DNA tetrahedral nano delivery material as well as preparation method and application thereof

Abstract

The invention relates to a DNA tetrahedral nano delivery material as well as a preparation method and application thereof, and belongs to the technical field of nucleic acid nano materials. According to the nucleic acid nano material, single-stranded DNA molecules TET-1, TET-2, TET-3 and TET-4 are self-assembled in an aminoguanidine aqueous solution through base complementary pairing to form a tetrahedral structure, and each tetrahedron can carry four STING siRNAs. Through an aminoguanidine mediating system and in combination with a constant temperature and gradient annealing process, the prepared material shows remarkable stability and biocompatibility in a serum environment, and meanwhile, efficient uptake of macrophages can be achieved without a transfection agent. The preparation process is simple and convenient, the material stability is good, the material has wide medical application prospects, and particularly the potential of application in nucleic acid drug development and preparation of drugs for treating acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) is huge.

Description

Technical Field

[0001] The invention belongs to the field of nucleic acid nanomaterials, and relates to a DNA tetrahedron nano delivery material and a preparation method and application thereof. Background Art

[0002] DNA is a natural component in the human body. Short-chain DNA has no immunogenicity and potential toxicity, and is easily biodegradable. At the same time, according to the principle of DNA base complementary pairing, DNA nanomaterials can achieve good programmability, can accurately control the loading amount and spatial arrangement of drugs at the nanoscale, and have the potential to achieve targeted treatment. Therefore, self-assembled DNA nanomaterials have great application prospects in disease treatment.

[0003] With the rapid development of bio-nanotechnology, nucleic acid nanomaterials have been widely used in targeted drug delivery, gene therapy, and bioimaging due to their unique structural properties and excellent biocompatibility. 2+ )-mediated self-assembly method. This method neutralizes the negative charge of DNA molecules and promotes base complementary pairing to form nanostructures. As a classic DNA nanostructure, DNA tetrahedron has shown broad application prospects in drug delivery, tumor treatment and biological detection.

[0004] CN116920108A invention discloses a DNA tetrahedron drug, which can be synthesized by a gradient annealing procedure, has a simple preparation method, and has strong serum stability under physiological conditions. In addition, its DNA tetrahedron cell uptake efficiency is relatively high. The relatively simple synthesis process and the stability of the DNA tetrahedron nanomaterial in vivo make it have good application prospects. Although the existing magnesium ion-mediated self-assembly method has made some progress, it still has the following significant defects:

[0005] Poor biocompatibility: High concentrations of magnesium ions have certain toxic effects on cells, which may interfere with the activity of intracellular enzymes and induce stress responses, which is not conducive to biomedical applications.

[0006] Poor structural stability: Magnesium ion-mediated DNA nanomaterials are easily degraded in the serum environment, resulting in insufficient material stability and functional persistence.

[0007] Low cell uptake efficiency: DNA nanomaterials carry a strong negative charge, which limits their effective uptake by cells. Transfection reagents or vectors are usually required to improve endocytosis efficiency.

[0008] Harsh preparation conditions: Magnesium ion-mediated self-assembly is sensitive to ion concentration and reaction conditions, resulting in poor stability and consistency between material batches and complex preparation processes.

[0009] It is difficult for DNA to remain stable in the body (endoplasmic reticulum clearance system, liver and kidney metabolism) for a sufficient period of time to ensure the effectiveness of drugs. How to construct composite functional DNA nanomaterials, while giving full play to the excellent characteristics of DNA such as design and programming, and making them suitable for biomedical applications is the key to the application and transformation of DNA nanomaterials.

[0010] The current global morbidity and mortality of acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) remain high, and there is still a lack of effective treatments. Clinically, there is an urgent need for a nanoformulation with good biocompatibility, strong targeting, and significant therapeutic effect to improve disease prognosis. In addition, with the rapid development of gene therapy and precision medicine, the market demand for efficient and safe nucleic acid drug delivery systems is growing, especially for targeted therapeutic products for inflammatory diseases. Summary of the invention

