Preparation method of spine-shaped mesoporous silica nanoparticles and application of spine-shaped mesoporous silica nanoparticles in plant virus resistance

Abstract

The invention relates to a preparation method of spine-shaped mesoporous silica nanoparticles and an application of the spine-shaped mesoporous silica nanoparticles in antivirus of plants. The mesoporous silica nanoparticles are used as a silica nano pesticide. The synthesis and preparation method is simple, the reaction condition is mild, the cost is low, and the mesoporous silica nanoparticles with good biological safety are obtained. The mesoporous silica nanoparticles can enhance the resistance of rice to southern rice black-streaked dwarf virus, which is shown as follows: after virus inoculation, the transcription level of a virus shell gene CP is obviously lower than that of rice sprayed with water after the mesoporous silica nanoparticles are sprayed; and the content of virus coat protein CP is obviously lower than that of rice sprayed with water. According to the invention, the effect of the mesoporous silica nanoparticles in regulating and controlling the plant virus resistance is confirmed for the first time, and a theoretical basis is provided for the application of nano materials in green prevention and control of plant virus diseases.

Description

Technical Field

[0001] The invention relates to the technical field of agricultural disease-resistant drugs, in particular to a method for preparing spike-shaped mesoporous silica nanoparticles and application thereof in plant anti-virus. Background Art

[0002] With the growth of population, the demand for food is increasing. However, rice, as the main food for more than half of the world's population, is seriously infected by diseases, which seriously affects the yield and quality of rice, thus posing a threat to global food security. Preventing rice from being infected by diseases is of great significance to global food security. Southern rice black-streaked dwarf virus (SRBSDV) is an important viral disease that has seriously endangered rice production in my country and neighboring countries in the past decade. At present, the disease still relies on pesticides for prevention and control, so it is particularly important to strengthen the research and development of new agents.

[0003] In recent years, nanomaterials have become a hot topic in the research and development of biology. As a new type of material for green prevention of plant diseases and ensuring food security, it has become one of the research hotspots of green prevention of plant diseases in the current agricultural field. In modern agriculture, nanomaterials have broken through the harmfulness of traditional pesticides and have the advantages of low biological toxicity, environmental friendliness, high utilization rate and low cost. Among various nanomaterials, mesoporous silica has attracted widespread attention due to its large specific surface area, good stability and good biocompatibility. Studies have shown that applying mesoporous silica nanoparticles to crops such as wheat, sugarcane, mango, sorghum, rice and tomatoes can enhance the resistance of plants to pathogens. For example, spiked mesoporous silica nanoparticles can enhance the resistance of rice to important fungal and bacterial diseases such as white blight and sheath blight, but there is no report on the control effect of nanomaterials on rice viral diseases. Summary of the invention

[0004] In order to overcome the above-mentioned shortcomings of the prior art, the object of the present invention is to provide a method for preparing spike-shaped mesoporous silica nanoparticles and application thereof in plant antiviral treatment.

[0005] The technical solution adopted by the present invention to solve the technical problem is: a method for preparing spike-shaped mesoporous silica nanoparticles, characterized in that the silica nanoparticles have a spike-shaped morphology, and the spike-shaped mesoporous silica nanoparticles include the following preparation steps: (1) Add surfactant, water and sodium hydroxide to the flask in sequence, start stirring, and control the reaction temperature in an oil bath; (2) After sufficient stirring, a mixed solution of tetraethyl orthosilicate (TEOS) and cyclohexane is added, the reaction temperature is maintained in an oil bath, the reaction is further stirred, and the supernatant is removed by centrifugation. The obtained solid is washed with water and ethanol respectively, and each step is repeated three times to obtain spike-shaped mesoporous silica nanoparticles composited with hexadecyltrimethylammonium bromide (CTAB); (3) Dispersing the spike-shaped mesoporous silica nanoparticles composited with CTAB obtained in step (2) with acetone, adding the dispersed nanoparticles into a flask, starting stirring, controlling the reaction temperature at 50°C in an oil bath, introducing condensed water, condensing and refluxing, and removing the CTAB template; (4) The reaction system is centrifuged to remove the supernatant, and the obtained solid is washed with ethanol. After repeated multiple times, the obtained solid is further washed with water. After repeated three times, spike-shaped mesoporous silica nanoparticles (VMSN) stored in the aqueous phase are obtained.

