Application of recombinant saccharomyces cerevisiae in removing antibiotics and relieving intestinal flora disorder

Abstract

The invention discloses application of recombinant saccharomyces cerevisiae to preparation of a medicine for removing antibiotics and / or preparation of a medicine for relieving intestinal flora disorder. The invention provides genetic engineering yeast probiotics capable of eliminating antibiotics and relieving intestinal flora disorder and a construction method thereof on the basis of the phenomenon that antibiotic hydrolase mediates hydrolysis inactivation of antibacterial drugs. Experiments clearly verify that the constructed recombinant saccharomyces cerevisiae can well remove antibiotics and can relieve intestinal flora disorder.

Description

Technical Field

[0001] The invention relates to application of recombinant saccharomyces cerevisiae in removing antibiotics and alleviating intestinal flora disorder, and belongs to the technical field of medicine. Background Art

[0002] Since the discovery of penicillin by Fleming, a famous British bacteriologist and physician in the 1930s, the discovery of antibiotics has not only saved countless lives, but also provided an effective means for the prevention and control of bacterial diseases in livestock and poultry farming, and ensured the stable supply of animal-derived food. Common broad-spectrum antibiotics, such as β-lactams, aminoglycosides, fluoroquinolones, macrolides, etc., are commonly used in the clinic for the treatment of respiratory tract, urinary tract, gastrointestinal tract infections, typhoid fever, paratyphoid fever, meningitis, endocarditis, sepsis and other diseases due to their broad antibacterial spectrum, strong antibacterial activity and low toxicity. According to statistics, β-lactam antibiotics are the most widely used class of antibiotics in human medicine. β-lactam antibiotics and tetracycline antibiotics are the two most widely used antibacterial drugs in livestock and poultry farming.

[0003] However, when using antibiotics to treat bacterial infectious diseases, antibiotics may destroy the normal intestinal flora after being taken orally or absorbed into the intestines, causing intestinal flora disorders, allowing conditional pathogens to proliferate, increasing the risk of enteric infection, and the occurrence of diseases such as antibiotic-associated diarrhea and antibiotic-associated colitis. Summary of the invention

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide the application of recombinant Saccharomyces cerevisiae in removing antibiotics and alleviating intestinal flora disorders.

[0005] The technical problem that the present invention needs to solve is to provide a method for constructing recombinant Saccharomyces cerevisiae.

[0006] The technical problem that the present invention needs to solve is to provide a recombinant Saccharomyces cerevisiae ESBcb constructed by the construction method.

[0007] The final technical problem to be solved by the present invention is to provide the application of recombinant cerevisiae ESBcb in removing antibiotics and alleviating intestinal flora disorders.

[0008] Technical solution: In order to solve the above technical problems, the present invention provides the use of recombinant cerevisiae in preparing drugs for removing antibiotics and / or preparing drugs for alleviating intestinal flora disorders, wherein the recombinant cerevisiae includes a recombinant vector containing ACT-7, CMY-2, CTX-M-27, CTX-M-3, DHA-1, IMP-4, KPC-2, LPA-2, MAL-1, OXA-1, OXA-10, SHV-12 or TEM-116 genes.

[0009] The recombinant vector is obtained by introducing ACT-7, CMY-2, CTX-M-27, CTX-M-3, DHA-1, IMP-4, KPC-2, LPA-2, MAL-1, OXA-1, OXA-10, SHV-12 or TEM-116 gene into the p426GPD plasmid.

[0010] The present invention also includes a method for constructing a recombinant Saccharomyces cerevisiae, comprising the following steps:

[0011] (1) Using p426GPD-TEM-116 as a template, PCR amplified the A product containing the promoter TEM-116;

[0012] (2) Using p426GPD-TEM-116 as a template, PCR amplified the B product uracil auxotrophy screening tag;

[0013] (3) Using the W303-1α genome as a template, PCR was performed to amplify the upstream homology arm of the C product and the downstream homology arm of the D product;

[0014] (4) Fusion PCR is performed on PCR amplification product A, PCR amplification product B, PCR amplification product C, and PCR amplification product D to obtain gene fragments, and the recovered products are transferred to brewer's yeast.

