Method for extracting zeaxanthin from fermentation liquor

Abstract

The invention provides a method for extracting zeaxanthin from fermentation liquor. The method comprises the following steps: crushing cells in the fermentation liquor to obtain crushed liquor, centrifuging the crushed liquor to obtain precipitates, washing the precipitates with pure water, washing and dewatering the precipitates, extracting the precipitates to obtain an extraction phase, concentrating the extraction phase to obtain concentrated slurry, performing suction filtration on the concentrated slurry to obtain a filter cake, and optionally drying the filter cake. The method has the advantages of simple process steps, avoiding of the use of high-toxicity solvents, high product purity and yield, and suitableness for subsequent large-scale commercial production.

Description

Technical Field

[0001] The invention relates to the field of biological extraction of zeaxanthin, and in particular to a method for extracting zeaxanthin from Yarrowia lipolytica fermentation broth. Background Art

[0002] Zeaxanthin, also known as zeaxanthin, CAS No. 144-68-3, molecular formula C 40 H 56 O2, molecular weight 566.88, is a kind of carotenoid, a dihydroxy derivative of beta-carotene. Zeaxanthin is present in large quantities in plant tissues such as green vegetables, red peppers, marigolds, corn seeds, wolfberries and Physalis fruits, and some non-photosynthetic bacteria. Zeaxanthin has a specific antioxidant function, making it an important nutritional health product. In addition, zeaxanthin also has unique physiological effects in preventing cardiovascular diseases, cataracts, preventing cancer, and enhancing immunity (CN101293863A). At the same time, zeaxanthin is also widely used in dietary pigments, agriculture, and cosmetics (CN101203616A).

[0003] At present, there are four main ways to obtain zeaxanthin in industry: extraction from plants; chemical synthesis; chemical transformation using other intermediates; and microbial fermentation. Plant extraction mainly obtains zeaxanthin from plants such as capsicum (CN110590630A), marigold (CN113582899A; CN105254549; CN114057072A), corn (CN102603590A), wolfberry (CN106349136A; CN107098839A; CN106349137A), and physalis (CN106565574A). This method often requires a large amount of organic solvents and is assisted by inefficient and expensive means such as supercritical extraction and ultrasound to obtain the final product. The process is complex, the energy consumption is high, the product yield is low, and the removal effect of other carotenoids is poor. As for the total synthesis strategy, the process steps are complicated, the process pollution is serious, and the synthesis cost is high. At present, this method is still a long way from commercialization. The use of canthaxanthin (CN101293863A), lutein (CN105085351A, CN101153017B; Helv. Chim. Acta 39 (1956) 2041; Justus Liebigs Ann. Chem. 603 (1957) 129), or astaxanthin (CN110143904B) can largely solve the problems caused by total synthesis, but the use of toxic reagents and harsh reaction parameters in the process have brought severe challenges to the industrial scale-up of zeaxanthin. Microbial synthesis has opened up a new way of thinking for the commercial production of zeaxanthin. Patents such as CN10123616A, CN103038358B, and CN105886518A have also conducted a lot of research on different bacterial genera, and made many attempts in strain construction, fermentation optimization, and downstream extraction. However, low fermentation yield, low extraction yield, and complex process have seriously limited its industrial prospects. Summary of the invention

[0004] To solve the above problems, the present invention provides a method for extracting zeaxanthin from microbial fermentation broth, which has simple process steps, low solvent toxicity, high extraction yield and good product quality.

[0005] The present invention provides a method for extracting zeaxanthin from microbial fermentation liquid or fermentation cells, the method comprising: 1) pre-treating the fermentation liquid or fermentation cells to obtain a precipitate; 2) washing the precipitate and removing water from the washing; and 3) leaching the precipitate.

[0006] In certain embodiments, pure water is used to wash the precipitate in step 2).

[0007] In certain embodiments, in step 2), an alcohol solvent is used for washing and removing water.

[0008] In certain embodiments, the alcohol solvent is selected from one or more of acetonitrile, methanol, acetone, ethanol, and isopropanol; preferably, the alcohol solvent is acetonitrile.