[0006] As a further improvement of the present invention: in step (1), the surfactant is hexadecyltrimethylammonium bromide (CTAB), the mass fraction is 1.9% to 2%, the concentration of sodium hydroxide is 0.1 M, and the amount used is 0.8 mL.

[0007] As a further improvement of the present invention: in step (2), before adding the mixed solution of tetraethyl orthosilicate (TEOS) and cyclohexane, the reaction system is fully stirred so that the surfactant is completely dissolved and the reaction system becomes clear, transparent and colorless.

[0008] As a further improvement of the present invention: in step (2), the stirring time is 2 h.

[0009] As a further improvement of the present invention: in step (2), the amount of the mixed solution of TEOS and cyclohexane is 100 mL, wherein the volume ratio of TEOS to cyclohexane is 1:4, and after TEOS and cyclohexane are uniformly mixed according to the proportion, they are added dropwise into the reaction system.

[0010] As a further improvement of the present invention: in step (2), after adding the mixed solution of TEOS and cyclohexane, the reaction temperature is maintained and the reaction is further stirred for 72 h.

[0011] As a further improvement of the present invention: in steps (1) and (2), an oil bath is used to maintain the reaction temperature at 57-63°C.

[0012] As a further improvement of the present invention: in step (3), the amount of acetone used to disperse the spike-shaped mesoporous silica nanoparticles composited with CTAB is 50 mL.

[0013] As a further improvement of the present invention: in step (3), condensed water is introduced and condensed and refluxed for 48 hours.

[0014] The present invention also includes the use of spike-shaped mesoporous silica nanoparticles in plant anti-virus, and the spike-shaped mesoporous silica nanoparticles described above are used as silica nanopesticides and applied to crops by foliar spraying, and the crops are rice.

[0015] Compared with the prior art, the beneficial effects of the present invention are: the present invention is the first to discover that externally applied spiky mesoporous silica nanoparticles significantly improve the resistance of plants to viruses; the present invention is the first to confirm through experiments that spiky mesoporous silica nanoparticles are involved in plant antiviral activities, and the present invention also provides a theoretical basis for the application of nanomaterials in the green prevention and control of plant viral diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a transmission electron microscope image of the spike-shaped mesoporous silica nanoparticles prepared in the present invention.

[0017] Figure 2 This is a diagram showing symptoms of rice sprayed with water and spike-shaped silica nanoparticles after virus inoculation in an embodiment of the present invention.

[0018] Figure 3 It is the transcription level of the viral capsid gene CP after the rice sprayed with water and spike-shaped silica nanoparticles in the embodiment of the present invention was inoculated with the virus.

[0019] Figure 4 It is the content of virus coat protein CP after the rice sprayed with water and spike-shaped silica nanoparticles in the embodiment of the present invention is inoculated with virus. DETAILED DESCRIPTION

[0020] The principles and features of the present invention are described below in conjunction with the accompanying drawings and specific embodiments. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0021] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0022] Unless otherwise specified, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. Reagents not described in detail in this application are all conventional reagents and can be obtained from commercial channels; methods not specifically described in detail are all conventional experimental methods and can be obtained from the prior art.

[0023] In the present application, the term "gene" refers to a nucleic acid fragment that expresses a specific protein or functional RNA molecule, which may include a regulatory sequence located before the coding sequence (5' non-coding region) and a regulatory sequence after the coding sequence (3' non-coding region).

[0024] In this application, the term "nucleic acid molecule" refers to a polymer of RNA or DNA, which is single-stranded or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases. Nucleic acid molecules in the form of DNA polymers can be composed of one or more segments of cDNA, genomic DNA or synthetic DNA.

[0025] As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, reference to "a plant" includes a plurality of such plants; reference to "a cell" includes one or more cells and equivalents thereof known to those skilled in the art, and so forth.