[0011] In view of this, the purpose of the present invention is to provide a DNA tetrahedron nano delivery material, which is self-assembled by four single-stranded DNA molecules under the mediation of aminoguanidine. One-third of the sequence of each DNA single strand is complementary to the bases of the other three single strands to form a single face of the tetrahedron, and the four single faces finally form a complete DNA tetrahedron. The four vertices of the tetrahedron are four functional sites, which carry siRNA through base complementary pairing. This DNA tetrahedron structure can target the delivery of DNA nanoparticles of four siRNAs, and aminoguanidine replaces magnesium ions as a mediator for the self-assembly of nucleic acid nanomaterials. The second purpose of the present invention is to provide a method for preparing a DNA tetrahedron nano delivery material. Under the mediation of an aminoguanidine aqueous solution, the DNA tetrahedron can achieve gradient or constant temperature annealing self-assembly. The third purpose of the present invention is to use the DNA tetrahedron nano delivery material in the preparation of pharmaceutical preparations, especially in the nano preparations for the treatment of acute lung injury (ALI) or acute respiratory distress syndrome (ARDS).

[0012] In order to achieve the above object, the present invention provides the following technical solutions:

[0013] The present invention provides a DNA tetrahedron nano-delivery material, wherein the DNA tetrahedron is formed by four DNA single-strands TET-1, TET-2, TET-3, and TET-4 bases being complementary to each other, the 5' ends of the four DNA single-strands are complementary to single-stranded siRNA, and the four DNA single-strands and siRNA are self-assembled in an aminoguanidine aqueous solution to form the DNA tetrahedron nano-delivery material.

[0014] The nucleotide sequence of TET-1 is shown in SEQ ID NO: 1, the nucleotide sequence of TET-2 is shown in SEQ ID NO: 2, the nucleotide sequence of TET-3 is shown in SEQ ID NO: 3, and the nucleotide sequence of TET-4 is shown in SEQ ID NO: 4. The siRNA is STING siRNA, and the nucleotide sequence is shown in SEQ ID NO: 5;

[0015] The molar ratio of the siRNA, TET-1, TET-2, TET-3, and TET-4 is 4:1:1:1:1;

[0016] Further, the preparation method of DNA tetrahedral nano delivery material comprises the following steps:

[0017] S1: preparing TET-1, TET-2, TET-3, TET-4 aqueous solutions;

[0018] S2: TET-1, TET-2, TET-3, and TET-4 aqueous solutions are taken in an aminoguanidine aqueous solution at a molar concentration ratio of 1:1:1:1 and complementary paired, and DNA tetrahedrons are synthesized under a gradient annealing or / and constant temperature annealing program to obtain a DNA tetrahedron solution.

[0019] S3: adding the siRNA solution to the DNA tetrahedron solution in step S2, and incubating at 37° C. for 30 min to obtain the DNA tetrahedron nanomaterial solution;

[0020] In step S2, the gradient annealing is performed at 95°C for 5 min, 65°C for 30 min, 50°C for 30 min, 37°C for 30 min, and then 22°C for 30 min;

[0021] In step S2, the constant temperature annealing program is 37°C or 45°C, and the mixture is placed at the constant temperature for 30 to 90 minutes, the DNA solution is mixed, and the mixture is placed at the same constant temperature for 30 to 90 minutes;

[0022] In step S2, the pH value of the aminoguanidine aqueous solution is 5.0-9.0;

[0023] In step S2, the concentration of the aminoguanidine aqueous solution is 50 mM;

[0024] Further, the application of DNA tetrahedral nano-delivery materials in the preparation of drug preparations;

[0025] The invention discloses an application of the DNA tetrahedral nano delivery material in preparing a nano drug preparation for treating acute lung injury (ALI) or acute respiratory distress syndrome (ARDS).

[0026] The beneficial effects of the present invention are:

[0027] Aminoguanidine-mediated self-assembly of nanomaterials has the following advantages: 1) It can mediate the self-assembly of nucleic acid nanomaterials at a constant temperature, making the synthesis method simpler. 2) It can be taken up by cells without the assistance of transfection agents, and the cell uptake rate is comparable to the uptake rate of transfection agent-assisted traditional magnesium ion-mediated self-assembly of nucleic acid nanomaterials. 3) Aminoguanidine-mediated self-assembled nucleic acid nanomaterials can stably exist in systems under physiological conditions, greatly increasing the possibility of their clinical application. 4) Aminoguanidine-mediated self-assembled nucleic acid nanomaterials can stably exist in serum for a longer period of time, thereby ensuring that they are not degraded before reaching the target cells and exerting their effects better. 5) This allows them to exert their efficacy more safely and effectively.

