidylcholine 36:1, the levels of aging genes were significantly reduced, the levels of pro-apoptotic genes were significantly reduced, and the levels of anti-apoptotic genes were significantly increased. In addition, no cytotoxicity was observed after phosphatidylcholine 36:1 was administered to mouse hippocampal neurons in vitro. Therefore, phosphatidylcholine 36:1 can be used for the prevention and treatment of aging-related cognitive impairment and meets the requirements of biosafety. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Phosphatidylcholine 36:1 improves learning and memory abilities in aging mice, including:

[0016] Figure 1(A) Trajectory diagram of novel object recognition in mice;

[0017] Figure 1 (B) Exploration time ratio during training period;

[0018] Figure 1 (C) Preference index in the novel object recognition test;

[0019] Figure 1 (D) Exploration time ratio in the novel object recognition test;

[0020] Figure 1 (E) Heat map of the mouse Y-maze;

[0021] Figure 1 (F) Y-maze spontaneous alternation rate;

[0022] Figure 1 (G) Number of entries into the novel arm in the Y-maze novel arm test;

[0023] Figure 1 (H) Time to enter the novel arm in the Y-maze novel arm test.

[0024] Figure 2 Phosphatidylcholine 36:1 alleviates oxidative factors and inflammatory factors in the brain of aging mice, including:

[0025] Figure 2 (A) Total antioxidant capacity in mouse brain;

[0026] Figure 2 (B) Superoxide dismutase activity;

[0027] Figure 2 (C) Glutathione peroxidase activity;

[0028] Figure 2 (D) Malondialdehyde level;

[0029] Figure 2 (E) interleukin-6 levels;

[0030] Figure 2 (F) Tumor necrosis factor α level;

[0031] Figure 2 (G) Interleukin-1β levels.

[0032] Figure 3 Phosphatidylcholine 36:1 improves neurotransmitter levels, brain aging and neuronal apoptosis in mice brains, including:

[0033] Figure 3 (A) Relative content of neurotransmitters in mouse brain;

[0034] Figure 3(B) Relative expression of aging genes and apoptosis genes in mouse brain.

[0035] Figure 4 Effects of phosphatidylcholine 36:1 on the survival rate of hippocampal neurons in HT22 mice DETAILED DESCRIPTION

[0036] The present invention is further explained below with reference to the examples, but the examples do not limit the present invention in any form.

[0037] Example 1

[0038] Step 1: Establishment of a mouse model of aging-related cognitive impairment

[0039] The aging model was established using the D-galactose method. The specific steps are as follows:

[0040] (1) Preparation of D-galactose solution: Dissolve D-galactose in sterile physiological saline to prepare a 10% (W / V, g / 100 mL) D-galactose solution.

[0041] (2) Establishment of a mouse model of aging-related cognitive impairment: The model group and the treatment group were intraperitoneally injected with 1000 mg / kg of D-galactose for 75 days, and the control group was intraperitoneally injected with an equal amount of normal saline.

[0042] The results showed that the preference index and exploration time ratio of mice to new objects were significantly reduced after modeling ( Figure 1 C, D), the Y-maze spontaneous alternation rate and the number and time of entering the new arm were significantly reduced ( Figure 1 FH), neurological function was damaged, indicating that the aging-related cognitive impairment model was successfully established.

[0043] Step 2: Administration of Phosphatidylcholine 36:1

[0044] 5 mg of phosphatidylcholine 36:1 was weighed and dissolved in 1 mL of normal saline to prepare a suspension, which was intraperitoneally injected into the mice in the treatment group at a dose of 10 mg / kg starting from the 35th day for 30 days.

[0045] The control group and the model group were intraperitoneally injected with the same dose of normal saline.

[0046] Step 3: Study on the effect of phosphatidylcholine 36:1 on learning and memory ability of aging mice

[0047] (1) New object experimental test: It is divided into three stages: adaptation stage, familiarization stage and test stage.