[0026] A "control", "control plant" or "control plant cell" provides a reference for determining phenotypic changes in a test plant or plant cell, where the genomic changes in the test plant or plant cell affect the gene of interest due to transformation, and the test plant or plant cell may be a transgenic plant or a progeny of a transgenic plant cell. For example, the control plant may have the same genetic background as the test plant, except for the genetic changes that caused the test plant or cell.

[0027] "Plant" includes whole plants, plant organs, plant tissues, seeds and plant cells and the progeny of the plant. Plant cells include, but are not limited to, cells from the following materials: seeds, suspension cultures, embryos, meristematic regions, callus, leaves, roots, shoots, gametophytes, sporophytes, pollen and microspores.

[0028] "Progeny" includes any subsequent generation of a plant.

[0029] "Polynucleotide", "nucleic acid sequence", "nucleotide sequence" or "nucleic acid fragment" are used interchangeably and are single-stranded or double-stranded RNA or DNA polymers that optionally contain synthetic, non-natural or altered nucleotide bases. Nucleotides (usually in their 5'-monophosphate form) are referred to by their single letter names as follows: "A" is adenylic acid or deoxyadenylic acid (RNA or DNA, respectively), "C" represents cytidylic acid or deoxycytidylic acid, "G" represents guanylic acid or deoxyguanylic acid, "U" represents uridylic acid, "T" represents deoxythymidylic acid, "R" represents a purine (A or G), "Y" represents a pyrimidine (C or T), "K" represents G or T, "H" represents A or C or T, "I" represents inosine, and "N" represents any nucleotide.

[0030] Southern Rice Black-streaked Dwarf Virus (SRBSDV) is one of the major viruses that threaten rice production. Innovation in prevention and control methods has always been a major challenge in agricultural research. Currently, most people rely on pesticides to prevent and control such diseases. However, with the increasing requirements for environmental protection, the research and development of green prevention and control materials is particularly important.

[0031] Mesoporous silica, due to its surface properties, large specific surface area, stability and biocompatibility, does provide a new research direction for plant disease prevention and control. Although most of the current research focuses on the prevention and control of bacterial and fungal diseases, for viral diseases, especially viruses like SRBSDV, the research on nanomaterials is still in its infancy.

[0032] In this context, studying the potential of mesoporous silica to control rice viral diseases (such as SRBSDV) can provide a new solution for agriculture. Possible mechanisms include: improving plant immunity, adsorbing or inhibiting the spread of viruses, and improving plant disease resistance. If further research proves that mesoporous silica can effectively control SRBSDV, it will be expected to replace or reduce the use of traditional pesticides, which is in line with the trend of green agricultural development.

[0033] Examples The following are examples of specific embodiments of certain aspects of the present invention. The examples provided are for illustrative purposes only and are not intended to limit the scope of the present invention in any way.

[0034] Implementation Case 1: Spiky mesoporous silica nanoparticles were prepared by the following preparation steps: (1) Add 1.0 g CTAB, 50 mL water and 0.8 mL 0.1 M sodium hydroxide to a 250 mL flask, start stirring, and control the reaction temperature at 60 °C in an oil bath. (2) After the reaction system was stirred for 2 h, CTAB was completely dissolved and the solution became colorless and transparent, 100 mL of a mixed solution of TEOS and cyclohexane (V / V = 1:4) was added, and the reaction temperature was maintained at 60 °C using an oil bath. After further reaction for 72 h, the supernatant was removed by centrifugation, and the solid was washed with water and ethanol, respectively, and each was repeated three times to obtain spike-shaped mesoporous silica nanoparticles composited with CTAB; (3) Use 50 mL of acetone to disperse the spike-shaped mesoporous silica nanoparticles compounded with CTAB, then add the dispersed nanoparticles into a flask, start stirring, control the reaction temperature at 50 °C in an oil bath, pass condensed water, condense and reflux for 48 hours to remove the CTAB template; (4) The reaction system is centrifuged to remove the supernatant, and the obtained solid is washed with ethanol. After repeated multiple times, the obtained solid is further washed with water. After repeated three times, spike-shaped silica nanoparticles (VMSN) stored in the aqueous phase are obtained.