[0015] The primers for PCR amplification in step (1) include primers

[0016] F1: TGGCTGTGGTCATTATCAATACTCGCCATTTC;

[0017] F2:TATAAGTAAGCAAATTAAAGCCTTCGAG, the primers for PCR amplification in step (2) include F3:TTTAATTTGCTTACTTATAATACAGTTTTTTAG;

[0018] F4: CATTATAAAAATTCAATTCATCATTTTTTTTTTA; the primers for PCR amplification in step (3) include F5: GCGGATTACTACCGTTGC;

[0019] F6:ATTGATAATGACCACAGCCACATTAACCT and

[0020] F7:ATGAATTGAATTTTTATAATGACGAAAAAAAAA;

[0021] F8:TGGTTAGATTAGATATGGTTTCT; the primers for PCR amplification in step (4) include

[0022] F5: GCGGATTACTACCGTTGC; F8: TGGTTAGATTAGATATGGTTTCT.

[0023] The gene fragment sequence obtained by fusion PCR is shown in SEQ ID NO.1.

[0024] The present invention also includes the recombinant Saccharomyces cerevisiae ESBcb constructed by the construction method.

[0025] The present invention also includes the use of the recombinant Saccharomyces cerevisiae ESBcb in the preparation of drugs for removing antibiotics and / or drugs for alleviating intestinal flora disorders.

[0026] Among other things, the application also includes removing antibiotics from the environment.

[0027] Wherein, the antibiotics include one or both of penicillin G and ampicillin.

[0028] Wherein, the drug includes the recombinant Saccharomyces cerevisiae ESBcb or its fermentation liquid or secretion.

[0029] Beneficial effects: Compared with the prior art, the present invention has the following outstanding and significant advantages: Based on the phenomenon of antibiotic hydrolase-mediated hydrolysis and inactivation of antibacterial drugs, the present invention provides a genetically engineered yeast probiotic that can remove antibiotics and alleviate intestinal flora disorders and a construction method thereof. The present invention has clearly verified through experiments that the constructed recombinant brewer's yeast can remove antibiotics well and alleviate intestinal flora disorders. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 a is a schematic diagram of the plasmid of the β-lactamase yeast expression system, and the red part is the insertion position of the β-lactamase gene. Figure 1 b is the result of plasmid-mediated recombinant brewing PCR verification;

[0031] Figure 2 a is the result of penicillin clearance in vitro by different recombinant brewing ESBcb, Figure 2 b shows the results of different recombinant brewing ESBcb clearing ampicillin in vitro;

[0032] Figure 3 The concentration of ampicillin in the EBScb group decreased over time and fell below the detection limit after 4 hours;

[0033] There was no significant change in the concentration of ampicillin in the W303-1A and SD / -Ura control groups, indicating that EBScb can effectively remove ampicillin from the culture supernatant;

[0034] Figure 4 a is a schematic diagram of the experimental operation. Figure 4 b is the curve of the change of ampicillin concentration in the cecum over time. Figure 4 c is the curve of the change of ampicillin concentration in plasma over time, Figure 4 d is the curve of the change of ampicillin drug concentration in the liver over time;

[0035] Figure 5 a is a schematic diagram of the experimental operation. Figure 5 b is the principal component analysis of intestinal microbial diversity of mice in the EBScb and W303-1A groups at different sampling times. Figure 5 c is the alpha diversity index of intestinal microbial diversity of mice in the EBScb and W303-1A groups at different sampling times, Figure 5 d is the weight changes of mice in the EBScb and W303-1A groups at different sampling times. Figure 5 e is the HE-stained sections of mice in the EBScb and W303-1A groups on the 20th day of the experiment. Figure 5 f is the height of intestinal villi of healthy mice, EBScb and W303-1A group mice on the 20th day of the experiment; Figure 5 g is the jejunum length-to-mass ratio of healthy mice, EBScb and W303-1A group mice on the 20th day of the experiment. DETAILED DESCRIPTION