[0028] After entering the cells, the DNA tetrahedral nano-delivery material loaded with STING-siRNA will be degraded by DNA enzymes and release aminoguanidine and STING-siRNA at the same time. Aminoguanidine inhibits the cGAS-STING pathway by inhibiting iNOS to reduce the release of mtDNA from damaged mitochondria, and jointly inhibits the transcription and expression of STING with STING-siRNA, reducing the release of inflammatory factors and effectively alleviating lung inflammation during acute lung injury.

[0029] Other advantages, objectives and features of the present invention will be described in the following description to some extent, and to some extent, will be obvious to those skilled in the art based on the following examination and study, or can be taught from the practice of the present invention. The objectives and other advantages of the present invention can be realized and obtained through the following description. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention will be described in detail below in conjunction with the accompanying drawings, wherein:

[0031] Figure 1 Schematic diagram of the self-assembly structure of DNA tetrahedral nano-delivery materials;

[0032] Figure 2 Dynamic light scattering characterization diagram of the self-assembled structure of DNA tetrahedral nano-delivery material;

[0033] Figure 3 The PAGE image of the self-assembly of DNA tetrahedral nano-delivery materials mediated by aminoguanidine gradient annealing;

[0034] Figure 4 It is the PAGE image of DNA tetrahedron self-assembly mediated by gradient annealing of different concentrations of aminoguanidine;

[0035] Figure 5 PAGE images of DNA tetrahedron self-assembly mediated by aminoguanidine at different temperatures;

[0036] Figure 6 PAGE images of DNA tetrahedron self-assembly mediated by aminoguanidine at different pH values;

[0037] Fig. 7A PAGE diagram of serum stability of DNA tetrahedral nano-delivery materials;

[0038] Figure 7B It is the PAGE diagram of aminoguanidine-mediated DNA tetrahedral nano-delivery material at 37°C;

[0039] Fig. 8A Laser confocal microscopy was used to observe the cellular uptake of aminoguanidine-mediated and magnesium-mediated DNA tetrahedral nano-delivery materials.

[0040] Figure 8B Flow cytometry was used to analyze the cellular uptake of aminoguanidine-mediated and magnesium-mediated DNA tetrahedral nanodelivery materials;

[0041] Fig. 9 The expression level and quantitative analysis of STING mRNA in RAW 264.7 cells by DNA tetrahedral nano-delivery materials;

[0042] Fig.10 To analyze the expression level and quantification of inflammatory factors in RAW 264.7 cells by DNA tetrahedral nano-delivery materials;

[0043] Fig.11 The DNA tetrahedral nano-delivery material was well enriched in the lungs of ALI mice;

[0044] Fig.12 DNA tetrahedral nano-delivery materials effectively reduce the levels of inflammatory factors and proteins in the lung BALF of ALI mice;

[0045] Fig.13 DNA tetrahedral nano-delivery materials effectively restore lung function in ALI mice;

[0046] Fig.14 The DNA tetrahedral nanodelivery material effectively reduces the infiltration of inflammatory cells in the lungs of ALI mice. DETAILED DESCRIPTION

[0047] The following describes the embodiments of the present invention by specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that the illustrations provided in the following embodiments only illustrate the basic concept of the present invention in a schematic manner, and the following embodiments and features in the embodiments can be combined with each other without conflict.

[0048] Among them, the drawings are only used for illustrative explanations, and they only represent schematic diagrams rather than actual pictures, and should not be understood as limitations on the present invention. In order to better illustrate the embodiments of the present invention, some parts of the drawings may be omitted, enlarged or reduced, and do not represent the size of actual products. For those skilled in the art, it is understandable that some well-known structures and their descriptions in the drawings may be omitted.

[0049] The same or similar numbers in the drawings of the embodiments of the present invention correspond to the same or similar parts; in the description of the present invention, it should be understood that if the terms "upper", "lower", "left", "right", "front", "rear", etc. indicate the orientation or position relationship, they are based on the orientation or position relationship shown in the drawings, which is only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operate in a specific orientation. Therefore, the terms describing the position relationship in the drawings are only used for illustrative purposes and cannot be understood as limiting the present invention. For ordinary technicians in this field, the specific meanings of the above terms can be understood according to specific circumstances.