[0009] In certain embodiments, the extractant used for the leaching in step 3) is a low-carbon alcohol or ester; preferably, the extractant is ethylene dichloride.

[0010] In certain embodiments, the method further comprises: 4) the step of concentrating the extract phase.

[0011] In certain embodiments, the method further comprises: 5) a step of washing the concentrated slurry with a solvent.

[0012] In certain embodiments, the solvent for washing the impurities in step 5) is selected from one or more of low-carbon hydrocarbons, alcohols, esters, and halogenated hydrocarbons; preferably, the solvent for washing the impurities is ethanol.

[0013] In certain embodiments, the method further comprises the steps of: 6) filtering the concentrated slurry and optionally 7) drying the filter cake.

[0014] In certain embodiments, the step 7) further comprises washing the filter cake with hot ethanol before drying the filter cake.

[0015] In certain embodiments, the pretreatment of the fermentation broth or fermentation cells in step 1) comprises cell disruption and centrifugation.

[0016] In certain embodiments, cell disruption is performed using a high pressure homogenizer.

[0017] In certain embodiments, the homogenization pressure is 600-1200 bar, and the homogenization temperature is 5-40°C.

[0018] In certain embodiments, the homogenization pressure is 800-1000 bar.

[0019] In certain embodiments, the homogenization temperature is 5-30°C.

[0020] In certain embodiments, the number of homogenizations is 1-4 times.

[0021] In certain embodiments, the relative centrifugal force of the centrifugation is 3000-12000 rcf, the centrifugation temperature is 0-25°C, and the centrifugation time is 2-40 min.

[0022] In certain embodiments, the relative centrifugal force is 4000-1000 rcf.

[0023] In certain embodiments, the centrifugation temperature is 20-25°C.

[0024] In certain embodiments, the centrifugation time is 5-20 min.

[0025] In certain embodiments, in step 2), 1 to 4 times the mass (W / W) of pure water is added to the precipitate obtained in step 1) for washing, and the washing water phase is removed by centrifugation.

[0026] In certain embodiments, the amount of pure water added is 2 to 3 times the mass (W / W) of the precipitate.

[0027] In certain embodiments, in step 2), 1 to 4 times the weight (W / W) of an alcohol solvent is added to the precipitate after washing with pure water to wash and remove water, and the aqueous solution is removed by centrifugation.

[0028] In some embodiments, the amount of the alcohol solvent is 2 to 3 times the weight (W / W) of the precipitate. In some embodiments, the washing and dewatering temperature is 10-80°C.

[0029] In certain embodiments, the washing and dewatering temperature is 10-60°C.

[0030] In certain embodiments, in step 3), the precipitate after washing and dehydration is extracted 1 to 5 times using 1 to 10 times the weight (W / W) of the extractant.

[0031] In certain embodiments, the amount of the extractant used is 2-6 times the mass (W / W) of the precipitate.

[0032] In certain embodiments, the extraction is performed 2-3 times.

[0033] In certain embodiments, the extraction vessel is a mechanically stirred tank.

[0034] In certain embodiments, the extraction time is 0.1-8 hours.

[0035] In certain embodiments, the extraction temperature is 0-80°C.

[0036] In certain embodiments, the extract phase is concentrated by evaporation in step 4).

[0037] In certain embodiments, the extract phase is concentrated by rotary evaporation.

[0038] In certain embodiments, the rotary evaporation temperature is 0-60° C., and the rotary evaporation vacuum degree is 10-1000 mbar.

[0039] In certain embodiments, the rotary evaporation temperature is 20-50°C.

[0040] In certain embodiments, the rotary evaporation vacuum degree is 20-60 mbar.

[0041] In certain embodiments, the evaporation concentration container is a rotary evaporator.

[0042] In certain embodiments, the rotary evaporation operation is stopped when no more liquid drips out during the rotary evaporation.

[0043] In certain embodiments, in step 5), 1-50 times the mass (W / W) of a washing solvent is added to the concentrated slurry, the washing temperature is 0-100° C., and the washing time is 0.1-5.0 hours.

[0044] In certain embodiments, the amount of the washing solvent is 5-20 times that of the concentrated slurry.