[0036] The technical scheme of the present invention is further described below in conjunction with the accompanying drawings. It should be pointed out that for those of ordinary skill in the art, without departing from the principle of the present invention, several modifications and improvements can also be made, which should also be considered to belong to the protection scope of the present invention. The experimental methods in the following embodiments are conventional methods unless otherwise specified. The experimental materials used in the following embodiments are purchased from conventional biochemical reagent stores unless otherwise specified. The quantitative experiments in the following embodiments are all repeated three times, and the results are averaged.

[0037] The pGPD426 plasmid was purchased from the American Type Culture Collection (ATCC 87361). The purchasing website is: https: / / www.atcc.org / products / 87361.

[0038] ACT-7, CMY-2, CTX-M-27, CTX-M-3, DHA-1, IMP-4, KPC-2, LPA-2, MAL-1, OXA-1, OXA-10, SHV-12, and TEM-116 gene fragments (sequences corresponding to NCBI accession numbers) and the corresponding primer sequences ( Table 1 ) were synthesized by Suzhou GeneWeiZhi Biotechnology Co., Ltd.

[0039] Table 1

[0040]

[0041]

[0042] Saccharomyces cerevisiae W303-1A was purchased from American Type Culture Collection (ATCC).

[0043] 5-6 week old ICR female mice were purchased from the Experimental Animal Center of Yangzhou University.

[0044] Example 1 Construction of plasmid-mediated recombinant Saccharomyces cerevisiae

[0045] (1) Linearization of the Saccharomyces cerevisiae expression vector p426GPD was performed using EcoRI endonuclease (NEB, catalog number: R0101S). The specific steps are as follows: Take 1 μg of p426GPD plasmid and add 5 μL NEBuffer TM r2.1 and 1 μL EcoRI endonuclease, ddH 2 Make up to 50 μL of 3% O, incubate at 37°C for 1 h, and incubate at 65°C for 20 min to inactivate the enzyme.

[0046] (2) The amplification method of β-lactamase gene was as follows: 12.5 μL 2× high-fidelity enzyme (TOYOBO, catalog number: KOD-211), 1 μL each of upstream and downstream primers, 100 ng of target gene fragment, ddH 2 O to make up to 25 μL. The sequences of upstream and downstream primers and target gene fragments are shown in Table 1. The PCR program is: 95℃3min; 95℃20s, 53℃20s, 72℃30s, 30 cycles; 72℃5min. After 1% agarose gel electrophoresis confirmed that the band size was correct, the kit was used to recover the PCR product (OMEGA, catalog number: D6492), and the PCR products of the gene fragments of ACT-7, CMY-2, CTX-M-27, CTX-M-3, DHA-1, IMP-4, KPC-2, LPA-2, MAL-1, OXA-1, OXA-10, SHV-12 and TEM-116 with restriction sites and homology arms were obtained.

[0047] (3) Use a seamless cloning kit (Novozymes, catalog number: C112) to connect the digested vector and the PCR purified product, respectively: 120 ng (6 μL) of the linearized vector prepared in step (1), 50 ng (1 μL) of the PCR product in step (2), 2 μL of buffer, and 1 μL of Exnase II, and incubate at 37°C for 30 min to obtain the ligation product.

[0048] (4) Add the ligation products to the DH5α competent medium (Tolo Biotechnology, catalog number: CC96102), ice bath for 25 min, heat shock at 42°C for 60 s, ice bath for 3 min, add 900 μL SOB broth, resuscitate at 37°C, 200 rpm for 1 h, and spread on LB agar plates containing 100 μg / mL ampicillin. After overnight culture at 37°C, single clones were selected for sequencing verification. The single clones with correct sequencing were expanded and cultured to extract plasmids (OMEGA, catalog number: D6943) and stored for later use.