[0050] The materials and reagents used in the examples are as follows:

[0051] RAW 264.7 cells were purchased from the American Type Culture Institute;

[0052] Fetal bovine serum and phosphate-buffered saline (PBS) were purchased from Hyclone, USA;

[0053] The STING siRNA sequence was synthesized by Shanghai Genema Co., Ltd.

[0054] TET-1, TET-2, TET-3, and TET-4 sequences were synthesized by Shanghai Bioengineering Co., Ltd.;

[0055] X-tremeGENE siRNA transfection reagent is a product of Roche, Switzerland;

[0056] NaOH, NaCl, KCl, Tris base, acetic acid, EDTA, magnesium acetate, HCl, and phenol were purchased from Shanghai Times Biotechnology Co., Ltd.;

[0057] STING and β-actin primers were synthesized by Shanghai Bioengineering Co., Ltd.;

[0058] The RT-PCR kit was provided by Thermo Company, USA.

[0059] The magnetic stirrer was purchased from Jenway Company, UK.

[0060] Dimethyl sulfoxide and cck8 kit were purchased from Sigma, USA

[0061] Example 1: Self-assembly of DNA tetrahedrons carrying STING siRNA nanoformulations via gradient annealing

[0062] A certain amount of aminoguanidine hydrochloride was weighed and dissolved in deionized water to make the final concentration 500 mM. The dry powder samples of each sequence of STING siRNA (SEQ ID NO: 5), TET-1 (SEQ ID NO: 1), TET-2 (SEQ ID NO: 2), TET-3 (SEQ ID NO: 3), and TET-4 (SEQ ID NO: 4) were diluted with sterilized deionized water, and then the concentration of each tube was measured using Nanndrop. The amount required for the corresponding ratio was calculated according to the concentration. TET-1, TET-2, TET-2, and TET-4 were added to the enzyme-killed centrifuge tube in a ratio of 1:1:1:1, and a certain amount of aminoguanidine hydrochloride aqueous solution was added to make the concentration of aminoguanidine in the system 50mM. The rest was supplemented with water, and finally a 30μL system was prepared. The tetrahedral structure was self-assembled and synthesized under the following conditions: 95℃ for 5min, 65℃ for 30min, 50℃ for 30min, 37℃ for 30min, and then 22℃ for 30min. Then a determined dose of STING siRNA was added into the system and placed again for 30min. A nanoformulation solution for treating lung inflammation with a molar ratio of STING siRNA, TET-1, TET-2, TET-2, and TET-4 of 4:1:1:1:1 was obtained. It is referred to as DNA tetrahedron nano delivery material. The data analysis diagram of the dynamic light scattering particle size measurement of the DNA tetrahedron nano delivery material structure is shown in Figure 2 A small amount of synthesized sample was electrophoresed in 6% non-denaturing PAGE gel, and the image was scanned by a scanner. The electrophoresis image of DNA tetrahedral nano delivery material is shown in Figure 3 , with higher purity.

[0063] Example 2: Self-assembly of DNA tetrahedrons mediated by aminoguanidine at different concentrations

[0064] A certain mass of aminoguanidine hydrochloride was weighed and dissolved in deionized water to make the concentration of the mother solution 500 mM, and then diluted with deionized water to 1 mM, 5 mM, 10 mM, 50 mM, 100 mM, 200 mM and 500 mM respectively. The dry powder samples of each sequence of TET-1, TET-2, TET-2, and TET-4 were diluted with sterilized and enzyme-inactivated deionized water, and then the concentration of each tube was measured using Nanndrop. The amount required for the corresponding proportion was calculated according to the concentration. TET-1, TET-2, TET-2, and TET-4 were added to the enzyme-inactivated centrifuge tubes in a ratio of 1:1:1:1, and a certain amount of aminoguanidine hydrochloride aqueous solution was added so that the concentration of aminoguanidine in the system was 1mM, 5mM, 10mM, 50mM, 100mM, 200mM, and 500mM. The rest was added with deionized water to prepare a 30 μL system. Seven groups of aminoguanidine-mediated DNA tetrahedral structures with different concentrations were prepared for self-assembly synthesis under the following conditions: 95°C for 5 min, 65°C for 30 min, 50°C for 30 min, 37°C for 30 min, and then 22°C for 30 min. A small amount of the synthesized sample was electrophoresed in a 6% non-denaturing PAGE gel in an ice bath (4°C). The image was scanned by a scanner. The DNA tetrahedron electrophoresis image is shown in Figure 4 , with the highest effective concentration at 50 mM aminoguanidine.