[0045] In certain embodiments, the washing temperature is 30-60°C.

[0046] In certain embodiments, the washing time is 0.2-2.0 hours.

[0047] In certain embodiments, the filter cake is dried at a temperature of 30-100° C., a vacuum degree of 1-20 KPa, and a drying time of 12-24 hours in step 7).

[0048] In certain embodiments, the drying temperature of the filter cake is 30-60°C.

[0049] In certain embodiments, the vacuum degree is 1-10 KPa.

[0050] In certain embodiments, the drying time is 12-18 hours.

[0051] In certain embodiments, the filter cake is dried in a vacuum oven.

[0052] In certain embodiments, the microorganism is Yarrowia lipolytica.

[0053] In certain embodiments, the Yarrowia lipolytica is a recombinant Yarrowia lipolytica.

[0054] In certain embodiments, the recombinant Yarrowia lipolytica comprises introduced genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase or a truncate thereof (tHMGR), β-carotene hydroxylase from Pantoea stewartii (CrtZ_9GAMM), mevalonate-5-pyrophosphate decarboxylase (ERG19), β-carotene hydroxylase from Saccharolobus solfataricus (CrtZ_SACS2), and β-carotene hydroxylase CrtZ_SACS2-ERG6 fusion protein.

[0055] In certain embodiments, the phytoene dehydrogenase comprises the amino acid sequence shown in SEQ ID NO:1.

[0056] In certain embodiments, the gene encoding phytoene dehydrogenase comprises the nucleotide sequence shown in SEQ ID NO:10.

[0057] In certain embodiments, the lycopene cyclase / phytoene synthase comprises the amino acid sequence shown in SEQ ID NO:2.

[0058] In certain embodiments, the gene encoding lycopene cyclase / phytoene synthase comprises the nucleotide sequence shown in SEQ ID NO:11.

[0059] In certain embodiments, the geranylgeranyl diphosphate synthase comprises the amino acid sequence shown in SEQ ID NO:3.

[0060] In certain embodiments, the gene encoding geranylgeranyl diphosphate synthase comprises the nucleotide sequence shown in SEQ ID NO:12.

[0061] In certain embodiments, the diacylglycerol acyltransferase comprises the amino acid sequence shown in SEQ ID NO:4.

[0062] In certain embodiments, the gene encoding diacylglycerol acyltransferase comprises the nucleotide sequence shown in SEQ ID NO:13.

[0063] In certain embodiments, the 3-hydroxy-3-methylglutaryl-CoA reductase or a truncate thereof comprises the amino acid sequence shown in SEQ ID NO:5.

[0064] In certain embodiments, the gene encoding 3-hydroxy-3-methylglutaryl-CoA reductase or a truncation thereof comprises the nucleotide sequence shown in SEQ ID NO:14.

[0065] In certain embodiments, the β-carotene hydroxylase CrtZ_9GAMM comprises the amino acid sequence shown in SEQ ID NO:6.

[0066] In certain embodiments, the gene encoding β-carotene hydroxylase CrtZ_9GAMM comprises the nucleotide sequence shown in SEQ ID NO:15.

[0067] In certain embodiments, the mevalonate 5-pyrophosphate decarboxylase comprises the amino acid sequence shown in SEQ ID NO:7.

[0068] In certain embodiments, the gene encoding mevalonate 5-pyrophosphate decarboxylase comprises the nucleotide sequence shown in SEQ ID NO:16.

[0069] In certain embodiments, the β-carotene hydroxylase CrtZ_SACS2 comprises the amino acid sequence shown in SEQ ID NO:8.

[0070] In certain embodiments, the gene encoding β-carotene hydroxylase CrtZ_SACS2 comprises the nucleotide sequence shown in SEQ ID NO:17.

[0071] In certain embodiments, the sterol methyltransferase comprises the amino acid sequence shown in SEQ ID NO:9.

[0072] In certain embodiments, the gene encoding sterol methyltransferase comprises the nucleotide sequence shown in SEQ ID NO:18.

[0073] In certain embodiments, the recombinant Yarrowia lipolytica genome is inserted with the following DNA sequences or a combination of fragments thereof: SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO: 26.