[0048] On the first day of the adaptation phase, the animals were placed in an empty box with their heads facing the side closest to the experimenter, and allowed to move freely for 5 minutes. After the experiment, the mice were taken out and returned to their original cages, and the empty box was cleaned with 70% alcohol to remove the odor left by the previous animal.

[0049] On the second day of the familiarization phase, two identical objects (black cylinders) were fixed 5 cm away from the two box walls. Randomization had been performed in advance in different mice and different groups. The animals were then placed in an empty box with their heads facing opposite directions of the two identical objects and allowed to move freely in the box. Anymaze software was used to calculate the exploration time of the animals on the two objects. After the experiment, the animals were removed and the empty boxes and objects were cleaned with 70% alcohol to remove the smell left by the animals.

[0050] On the third day of the test phase, 24 hours later, similar to the familiarization phase, one of the same objects was replaced with another object (white cylinder). Anymaze was used to calculate the time the animals spent exploring each of the two objects.

[0051] (2) Y-maze novel arm recognition test: Mark the three arms of the maze as A, B, and C. Close one of the arms with a partition. Record which arm is closed. Place the animal into an open arm facing the center and record which arm the animal was placed in to leave the behavioral testing room. Allow the animal to freely explore the maze for 5 minutes. Return the test mouse to its home cage. After waiting for 1 hour, remove the partition and place the same test mouse at the far end of the same arm used in the previous trial, facing the center of the maze. Allow the animal to freely explore the maze for 5 minutes, record the video and save the file. Remove the mouse from the maze and return it to the cage. Clean all walls and floor of the maze before proceeding to the next animal. At the end of the experiment, use Anymaze software to analyze the number of entries into each arm and the time spent in each arm during the test.

[0052] (3) Y-maze spontaneous alternation test: The three arms of the maze are A, B, and C. Place the test animal at the far end of the arm marked A, facing the center of the maze, and gently grasp the base of the tail. Allow the mouse to freely explore the maze for 5 minutes. After the end, remove the mouse from the maze and return it to the original cage. And before proceeding to the next animal, clean all the walls and floors of the maze. Check the video and record all the times of entering the arm and the number of alternations. Spontaneous alternation rate (%) = [(spontaneous alternation number) / (total number of arm entries-2)]×100.

[0053] The results showed that after phosphatidylcholine 36:1 treatment, the mice explored the new object area significantly more ( Figure 1 A), the preference index and exploration time ratio of mice to new objects increased significantly ( Figure 1C, D). The Y-maze test showed that the time and frequency of exploration in the new arm of mice treated with phosphatidylcholine 36:1 were significantly higher than those of the control group ( Figure 1 E), the spontaneous alternation rate increased significantly ( Figure 1 F), the number and time of entering the new arm to explore were significantly improved ( Figure 1 G, H), the above results show that phosphatidylcholine 36:1 treatment can significantly improve the learning and memory ability of mice ( Figure 1 ).

[0054] Step 4: Effects of phosphatidylcholine 36:1 on oxidative stress and inflammatory factor levels in the brain of aged mice

[0055] (1) According to the instructions of the Bio-Tian Total Antioxidant Capacity Test Kit, add 200 μl of ABTS working solution to each test well of the 96-well plate. Add 10 μl of distilled water or PBS or other appropriate solution to the blank control well; add 10 μl of Trolox standard solution of various concentrations to the standard curve test well; add 10 μl of various samples to the sample test well. Mix gently. Incubate at room temperature for 2-6 minutes and then measure A734. Calculate the total antioxidant capacity of the sample based on the standard curve.

[0056] (2) Total glutathione peroxidase detection: According to the instructions of the Biyuntian Total Glutathione Peroxidase Detection Kit, use a 96-well plate, add the detection buffer, the sample to be tested and the GPx detection working solution in sequence, mix well, add 40 microliters of GPx detection working solution, and incubate at room temperature for 15 minutes to consume the GSSG in the sample and eliminate interference with subsequent detection. Add 10 microliters of 30mM peroxide reagent solution to each well and mix well. Immediately use an ELISA reader to measure A340, and record it as the 0-minute reading. Measure A340 every 1 minute. Calculate the total glutathione peroxidase activity according to the instructions.