[0065] Example 3: Aminoguanidine-mediated self-assembly of DNA tetrahedrons at different temperatures

[0066] The addition method of TET-1, TET-2, TET-2, and TET-4 was the same as above, and a certain amount of aminoguanidine aqueous solution was added to make the concentration of aminoguanidine in the system 50mM, and the rest was added with deionized water to prepare a 30μL system, and 5 groups of triangular prism structures were prepared, and placed at 4°C for 60min, 22°C for 60min, 37°C for 60min, and 45°C for 60min, respectively, and annealed according to the gradient in Example 1, and then a small amount of the 5 groups of samples was electrophoresed in 6% non-denaturing PAGE gel, and the picture was scanned by a scanner. The picture of DNA tetrahedron electrophoresis is shown in FIG. Figure 5 , self-assembled at a constant temperature of 37℃ and 45℃ with high purity.

[0067] Example 4: Self-assembly of DNA tetrahedrons mediated by aminoguanidine at different pH values

[0068] TET-1, TET-2, TET-2, TET-4 were added in the same manner as above, and a certain amount of aminoguanidine aqueous solution was added, and a certain amount of aminoguanidine aqueous solution with different pH values ​​was added, so that the concentration of aminoguanidine in the system was 500mM, and the rest was added with deionized water to prepare a 30μL system, and 5 groups of aminoguanidine aqueous solutions with different pH values ​​were prepared to mediate the self-assembly synthesis of tetrahedral structures under the following conditions: 95°C for 5min, 65°C for 30min, 50°C for 30min, 37°C for 30min, and then 22°C for 30min. Subsequently, a small amount of the five groups of synthesized samples was taken and electrophoresed in a 6% non-denaturing PAGE gel under ice bath (4°C), and the pictures were scanned by a scanner. The DNA tetrahedron electrophoresis pictures are shown in Figure 6 At the above five pH values, aminoguanidine-mediated DNA tetrahedral synthesis has high purity.

[0069] Example 5: Aminoguanidine-mediated DNA tetrahedron self-assembly and stability at 37°C and in serum

[0070] According to the method in Example 1, a certain amount of aminoguanidine-mediated DNA tetrahedron and a corresponding amount of TAE-Mg 2+ To mediate DNA tetrahedron, a small amount of the mixture was added to a system containing 10% FBS (fetal bovine serum) at a ratio of 1:9 and placed in an incubator at 37°C. The experimental groups were set to have time of 0h, 3h, 6h, and 9h. After the time was up, the mixture was taken out and electrophoresed in a 6% non-denaturing PAGE gel. The images were scanned by a scanner, as shown in Figure 7(A). The aminoguanidine-mediated DNA tetrahedron can be stably present in serum for 6h or even 9h, while TAE-Mg 2+ The mediated DNA tetrahedron was decomposed within 3 hours in serum.

[0071] According to the method in Example 1, a certain amount of aminoguanidine-mediated DNA tetrahedron was synthesized, and a small amount was electrophoresed in a 6% non-denaturing PAGE gel in a 37°C water bath. Scanning by a scanner, as shown in Figure 7 (B), shows that aminoguanidine-mediated DNA tetrahedron can exist stably at 37°C.

[0072] Example 6: Cellular response to aminoguanidine-mediated DNA tetrahedron self-assembly and TAE-Mg 2+ Comparison of mediated nucleic acid nanomaterial uptake

[0073] RAW 264.7 cells in the logarithmic growth phase were seeded in a 24-well plate (with a built-in cover glass) and placed in a 37°C, 5% CO 2 After 48 hours of incubation in an incubator, when the cell density reaches 50% to 60%, it can be used for the uptake of nucleic acid nanomaterials. The experimental groups are: aminoguanidine-mediated DNA tetrahedral nanomaterials (150nM), TAE-Mg 2+DNA tetrahedral nanomaterials (150 nM) and blank control group were mixed with culture medium at a ratio of 1:10, and the nanoparticles were added and placed at 37°C and 5% CO 2 Culture in an incubator for 24 hours. Afterwards, discard the culture medium of the 24-well plate, gently rinse with PBS for 3 minutes × 3 times; add 1 ml of 4% paraformaldehyde along the wall of the culture plate and fix at room temperature for 5 minutes; rinse with PBS for 5 minutes × 3 times, discard the PBS liquid; remove the cover glass, use antifade mounting medium (about 10 μl) to seal the slide, and store it in the dark; take pictures under a laser confocal microscope.