[0049] The experimental results are shown in Figure 1 . Figure 1 a is a schematic diagram of the plasmid of the β-lactamase yeast expression system, and the red part is the insertion position of the β-lactamase gene. Figure 1 b is the result of plasmid-mediated recombinant brewing PCR verification. From left to right are p426GPD (empty vector), p426GPD-ACT-7, p426GPD-CMY-2, p426GPD-CTX-M-27, p426GPD-CTX-M-3, p426GPD-DHA-1, p426GPD-IMP-4, p426GPD-KPC-2, p426GPD-LPA-2, p426GPD-MAL-1, p426GPD-OXA-1, p426GPD-OXA-10, p426GPD-SHV-12, p426GPD-TEM-116 and pure water (negative control), indicating that the above vectors were successfully constructed.

[0050] Example 2 In vitro clearance of penicillin G and ampicillin

[0051] The above plasmids were transferred to Saccharomyces cerevisiae W303-1A by the lithium acetate method. The specific operation was as follows: 100 ng of plasmid, 5 μL of pre-denatured Carrier DNA (Beijing Coolbo Technology Co., Ltd., Catalog No.: YT0003), 50 μL of yeast competent cells (Beijing Coolbo Technology Co., Ltd., Catalog No.: W303-1A), and 500 μL of PEG / LiAC (Beijing Coolbo Technology Co., Ltd., Catalog No.: YT0009) were added to a 1.5 mL sterile centrifuge tube and gently mixed. The mixture was incubated in a 30°C water bath for 30 min, heat-shocked in a 42°C water bath for 15 min, centrifuged at 1000 rpm for 5 min, the supernatant was discarded, and the mixture was resuspended with 1 mL of YPD Plus (Beijing Coolbo Technology Co., Ltd., Catalog No.: YT0004), shaken and cultured at 30°C and 200 rpm for 1.5 h, centrifuged at 1000 rpm for 5 min, the supernatant was discarded, and 0.2 mL of normal saline was added for resuspending. The mixture was spread on a uracil-deficient culture medium and cultured at 30°C for 3 days.

[0052] The cells growing on the uracil-deficient plates were picked and transferred to monoclonal expansion culture until OD620≈1. Penicillin and ampicillin were added respectively to make the final concentration of 256 μg / mL. After culturing at 37°C and 200 rpm for 3 h, the culture supernatant was filtered with a 0.22 μm sterile filter, and the concentrations of penicillin G and ampicillin in the supernatant were detected using ELISA kits (Jianglai Biotechnology, JL45924, JL18787).

[0053] The experimental results are shown in Figure 2 . Figure 2 a is the result of penicillin clearance in vitro by different recombinant brewers. Figure 2 b is the result of different recombinant wines clearing ampicillin in vitro. Different recombinant wines can significantly reduce the in vitro concentrations of penicillin and ampicillin, among which CTX-M, CTX-M, KPC, OXA and TEM116 have strong in vitro clearance effects, but considering the gene length and hydrolase safety (narrow spectrum), TEM116 was selected for further testing.

[0054] Example 3 Construction of recombinant Saccharomyces cerevisiae EBScb

[0055] (1) Fusion PCR

[0056] PCR product A (TEM-116 containing promoter): 100 ng (1 μL) p426GPD-TEM-116 as template, 12.5 μL high-fidelity enzyme (TOYOBO, catalog number: KOD-211), 1 μL each of primers (F1: TGGCTGTGGTCATTATCAATACTCGCCATTTC; F2: TATAAGTAAGCAAATTAAAGCCTTCGAG), ddH 2 Make up to 25 μL with HO.

[0057] PCR product B (uracil auxotrophy screening tag): 100 ng (1 μL) p426GPD-TEM-116 as template, 12.5 μL high-fidelity enzyme (TOYOBO, Cat. No.: KOD-211), 1 μL each of primers (F3: TTTAATTTGCTTACTTATAATACAGTTTTTTAG; F4: CATTATAAAAATTCAATTCATCATTTTTTTTTTA), ddH 2 Make up to 25 μL with HO.