[0057] (3) Total superoxide dismutase activity detection: According to the instructions of the Bio-Time Total SOD Activity Detection Kit, set up sample wells and various blank control wells in a 96-well plate. Add the sample to be tested and SOD buffer, enzyme working solution and reaction starter solution in sequence. After adding the reaction starter working solution, mix thoroughly. Detect the enzyme activity at A450.

[0058] (4) Malondialdehyde content detection: According to the instructions of the Solebold Malondialdehyde Content Detection Kit, add 300 μl of detection working solution, 100 μl of sample and 100 ul of reagent three mixed solutions into a 1.5 ml EP tube, keep in a 100°C water bath for 60 min, cool in an ice bath, and centrifuge at 10000 g for 10 min at room temperature. Pipette 200 mL of supernatant into a 96-well plate, and measure the absorbance of each sample at 532 nm and 600 nm.

[0059] (5) Mouse interleukin-6 enzyme-linked immunosorbent assay kit

[0060] 1. Set up standard wells, blank wells, and sample wells respectively. Add 100 μL of the diluted standard to the standard wells, 100 μL of the standard & sample diluent to the blank wells, and 100 μL of the sample to be tested to the remaining wells. Cover the ELISA plate with film and incubate at 37°C for 90 minutes.

[0061] 2. Shake off the liquid in the wells without washing. Add 100 μL of biotinylated antibody working solution to each well, cover the ELISA plate with a film, and incubate at 37°C for 1 hour.

[0062] 3. Shake off the liquid in the wells and pat dry on clean absorbent paper. Add 350μL of washing solution to each well, soak for 1 minute, absorb or shake off the liquid in the ELISA plate, and pat dry. Repeat this washing step 3 times. After washing, please proceed to the next step immediately and do not let the microplate dry.

[0063] 4. Add 100 μL of HRP enzyme conjugate working solution to each well, cover the ELISA plate with a film, and incubate at 37°C for 30 minutes.

[0064] 5. Shake off all liquid in the wells and wash the plate 5 times using the same method as step 3.

[0065] 6. Add 90 μL of substrate solution (TMB) to each well, cover the ELISA plate with a film, and incubate at 37°C in the dark for about 15 minutes. Tip: shorten or extend the time as appropriate according to the actual color development, but do not exceed 30 minutes. When a clear gradient appears in the standard well (clear blue gradient appears in the first 4 color development wells), it can be terminated.

[0066] 7. Add 50 μL of stop solution to each well to terminate the reaction.

[0067] 8. Immediately measure the optical density (OD value) of each well at a wavelength of 450 nm using an enzyme reader.

[0068] (6) Mouse tumor necrosis factor α enzyme-linked immunosorbent assay kit

[0069] The procedure is the same as that of (5) Mouse Interleukin-6 ELISA Kit.

[0070] (7) Mouse interleukin-1β enzyme-linked immunosorbent assay kit

[0071] The procedure is the same as that of (5) Mouse Interleukin-6 ELISA Kit.

[0072] The results showed that the total antioxidant capacity, superoxide dismutase activity and glutathione peroxidase activity in the brain of mice were significantly increased after treatment with phosphatidylcholine 36:1 ( Figure 2 AC), the malondialdehyde content was significantly reduced ( Figure 2 D), the level of oxidative stress in the brain was reduced. After phosphatidylcholine 36:1 treatment, the levels of interleukin-6, interleukin-1β, and tumor necrosis factor-α in the brain of mice were significantly reduced ( Figure 2 EG), the level of inflammatory factors in the brain returned to normal and brain damage was improved.