[0074] As can be seen from the laser confocal microscopy image 8 (A), at the same time and concentration, the Cy3 carried by the DNA tetrahedral nano-delivery material is distributed in the cells as red fluorescence, which shows that the uptake of the aminoguanidine-mediated nano-material self-assembly is much higher than that of the traditional TAE-Mg 2+ Mediated, i.e., aminoguanidine-mediated self-assembly of DNA tetrahedral nanodelivery materials significantly increased their uptake by RAW 264.7 cells.

[0075] The RAW 264.7 cells in the logarithmic growth phase were counted and prepared into a cell suspension, which was inoculated into a 96-well fluorescent ELISA plate. 100 μL of cell suspension was added to each well, and the cell density was 1×10 4 The experimental groups were blank control, aminoguanidine-mediated DNA tetrahedral nano-delivery material (150 nM), and TAE-Mg 2+ DNA tetrahedral nanomaterials (150 nM) were mediated. Five replicate wells were set for each group, and a zeroing well was set. The cells were placed at 37°C and 5% CO 2 After 24 hours of incubation in an incubator, the corresponding nanomaterials and culture medium mixture were added and placed in an incubator at 37°C and 5% CO 2 After culturing in the incubator for 1, 3, and 6 hours, the culture medium was discarded, each well was washed with 200 μL PBS for 5 min × 3, and then 400 μL PBS was added to each well to wash the cell suspension, which was measured on a flow cytometer with the emission wavelength adjusted to 546 nm and 461 nm. The corresponding data were normalized and the statistical graph was obtained as shown in Figure 8 (B). It can be seen that the uptake of aminoguanidine-mediated DNA tetrahedral nano-delivery material self-assembly is higher than that of traditional TAE-Mg 2+ Mediated.

[0076] Example 7: Effect of aminoguanidine-mediated self-assembled DNA tetrahedral nano-delivery materials on cell STING mRNA expression

[0077] One day before treatment, RAW 264.7 cells were counted and seeded in 6-well plates. The corresponding STING siRNA concentration was 100 nmol / ml. The experimental groups were set as follows: blank control, LPS, TAE-Mg 2+ Mediated DNA tetrahedron, aminoguanidine-mediated tetrahedron, aminoguanidine-mediated DNA tetrahedron material (without single-stranded STING siRNA), TAE-Mg 2+ Mediated DNA tetrahedron nanomaterials (carrying single-stranded STING siRNA) and aminoguanidine-mediated DNA tetrahedron nanodelivery materials (carrying single-stranded STING siRNA). Then placed at 37°C, 5% CO 2 After 24 hours of incubation in the incubator, the cells were rinsed twice with PBS. 1 ml of TRIzol reagent (Invitrogen, USA) was added and RNA was extracted according to the instructions for TRIzol reagent extraction. The RNA concentration and purity were determined using a nucleic acid quantitative analyzer. The A260 / A280 ratio of all RNAs was between 1.8 and 2.0. Reverse transcription PCR (RT-PCR) reagent was then used to detect the STING mRNA in each group, with β-actin as a positive control. The primers were designed as follows:

[0078] STING

[0079] F:CACGCGTCCGCCCAC

[0080] R:TCGAGACTCGGGGACATCTT

[0081] β-actin

[0082] F:TCAGGTCATCACTATCGGCAAT

[0083] R:AAAGAAAGGGTGTAAAACGCA

[0084] RT reaction conditions: 42°C, 60 minutes, 72°C, 5 minutes, 12°C, 10 minutes, and the reaction volume was 20 μl; qPCR reaction conditions were: 94°C, 3 minutes of denaturation, cycling conditions were 94°C, 30 seconds, 54°C, 45 seconds, 72°C, 30 seconds, 40 cycles, 72°C extension for 10 minutes, and the reaction volume was 10 μl.