[0074] In certain embodiments, the fragment is a sequence obtained by removing the resistance gene or the screening gene based on any one of SEQ ID NOs: 19-26.

[0075] In certain embodiments, the starting strain for constructing the recombinant Yarrowia lipolytica is Polf.

[0076] The second aspect of the present invention provides a zeaxanthin product obtained by extraction according to the method of the first aspect of the present invention.

[0077] In certain embodiments, the product has a purity of >90%.

[0078] The advantages of the present invention over the prior art are:

[0079] The present invention provides a method for extracting and purifying zeaxanthin from fermentation liquid or fermentation cells for the first time.

[0080] The purification method adopted by the present invention has simple process steps and avoids the use of highly toxic solvents, and is suitable for subsequent large-scale commercial production.

[0081] The technical route provided by the present invention has a product quality purity of >90%, and a separation and purification yield of up to 78%. BRIEF DESCRIPTION OF THE DRAWINGS

[0082] Figure 1 The AP18860 plasmid map is shown.

[0083] Figure 2 The DNA6336 plasmid map is shown.

[0084] Figure 3 Shown is a comparison of the β-carotene production abilities of strains BOTA01025, BOTA01027, and BOTA01017.

[0085] Figure 4 Shown is a comparison of zeaxanthin production by strains BOTA01017, BOTA01018 and BOTA01021.

[0086] Figure 5 Shown is a comparison of zeaxanthin production between strains BOTA01021 and BOTA01019.

[0087] Figure 6 Shown is a comparison of zeaxanthin production between strains BOTA01019 and BOTA01026.

[0088] Figure 7 The liquid phase chromatogram of the fermentation broth of the experimental example is shown. The chromatogram is derived from the detection of the sample at the end of the fermentation. The retention time of 1.367 min is zeaxanthin, the retention time of 3.178 min is the β-carotene component, the retention time of 2.440 min is the cryptoxanthin component, and the other retention time components are other fermentation by-products.

[0089] Figure 8The liquid chromatogram of the experimental example disrupted liquid is shown. The chromatogram is derived from the detection of the cell homogenized disrupted liquid sample. The retention time of 1.331min is zeaxanthin, the retention time of 3.170min is the β-carotene component, the retention time of 2.384min is the cryptoxanthin component, and the other retention time components are other fermentation by-products.

[0090] Fig. 9 The chromatogram of the washing phase of the experimental example is shown. The chromatogram is derived from the detection of the washing phase sample. The component at the retention time of 1.328 min is zeaxanthin, the component at the retention time of 3.169 min is β-carotene, and the components at other retention times are other fermentation byproducts.

[0091] Fig.10 The liquid phase chromatogram of the washing and dewatering solution in the experimental example is shown. The chromatogram is derived from the detection of the washing and dewatering phase sample. The retention time of 1.327 min is zeaxanthin, the retention time of 3.167 min is the β-carotene component, the retention time of 2.381 min is the cryptoxanthin component, and the other retention time components are other fermentation byproducts.

[0092] Fig.11 The chromatogram of the extraction phase of the experimental example is shown. The chromatogram is derived from the detection of the extraction phase sample. The retention time of 1.313min is zeaxanthin, the retention time of 3.173min is the β-carotene component, the retention time of 2.372min is the cryptoxanthin component, and the components at other retention times are other fermentation by-products.

[0093] Fig.12 The chromatogram of the raffinate phase of the experimental example is shown. The chromatogram is derived from the detection of the raffinate phase sample. The retention time of 1.323 min is zeaxanthin, the retention time of 3.175 min is the β-carotene component, the retention time of 2.391 min is the cryptoxanthin component, and the components at other retention times are other fermentation by-products.

[0094] Fig.13 The mother liquor liquid chromatogram of the experimental example is shown. The chromatogram is derived from the detection of the mother liquor sample. The component at the retention time of 3.195min is the β-carotene component, and the components at other retention times are other fermentation by-products.