[0058] PCR product C (with homology arms): 200 ng (2 μL) W303-1A genome as template, 12.5 μL high-fidelity enzyme (TOYOBO, KOD-211), 1 μL each of primers (F5: GCGGATTACTACCGTTGC; F6: ATTGATAATGACCACAGCCACATTAACCT), ddH 2 Make up to 25 μL with HO.

[0059] PCR product D (downstream homology arm): 200 ng (2 μL) W303-1A genome as template, 12.5 μL high-fidelity enzyme (TOYOBO, KOD-211), 1 μL each of primers F7: ATGAATTGAATTTTTATAATGACGAAAAAAAA; F8: TGGTTAGATTAGATATGGTTTCT), ddH 2 Make up to 25 μL with HO.

[0060] The PCR program was: 95°C for 3 min; 95°C for 20 s, 53°C for 20 s, 72°C for 30 s, 30 cycles; 72°C for 5 min. After confirming the correct band size by 1% agarose gel electrophoresis, the gel was cut and the PCR product was recovered using a gel recovery kit (OMEGA, catalog number: D2500) and stored for later use.

[0061] Take 8.6 ng of PCR product A, 15 ng of PCR product B, 31.2 ng of PCR product C, 31.2 ng of PCR product D, 1 μL of each primer (F5: GCGGATTACTACCGTTGC; F8: TGGTTAGATTAGATATGGTTTCT), 12.5 μL of high-fidelity enzyme (TOYOBO, product number KOD-211), ddH 2O to 25 μL. The PCR program was: 95°C for 3 min; 95°C for 20 s, 53°C for 20 s, 72°C for 80 s, 30 cycles; 72°C for 5 min. After the band size was confirmed to be correct by 1% agarose gel electrophoresis, the fusion PCR product was recovered by the kit (OMEGA, D6492).

[0062] Among them, the gene fragment sequence obtained by fusion PCR is:

[0063]

[0064]

[0065]

[0066] The recovered product was transformed into Saccharomyces cerevisiae W303-1A by lithium acetate method, and the positive clone integrated into W303-1A was screened by uracil-deficient plates, which was Saccharomyces cerevisiae ESBcb.

[0067] Saccharomyces cerevisiae W303-1A and Saccharomyces cerevisiae EBScb were selected and cultured in YPD broth until OD620≈1, SD / -Ura was used as negative control, and ampicillin was added to a final concentration of 20 mg / mL. The cells were cultured at 37°C and 200 rpm, and the concentration of ampicillin in the supernatant was detected using an ELISA kit (Jianglai Biotechnology, JL45924) at 15 min, 30 min, 1 h, 1.5 h, 2 h, 4 h, and 8 h.

[0068] The experimental results are shown in Figure 3 The concentration of ampicillin in the EBScb group decreased over time and fell below the detection limit (0.5 μg / mL) after 4 h; the concentration of ampicillin in the W303-1A and SD / -Ura control groups did not change significantly, indicating that EBScb can effectively remove ampicillin from the culture supernatant.

[0069] Example 4EBScb can significantly reduce the concentration of ampicillin in the intestine

[0070] 1. A total of 40 5-6 week old ICR female mice were selected for the experiment, with 20 mice in each experimental group and control group. The mice were separated into cages and adapted to the environment for 5 days. They were weighed before the experiment and injected with ampicillin intraperitoneally at a dose of 200 mg / kg body weight. 60 minutes and 15 minutes before the intraperitoneal injection, 200 μL of 6*10 9cells / mL recombinant Saccharomyces cerevisiae EBScb or control group Saccharomyces cerevisiae W303-1A suspension was injected into the digestive tract of mice; carbon dioxide anesthesia was used and blood was collected by removing the eyeballs 15min, 30min, 45min, 60min, 90min, and 120min after injection, and liver and intestinal content samples were collected at the same time.