[0073] Step 5: Effects of phosphatidylcholine 36:1 on neurotransmitter levels, brain aging and neuronal apoptosis in the brain of aged mice

[0074] (1) Neurotransmitter sampling in mouse brain tissue

[0075] First, brain tissue samples were taken from mice in the control group, model group, and treatment group, and then homogenized with water containing 20 mM ascorbic acid at a mass volume ratio (w / v) of 1:10. Then, four times the volume of methanol containing 1 μg / ml chlorophenylalanine (Cl-Phe) was added for protein precipitation. After the sample was centrifuged at 18000 rpm for 10 minutes, 200 μl of the supernatant was transferred to a 1.5 ml Eppendorf tube and centrifuged again at 18000 rpm for 10 minutes. Subsequently, 120 μl of the supernatant was transferred to an injection vial, from which 5 μl of the sample was taken for LC-MS / MS analysis.

[0076] The mass spectrometry parameters are shown in the following table:

[0077] Metabolites Q1 Mass(Da) Q2Mass(Da) Time(msec) DP(volts) CE(volts) Glutamate 148.400 102.00 50.0 40.000 14.000 Norepinephrine 170.000 152.000 50.0 40.000 15.000 Cyclic Adenosine 330.100 136.100 50.0 70.000 32.000 Dopamine 154.100 137.100 50.0 40.000 15.000 Serotonin 177.600 161.100 50.0 50.000 16.000 Chlorophenylalanine 200.200 118.100 50.0 80.000 46.000

[0078] (2) qRT-PCR of mouse brain tissue genes

[0079] Total RNA was extracted with TRIzol reagent (Takara) and reverse transcribed into cDNA for qPCR (Vazyme) using HiScript III-RTSuperMix according to the manufacturer's instructions. GAPDH was used as an internal reference gene.

[0080] The primer sequences used for RT-qPCR are shown in the table:

[0081] Primers Upstream primer Downstream primer P53 CTCCGAAGACTGGATGACTG(SEQ ID NO.1) ACAGATCGTCCATGCAGTGAG(SEQ ID NO.2) P21 CAGATCCACAGCGATATCCAG(SEQ ID NO.3) AGAGACAACGGCACACTTTG(SEQ ID NO.4) P16 GCGATATTTGCGTTCCGCTG(SEQ ID NO.5) AGCTCTGCTCTTGGGATTGG(SEQ ID NO.6) Bax CCAAGAAGCTGAGCGAGTGT(SEQ ID NO.7) ACGTCAGCAATCATCCTCTGC(SEQ ID NO.8) Bcl-2 CTTTGAGTTCGGTGGGGTCA(SEQ ID NO.9) ATCCACAGGGCGATGTTGTC(SEQ ID NO.10) Caspase 3 ATGGGAGCAAGTCAGTGGAC(SEQ ID NO.11) AGAGCGAGATGACATTCCAGT(SEQ ID NO.12) GAPDH TGGATTTGGACGCATGGTC(SEQ ID NO.13) TTTGCACTGGTACGTGTTGAT(SEQ ID NO.14)

[0082] The results showed that the neurotransmitter levels in the brain of aging mice were significantly reduced, the expression of aging genes and pro-apoptotic genes was significantly increased, and the expression of anti-apoptotic genes was significantly reduced. After administration of phosphatidylcholine 36:1, the neurotransmitter levels in the brain were significantly improved, and the levels of acetylcholine, serotonin, cyclic adenosine, norepinephrine, and dopamine were significantly increased ( Figure 3 A), the expression of aging genes P53, P21, P16 and pro-apoptotic genes Bax and Caspase3 decreased, and the expression of anti-apoptotic gene Bcl-2 increased ( Figure 3B), Phosphatidylcholine 36:1 can significantly improve neurotransmitter levels and reduce the occurrence of brain aging and neuronal apoptosis.