[0035] Implementation Case 2: The spike-shaped mesoporous silica nanoparticles prepared above were used for testing. The spike-shaped silica nanoparticles were sprayed on rice to show their resistance to southern rice black streaked dwarf disease: 1. Virus inoculation of rice seedlings The SRBSDV virus source used in the present invention was collected by our laboratory from the rice-growing areas in southern China, and after being confirmed to be infected with SRBSDV by RT-PCR detection, it was planted and preserved in the experimental field.

[0036] The transmission medium white-backed planthoppers used in the present invention were collected from the field by this laboratory, and then subjected to long-term propagation and subculture. The white-backed planthoppers were raised in an artificial climate incubator with a temperature of 25°C±1°C, a relative humidity of 70%±5%, and 16 h light / 8 h dark.

[0037] Rice was sown, and when the seedlings grew to the 3-4 leaf stage, VMSNs at a concentration of 0.1 mg / ml was sprayed on the rice leaves once a day. After spraying once, the white-backed planthoppers carrying SRBSDV that had passed the cycle period were placed on the rice at a ratio of 2 per plant for feeding; the white-backed planthoppers were removed 2-3 days after inoculation, and the inoculated rice was transplanted and cultured in an artificial climate incubator. After 10 days, the virus rate of rice could be detected by RT-PCR. Symptom pictures were taken 5 days later. The symptom picture results were as follows: Figure 3 The results showed that the growth of diseased plants sprayed with 0.1 mg / ml of spiky silica nanoparticles was significantly better than that of the control group sprayed with water.

[0038] 2. Determination of the transcription level of the viral capsid gene CP of the control strain and the strain sprayed with spike-shaped silica nanoparticles after virus inoculation.

[0039] Fifteen days after virus inoculation, RNA was extracted from rice leaves, and the expression of virus capsid CP gene was detected by RT-qPCR experiment. The primers used in RT-qPCR experiment were (5'-3'): SRBSDV CP-QF CGCGTCATCTCAAACTACAG (SEQ ID NO:1); SRBSDV CP-QRTTTGTCAGCATCTAAAGCGC (SEQ ID NO:2).

[0040] The results are as follows Figure 4 The results showed that the transcription level of the viral coat gene CP in rice sprayed with 0.1 mg / ml of spike-shaped silica nanoparticles was significantly lower than that in the control group sprayed with water. * and ** represent mutants with significant differences compared with the wild type (* indicates p <0.05; ** indicates p <0.01).

[0041] 3. Determination of virus capsid protein CP of the control strain and the VMSNs sprayed strain after virus inoculation.

[0042] Fifteen days after virus inoculation, rice leaves were taken to extract proteins. The results of protein immunoblotting showed that the content of virus capsid protein CP in rice sprayed with 0.1 mg / ml spike-shaped silica nanoparticles was significantly lower than that in the control group sprayed with water.

[0043] Experimental data show that the disease resistance of rice can be improved after the rice seedlings are inoculated with SRBSDV by spraying the spike-shaped mesoporous silica nanoparticles. The phenotype of the rice seedlings sprayed with the mesoporous silica nanoparticles is different from that of the control.

[0044] After virus inoculation, the spike-shaped silica nanoparticles were sprayed, and the transcription level of the virus capsid gene CP was significantly lower than that of the control plant.

[0045] After virus inoculation, the spike-shaped silica nanoparticles were sprayed, and the protein content of the virus capsid gene CP was significantly lower than that of the control plant.

[0046] The main functions of the present invention are: The present invention provides mesoporous silica nanoparticles with simple synthesis and preparation methods, mild reaction conditions, low cost and good biosafety. The obtained nanomaterials significantly improve the resistance of rice to southern rice black-streaked dwarf virus. The present invention experimentally confirms for the first time the role of mesoporous silica nanoparticles in regulating plant virus tolerance. Based on the application of mesoporous silica nanoparticles in plant virus resistance, it can be considered that the nanomaterial has potential application value in regulating plant response to viral stress. The present invention also provides a theoretical basis for the application of nanomaterials in green prevention and control of plant viral diseases.