[0071] 2. Sample Pretreatment

[0072] (1) Pretreatment of plasma samples:

[0073] a. Centrifuge freshly collected mouse blood at 4°C, 3000 rpm for 10 min, separate the layers, and take the upper yellowish liquid as the plasma component;

[0074] b. Take 100 μL of plasma sample, add 200 μL of acetonitrile, vortex mix for 1 min, and centrifuge at 12,000 rpm for 5 min;

[0075] c. Take the supernatant to a new 1.5 mL finger tube, add 2.3 μL of 10% phosphoric acid aqueous solution (v / v) and 560 μL of dichloromethane, vortex for 1 min, and centrifuge at 4000 rpm for 5 min;

[0076] d. Take 66 μL of the supernatant, add 2 μL of 2% KOH aqueous solution (w / v), and test.

[0077] (2) Pretreatment of liver samples:

[0078] a. Take a mouse liver sample, weigh it, and add 0.01M NaH 2 PO 4 Solution, homogenization at 60 Hz for 900 s;

[0079] b. Add 4 mL of acetonitrile to the liver homogenate, oscillate and mix, perform ultrasonic extraction for 15 min, centrifuge at 4°C and 12,000 rpm for 4 min, transfer the supernatant to another collection tube, repeat the above steps, and combine the two extracts;

[0080] c. Add 2.5 mL of 75% acetonitrile saturated n-hexane solution to the collection tube (prepare 75% acetonitrile solution first: add 50 mL of ultrapure water to 150 mL of acetonitrile, invert and mix; add 200 mL of n-hexane to the separatory funnel, slowly add 75% acetonitrile solution, invert several times, and let stand at room temperature for 10 minutes; the upper layer is the 75% acetonitrile saturated n-hexane solution), shake and mix, let stand to separate, remove the upper solution, and repeat once;

[0081] d. Add 7.5 mL of ultrapure water-saturated dichloromethane solution to the collection tube, shake and mix, centrifuge at 12,000 rpm for 5 min, and collect the supernatant into a new centrifuge tube;

[0082] e. The collected supernatant was concentrated to dryness with nitrogen, 1 mL of mobile phase was added, ultrasonicated for 10 min, centrifuged at 4°C and 12,000 rpm for 1 min, the supernatant was collected, filtered using a 0.22 μm filter membrane, and then tested.

[0083] (3) Pretreatment of cecal contents samples:

[0084] a. Take the contents of mouse cecum and add 1 mL 0.01 M NaH 2 PO 4 Solution, homogenization at 60 Hz for 600 s;

[0085] b. Add 1.5 mL of acetonitrile to the homogenate, shake and mix, perform ultrasonic extraction for 15 min, centrifuge at 4°C and 12,000 rpm for 4 min, transfer the supernatant to another collection tube, repeat the above steps, and combine the two extracts;

[0086] c. Add 1 mL of 75% acetonitrile-saturated n-hexane to the extract, shake and mix, let stand to separate the layers, remove the upper layer, and repeat once;

[0087] d. Add 3 mL of dichloromethane solution saturated with ultrapure water (add 250 mL of ultrapure water to the separatory funnel, then slowly add 200 mL of dichloromethane and mix thoroughly by inversion, let stand at room temperature for 10 min, and the lower layer is dichloromethane saturated with ultrapure water), shake and mix thoroughly, centrifuge at 12,000 rpm for 5 min, and transfer the supernatant to a new centrifuge tube;

[0088] e. The collected supernatant was concentrated to dryness using nitrogen blowing, 0.2 mL of mobile phase was added, ultrasonicated for 10 min, centrifuged at 4°C and 12,000 rpm for 1 min, the supernatant was taken, filtered using a 0.22 μm filter membrane, and then tested.

[0089] 3. High performance liquid chromatography HPLC / detection

[0090] (1) Instrument: Agilent HPLC

[0091] (2) Mobile phase: phase A: acetonitrile, phase B: 0.05 M potassium dihydrogen phosphate, volume ratio 8:92;

[0092] (3) Detection wavelength: 210nm;

[0093] (4) Injection volume: 20 μL; column temperature: 35°C; flow rate: 1 mL / min.