[0085] The results showed that the STING siRNA carried by DNA tetrahedral nanoparticles could significantly downregulate the expression of STING mRNA in cells, which was significantly lower than that in the LPS treatment group (* represents p<0.05). 2+Mediated by DNA tetrahedral nanomaterials, the expression of STING mRNA decreased relatively more (see Fig. 9 ).

[0086] Example 8: Aminoguanidine-mediated self-assembled DNA tetrahedral nano-delivery material down-regulates the expression of inflammatory factors in macrophages

[0087] One day before treatment, RAW 264.7 cells were counted and seeded in 6-well plates. The corresponding STING siRNA concentration was 100 nmol / ml. The experimental groups were set as follows: blank control, LPS, TAE-Mg 2+ DNA tetrahedron-mediated, aminoguanidine-mediated tetrahedron, aminoguanidine-mediated DNA tetrahedron nanomaterials (without single-stranded STING siRNA), TAE-Mg 2+ Mediated DNA tetrahedron nanomaterials (carrying single-stranded STING siRNA) and aminoguanidine-mediated DNA tetrahedron nanodelivery materials (carrying single-stranded STING siRNA). Then placed at 37°C, 5% CO 2 After 24 hours of incubation in the incubator, the cells were rinsed twice with PBS. 1 ml of TRIzol reagent (Invitrogen, USA) was added and RNA was extracted according to the instructions for TRIzol reagent extraction. The RNA concentration and purity were determined using a nucleic acid quantitative analyzer. The A260 / A280 ratio of all RNAs was between 1.8 and 2.0. Reverse transcription PCR (RT-PCR) reagents were then used to detect the inflammatory factors in each group, with β-actin as a positive control. The primers were designed as follows:

[0088] TNF-α

[0089] F:GGAACACGTCGTGGGATAATG

[0090] R:GGCAGACTTTGGATGCTTCTT

[0091] IL-6

[0092] F:CTCCCAACAGACCTGTCTATAC

[0093] R:CCATTGCACAACTCTTTTCTCA

[0094] IL-1β

[0095] F:TCGCAGCAGCACATCAACAAGAG

[0096] R:AGGTCCACGGGAAAGACACAGG

[0097] RT reaction conditions: 42°C, 60 minutes, 72°C, 5 minutes, 12°C, 10 minutes, and the reaction volume was 20 μl; qPCR reaction conditions were: 94°C, 3 minutes of denaturation, cycling conditions were 94°C, 30 seconds, 54°C, 45 seconds, 72°C, 30 seconds, 40 cycles, 72°C extension for 10 minutes, and the reaction volume was 10 μl.

[0098] The results showed that the STING siRNA carried by DNA tetrahedral nanoparticles could significantly downregulate the expression of inflammatory factors in cells, which was significantly lower than that in the LPS treatment group (* represents p<0.05). 2+ Mediated by DNA tetrahedral nanomaterials, the expression of STING mRNA decreased relatively more (see Fig.10 ).

[0099] Example 9: Aminoguanidine-mediated DNA tetrahedral nano-delivery material is well enriched in the lungs of ALI mice

[0100] TET AG -STING NC was labeled with Cy5, and the mice were anesthetized and 50 μL LPS (5 mg kg-1) was injected into the trachea with an insulin syringe. 2 h later, 50 μL TET was injected into the trachea AG -STING NC, Cy5 concentration was 20 μg / mouse, and the biodistribution and lung deposition were detected by In VivoXtreme imaging system (see Fig.11 ).

[0101] Example 10: Aminoguanidine-mediated DNA tetrahedral nano-delivery material effectively reduces the levels of inflammatory factors and proteins in the BALF of the lungs of ALI mice

[0102] The ALI mouse model was established according to the above method, and the drug was administered through the airway 2 hours later. After 24 hours, pre-cooled PBS was injected into the trachea and the alveolar lavage fluid was collected. The ELISA kit was used to detect the content of inflammatory factors, including TNF-α, IL-6 and IL-1β, and the BCA kit was used to detect the protein content (see Fig.12 ).