[0047] In summary, after reading the present invention document, ordinary technicians in this field can make various other corresponding transformation schemes based on the technical scheme and technical concept of the present invention without creative mental work, which all fall within the scope of protection of the present invention.

Claims

1. A method for preparing spike-shaped mesoporous silica nanoparticles, characterized in that: The silicon dioxide nanoparticles have a spike-like morphology, and the spike-like mesoporous silicon dioxide nanoparticles include the following preparation steps: (1) Add surfactant, water and sodium hydroxide to a flask in sequence, start stirring, and control the reaction temperature in an oil bath; (2) After sufficient stirring, a mixed solution of tetraethyl orthosilicate and cyclohexane is added, the reaction temperature is maintained in an oil bath, the reaction is further stirred, the supernatant is removed by centrifugation, and the obtained solid is washed with water and ethanol respectively, each of which is repeated three times to obtain spike-shaped mesoporous silica nanoparticles composited with hexadecyltrimethylammonium bromide (CTAB); (3) dispersing the spike-shaped mesoporous silica nanoparticles composited with CTAB obtained in step (2) with acetone, adding the dispersed nanoparticles into a flask, starting stirring, controlling the reaction temperature at 50° C. in an oil bath, introducing condensed water, condensing and refluxing, and removing the CTAB template; (4) The reaction system is centrifuged to remove the supernatant, and the obtained solid is washed with ethanol. After repeated multiple times, the obtained solid is further washed with water. After repeated three times, spike-shaped mesoporous silica nanoparticles stored in the aqueous phase are obtained.

2. The method for preparing spike-shaped mesoporous silica nanoparticles according to claim 1, characterized in that: In step (1), the surfactant is hexadecyltrimethylammonium bromide, the mass fraction is 1.9% to 2%, the concentration of sodium hydroxide is 0.1M, and the amount used is 0.8mL.

3. The method for preparing spike-shaped mesoporous silica nanoparticles according to claim 2, characterized in that: In step (2), before adding the mixed solution of tetraethyl orthosilicate and cyclohexane, the reaction system is stirred sufficiently to allow the surfactant to be completely dissolved and the reaction system to become clear, transparent and colorless.

4. The method for preparing spike-shaped mesoporous silica nanoparticles according to claim 3, characterized in that: In step (2), the stirring time is 2 h.

5. The method for preparing spike-shaped mesoporous silica nanoparticles according to claim 4, characterized in that: In step (2), the amount of the mixed solution of tetraethyl orthosilicate TEOS and cyclohexane is 100 mL, wherein the volume ratio of TEOS to cyclohexane is 1:

4. After TEOS and cyclohexane are uniformly mixed according to the proportion, they are added dropwise into the reaction system.

6. The method for preparing spike-shaped mesoporous silica nanoparticles according to claim 5, characterized in that: In step (2), after adding the mixed solution of TEOS and cyclohexane, the reaction temperature was maintained and the reaction was further stirred for 72 hours.

7. The method for preparing spike-shaped mesoporous silica nanoparticles according to claim 1, characterized in that: In steps (1) and (2), the reaction temperature was maintained at 57-63°C using an oil bath.

8. The method for preparing spike-shaped mesoporous silica nanoparticles according to claim 1, characterized in that: In step (3), the amount of acetone used to disperse the spike-shaped mesoporous silica nanoparticles composited with CTAB is 50 mL.

9. The method for preparing spike-shaped mesoporous silica nanoparticles according to claim 1, characterized in that: In step (3), condensed water is introduced and condensation reflux is performed for 48 hours.

10. Application of spike-shaped mesoporous silica nanoparticles in plant antiviral treatment, characterized in that: The spike-shaped mesoporous silica nanoparticles according to any one of claims 1 to 9 are applied to crops by foliar spraying as silica nanopesticides, wherein the crops are rice.

Images