[0094] The experimental results are shown in Figure 4 . Figure 4 a is a schematic diagram of the experimental operation. Figure 4 b is the curve of the change of ampicillin concentration in the cecum over time. Figure 4c is the curve of the change of ampicillin concentration in plasma over time, Figure 4 d is the curve of the change of ampicillin concentration in the liver over time. The results showed that after mice were gavaged with recombinant Saccharomyces cerevisiae EBScb, the drug concentration in the intestinal contents was significantly lower than that in the control group 15min, 30min, 45min, 60min and 120min after intraperitoneal injection of the same ampicillin dose, but there was no difference in the concentration in plasma and liver, indicating that recombinant Saccharomyces cerevisiae EBScb can specifically reduce the content of ampicillin in the intestine without affecting the distribution of intraperitoneal injected drugs in the blood and tissues.

[0095] Example 5 Recombinant Saccharomyces cerevisiae EBScb can significantly reduce the concentration of ampicillin in the intestine

[0096] Mice and experimental environment: Mice were obtained from the Comparative Medicine Center of Yangzhou University. The mice used in the intestinal microbial diversity analysis study were all SPF-grade ICR female mice, 5-6 weeks old. Mouse breeding, animal experiments, and sample collection were all carried out in the barrier facility of the Comparative Medicine Center of Yangzhou University. After the experiment, the mice were anesthetized with Shutai and then killed by cervical dislocation, and the bodies were harmlessly disposed of at the Harmless Treatment Center of Yangzhou University.

[0097] After the mice were adapted to the environment for 3 days, they were weighed and injected intraperitoneally with ampicillin at a dose of 200 mg / kg on Day 1-Day 5. At the same time, 200 μL of 6*10 9cells / mL of recombinant Saccharomyces cerevisiae EBScb or Saccharomyces cerevisiae W303-1A; weighed every day from Day1 to Day20; fecal samples were collected on Day0, Day1, Day3, Day5, Day7, Day10, and Day13. The samples were collected at 11 o'clock on the morning of each dosing day or at the same time on the sampling day. After the samples were collected, they were immediately placed in liquid nitrogen for quick freezing and stored at -80°C before being sent for testing. They were sent to Shanghai Meiji Biopharmaceutical Technology Co., Ltd. in a dry ice environment for 16SrRNA diversity sequencing. After sampling on Day20, the mice were killed by carbon dioxide anesthesia, and the colon tissue was fixed in 4% (v / v) formaldehyde aqueous solution. The overnight fixed tissues were dehydrated in 70%, 80%, 90%, 95% and 100% anhydrous ethanol in turn and embedded in paraffin. The paraffin blocks were appropriately trimmed and sliced. According to the user manual, the tissue sections were stained with an H&E staining kit (Sangon Biotech), and the sections were observed and photographed using a BX61 optical microscope (Olympus, Tokyo, Japan) equipped with a DP70 electronic camera (Olympus, Japan). The length of intestinal villi and mucosal thickness were analyzed using OLYMPUS cellSens Dimension software. At the same time, the jejunal tissue was taken, weighed using a precision balance, and its length was accurately measured using a vernier caliper, and its mass-to-length ratio was calculated.

[0098] The experimental results are shown in Figure 5 . Figure 5 a is a schematic diagram of the experimental operation. Figure 5 b is the principal component analysis of intestinal microbial diversity of mice in the EBScb and W303-1A groups at different sampling times. Figure 5 c is the alpha diversity index of intestinal microbial diversity of mice in the EBScb and W303-1A groups at different sampling times, Figure 5 d is the weight changes of mice in the EBScb and W303-1A groups at different sampling times. Figure 5 e is the HE-stained sections of mice in the EBScb and W303-1A groups on the 20th day of the experiment. Figure 5 f is the height of intestinal villi of mice in the EBScb and W303-1A groups on the 20th day of the healthy mouse experiment; Figure 5g is the jejunal length-to-mass ratio of mice in the EBScb and W303-1A groups on the 20th day of the healthy mouse experiment. The results showed that recombinant Saccharomyces cerevisiae EBScb can maintain the intestinal microbial diversity of mice after the administration of ampicillin. The body weight of mice in the EBScb group was significantly higher than that of the Saccharomyces cerevisiae W303-1A control group from the third day of the experiment. In the HE-stained sections, the hollow arrows indicate inflammatory cell infiltration in the intestinal mucosal tissue and damaged mucosal structures, such as necrosis and incomplete microvilli structure. The intestinal villus height and jejunal mass-to-length ratio of mice in the recombinant Saccharomyces cerevisiae EBScb group were significantly higher than those in the Saccharomyces cerevisiae W303-1A control group, and there was no significant difference compared with healthy mice. The above results all indicate that recombinant Saccharomyces cerevisiae EBScb can protect the intestinal microbial diversity of mice and maintain normal intestinal tissue structure after the administration of high-concentration ampicillin.