[0103] Example 11: Aminoguanidine-mediated DNA tetrahedral nano-delivery material effectively restores lung function in ALI mice

[0104] The ALI mouse model was established as described above, and the drug was administered through the airway 2 h later. After 24 h, the mice were anesthetized and intubated, and the ventilation function was tested using the flexiVent FX system according to the instructions, and analyzed using the flexiWare v7.2 software (see Fig.13 ).

[0105] Example 12: Aminoguanidine-mediated DNA tetrahedral nano-delivery material effectively restores lung function in ALI mice

[0106] The ALI mouse model was established according to the above method, and the drug was administered through the airway 2 hours later. Lung tissue was obtained 24 hours later for H&E staining: the mouse lung tissue was fixed with 4% formalin, embedded in paraffin, cut into 4 μm sections, and H&E stained according to standard procedures. The histopathological characteristics were observed under an optical microscope (see Fig.14 ).

[0107] Therefore, the aminoguanidine-mediated DNA tetrahedron nano-delivery material self-assembly method of the present invention can be used for the self-assembly of a variety of nucleic acid nanomaterials, including not only the DNA tetrahedrons in the embodiments, but also DNA nanotubes, DNA triangular prisms, etc., and can be widely used in the self-assembly of nucleic acid nanomaterials.

[0108] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solution, which should be included in the scope of the claims of the present invention.

Claims

1. DNA tetrahedral nano delivery material, characterized in that: The DNA tetrahedron is formed by four DNA single strands TET-1, TET-2, TET-3, and TET-4 base complementary pairing, the 5' ends of the four DNA single strands are complementary paired with single-stranded siRNA, and the four DNA single strands and siRNA are self-assembled in an aminoguanidine aqueous solution to form the DNA tetrahedron nano delivery material.

2. The DNA tetrahedral nano-delivery material according to claim 1, characterized in that: The nucleotide sequence of TET-1 is shown in SEQ ID NO: 1, the nucleotide sequence of TET-2 is shown in SEQ ID NO: 2, the nucleotide sequence of TET-3 is shown in SEQ ID NO: 3, and the nucleotide sequence of TET-4 is shown in SEQ ID NO:

4. The siRNA is STING siRNA, and the nucleotide sequence is shown in SEQ ID NO:

5.

3. The DNA tetrahedral nano-delivery material according to claim 1, characterized in that: The molar ratio of the siRNA, TET-1, TET-2, TET-3, and TET-4 is 4:1:1:1:

1.

4. The method for preparing the DNA tetrahedral nano-delivery material according to any one of claims 1 to 3, characterized in that: The steps are as follows: S1: preparing TET-1, TET-2, TET-3, TET-4 aqueous solutions; S2: TET-1, TET-2, TET-3, and TET-4 aqueous solutions are taken in an aminoguanidine aqueous solution at a molar concentration ratio of 1:1:1:1 and complementary paired, and DNA tetrahedrons are synthesized under a gradient annealing or / and constant temperature annealing program to obtain a DNA tetrahedron solution. S3: adding the siRNA solution to the DNA tetrahedron solution in step S2, and incubating them at 37° C. for 30 minutes to obtain the DNA tetrahedron nanomaterial solution.

5. The preparation method according to claim 4, characterized in that: In step S2, the gradient annealing program is 95°C for 5 min, 65°C for 30 min, 50°C for 30 min, 37°C for 30 min, and then 22°C for 30 min.

6. The preparation method according to claim 4, characterized in that: In step S2, the constant temperature annealing program is 37° C. or 45° C., and the mixture is placed at the constant temperature for 30 to 90 minutes. The DNA solution is mixed and then placed at the same constant temperature for 30 to 90 minutes.

7. The preparation method according to claim 4, characterized in that: In step S2, the pH value of the aminoguanidine aqueous solution is 5.0-9.

0.

8. The preparation method according to claim 4, characterized in that: In step S2, the concentration of the aminoguanidine aqueous solution is 50 mM-500 mM.

9. Use of the DNA tetrahedral nano delivery material according to any one of claims 1 to 3 in the preparation of pharmaceutical preparations.

10. The use according to claim 9, characterized in that: The invention discloses an application of the DNA tetrahedral nano delivery material in preparing a nano drug preparation for treating acute lung injury (ALI) or acute respiratory distress syndrome (ARDS).

Images