[0083] Step 6: Effect of phosphatidylcholine 36:1 on the survival rate of hippocampal neurons in HT22 mice

[0084] (1) Cell recovery: Shake and thaw the cryotube containing 1 mL of HT22 cell suspension (purchased from Ningbo Mingzhou Biotechnology Co., Ltd.) in a 37°C water bath quickly, add 4 mL of DMEM complete medium (purchased from Gibco) containing 10% fetal bovine serum and mix well. Centrifuge at 1000 RPM for 4 minutes, discard the supernatant, add 1-2 mL of DMEM complete medium and blow evenly. Then add all the cell suspension to the culture bottle and culture overnight.

[0085] (2) Cell passaging: If the cell density reaches 80%-90%, you can proceed to passaging. Discard the culture supernatant and rinse the cells 1-2 times with PBS that does not contain calcium and magnesium ions. Add 2mL of digestion (0.25% Trypsin-0.53mM EDTA) to the culture bottle and place it in a 37°C incubator for 1-2 minutes. Then observe the cell digestion under a microscope. If most of the cells become round and fall off, quickly take it back to the operating table, tap the culture bottle a few times, and add 2mL of DMEM complete medium to terminate the digestion. Gently blow the cells down and then aspirate them, centrifuge at 1000RPM for 4 minutes, discard the supernatant, add 1mL of DMEM complete medium and blow evenly. Divide the cell suspension into new culture bottles containing 5mL of DMEM complete medium in a ratio of 1:2 for culture.

[0086] (3) Cell spotting: After the revived cells are cultured normally for two generations, the cells are spotted, the culture supernatant is discarded, and the cells are rinsed 1-2 times with PBS without calcium and magnesium ions. 2mL of digestion (0.25% Trypsin-0.53mM EDTA) is added to the culture bottle, placed in a 37°C incubator for digestion for 1-2 minutes, and then the cell digestion is observed under a microscope. If most of the cells become round and fall off, quickly take them back to the operating table, tap the culture bottle a few times, and add 2mL of DMEM complete medium to terminate the digestion. The cells are gently blown down and then sucked out, centrifuged at 1000RPM for 4 minutes, the supernatant is discarded, 1mL of DMEM complete medium is added, and then the cells are blown evenly, and the cells are counted, and then an appropriate amount of cell suspension is sucked and added to the DMEM complete medium and mixed evenly, and 100μL of cell suspension containing 10,000 cells is added to each well of the 96-well plate. After culturing in a 37°C incubator for 12 hours, the culture medium in each well was removed, 100 μL of DMEM culture medium was added to the control group, and the same volume of DMEM culture medium containing 5 μM, 10 μM, 20 μM, 50 μM, and 100 μM phosphatidylcholine 36:1 was added to the remaining wells in sequence and cultured in a 37°C incubator for 24 hours.

[0087] (4) Cell viability determination

[0088] Remove the culture medium from each well, add 10 μL CCK-8 solution and 100 μL DMEM culture medium to each well. Set up a blank control well with the corresponding amount of cell culture medium and CCK-8 solution but no cells. Continue incubation in the cell culture incubator for 1 hour, and measure the absorbance at 450 nm.

[0089] Cell survival rate % = (cell absorbance of each well - absorbance of blank control) / (mean absorbance of control group - absorbance of blank control group) * 100%

[0090] The results showed that 5-100 μM concentration of phosphatidylcholine 36:1 had no effect on the survival rate of HT22 mouse hippocampal neurons ( Figure 4 ), indicating that phosphatidylcholine 36:1 has no obvious toxic side effects on brain neurons.

[0091] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of phosphatidylcholine 36:1 in the preparation of drugs for preventing and / or treating senile cognitive impairment.

2. Use of a pharmaceutical composition comprising phosphatidylcholine 36:1 in the preparation of a drug for preventing and / or treating senile cognitive impairment.

3. The use according to claim 1 or 2, characterized in that: The drug prevents and / or treats aging-related cognitive impairment by reducing oxidative stress in the brain, reducing inflammatory response in the brain, increasing neurotransmitter levels in the brain, and reducing brain aging and neuronal apoptosis.

Images