Claims

1. Use of recombinant Saccharomyces cerevisiae in the preparation of drugs for removing antibiotics and / or drugs for alleviating intestinal flora disorders, characterized in that: The recombinant Saccharomyces cerevisiae includes a recombinant vector containing ACT-7, CMY-2, CTX-M-27, CTX-M-3, DHA-1, IMP-4, KPC-2, LPA-2, MAL-1, OXA-1, OXA-10, SHV-12 or TEM-116 genes.

2. The use according to claim 1, characterized in that: The recombinant vector is obtained by introducing ACT-7, CMY-2, CTX-M-27, CTX-M-3, DHA-1, IMP-4, KPC-2, LPA-2, MAL-1, OXA-1, OXA-10, SHV-12 or TEM-116 gene into p426GPD plasmid.

3. A method for constructing a recombinant Saccharomyces cerevisiae, characterized in that: The following steps are involved: (1) Using p426GPD-TEM-116 as a template, PCR amplified product A containing the promoter TEM-116; (2) Using p426GPD-TEM-116 as a template, PCR amplified the B product uracil auxotrophy screening tag; (3) Using the W303-1α genome as a template, PCR was performed to amplify the upstream homology arm of the C product and the downstream homology arm of the D product; (4) Fusion PCR is performed on product A, product B, product C, and product D to obtain gene fragments, and the recovered products are transferred into Saccharomyces cerevisiae; The primers for PCR amplification in step (1) include primers F1: TGGCTGTGGTCATTATCAATACTCGCCATTTC; F2: TATAAGTAAGCAAATTAAAGCCTTCGAG, The primers for PCR amplification in step (2) include primers F3: TTTAATTTGCTTACTTATAATACAGTTTTTTAG; F4: CATTATAAAAATTCAATTCATCATTTTTTTTTTA; The primers for PCR amplification in step (3) include primer F5: GCGGATTACTACCGTTGC; F6: ATTGATAATGACCACAGCCACATTAACCT and primer F7: ATGAATTGAATTTTTATAATGACGAAAAAAAA; F8: TGGTTAGATTAGATATGGTTTCT; The primers for PCR amplification in step (4) include primers F5: GCGGATTACTACCGTTGC; F8: TGGTTAGATTAGATATGGTTTCT.

4. The method for constructing recombinant Saccharomyces cerevisiae according to claim 3, characterized in that: The gene fragment sequence obtained by the fusion PCR is shown as SEQ ID NO.

1.

5. The recombinant Saccharomyces cerevisiae ESBcb constructed by the construction method according to claim 3 or 4.

6. Use of the recombinant Saccharomyces cerevisiae ESBcb according to claim 5 in the preparation of drugs for removing antibiotics and / or drugs for alleviating intestinal flora disorders.

7. The use according to claim 1 or 2 or 3 or 5, characterized in that: The uses include removing antibiotics and also removing antibiotics from the environment.

8. The use according to claim 1 or 2 or 3 or 5, characterized in that: The antibiotics include one or both of penicillin G and ampicillin.

9. The use according to claim 6, characterized in that The medicine comprises the recombinant Saccharomyces cerevisiae ESBcb or its fermentation liquid or secretion.

Images