[0095] Fig.14 The liquid chromatogram of the experimental product is shown. This chromatogram is derived from the detection of the mother liquor sample. The retention time of 1.236min is zeaxanthin, and there are small amounts of byproducts at other retention times. DETAILED DESCRIPTION

[0096] The following definitions are provided to facilitate understanding of the present invention by those skilled in the art. Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those of ordinary skill in the art to which the present invention belongs. Preferred materials and methods are described herein, but any methods and materials similar to or equivalent to those described herein may be used in the practice of the present invention's tests. It should also be understood that the terms used herein are only for the purpose of describing specific embodiments and are not intended to be limiting.

[0097] Definition of terms

[0098] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0099] In order to more readily understand the present disclosure, certain terms are first defined below.

[0100] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0101] As used herein, the terms "comprising," "having," "including," and "containing" should be construed as open-ended terms (ie, meaning "including, but not limited to, ").

[0102] In this article, "and / or" refers to and includes any and all possible combinations of one or more items in the associated listed items. For example, a composition comprising A and / or B can be interpreted as a composition comprising A, a composition comprising B, or a composition comprising A and B.

[0103] All numerical designations, such as pH, temperature, time, concentration, and molecular weight, including ranges, are approximate and are appropriately varied in increments of 1.0 or 0.1, or are optionally varied (+) or (-) by + / - 15%, 10%, 5%, 2%. It should be understood that all numerical designations are preceded by the term "about". It should also be understood that the agents described herein are exemplary only and that equivalents thereof are known in the art. When referring to measurable values ​​such as amounts or concentrations, the term "about" as used herein is meant to include variations within 20%, 10%, 5%, 1%, 0.5%, or 0.1% of the specified amount.

[0104] As used herein, the term "zeaxanthin", also known as "zeaxanthin", "zeaxanthin", is a fat-soluble pigment component of lutein and a dihydroxy derivative of β-carotene. Zeaxanthin is abundantly present in plant tissues such as green vegetables, corn seeds, wolfberries and Physalis fruits, and in some non-photosynthetic bacteria.

[0105] As used herein, the term "Yarrowia lipolytica", Latin name Yarrowia lipolytica, is a non-conventional yeast belonging to the class Hemiascomycetes. Yarrowia lipolytica is widely used in the production of food additives. The application of Yarrowia lipolytica in the biosynthesis of natural products includes the fermentation production of fatty acids and lipids, terpenoids, flavonoids and other active products such as succinic acid, pyruvic acid, α-ketoglutaric acid, adipic acid, erythritol, cordycepin, etc.

[0106] As used herein, the term "cell disruption" refers to the disruption of cells in a fermentation broth by physical or chemical methods to release effective components in the cells, such as enzymes, polysaccharides, and nucleic acids. The disruption process is essential for extracting target components because many genetic engineering products are usually accumulated in cells. Commonly used disruption methods for fermentation broth include mechanical methods, chemical methods, and enzymatic methods. Mechanical methods include high-pressure homogenization, grinding, etc. Chemical methods use chemical reagents such as acids, alkalis, or organic solvents to disrupt cells. Enzymatic methods utilize enzymatic action to disrupt cells. For example, lysozyme and polysaccharide hydrolase are used to pretreat baker's yeast, and then high-pressure homogenization is performed. Herein, a high-pressure homogenizer is used to disrupt cells in a fermentation broth.

[0107] As used herein, the term "high pressure homogenization" means that the material is made to flow at high speed in a cavity with a special structure by ultra-high pressure, thereby achieving a homogenization effect. High pressure homogenization can make the material in a suspended state flow through a cavity with a special internal structure under a pressure of up to 60,000 psi, causing the material to undergo physical, chemical and structural property changes, ultimately achieving a homogenization effect.

[0108] As used herein, the term "extraction method" is also called liquid-solid extraction method, which uses a volatile organic solvent to transfer certain components in the raw material to the solvent phase, and then recovers the organic solvent by means of evaporation, distillation, etc., to obtain the desired relatively pure extraction components. In this article, the extraction phase and the raffinate phase are obtained after the precipitation is treated by the "extraction method", and most of the zeaxanthin is contained in the extraction phase.

[0109] The term "rotary evaporation" as used in this article is a method commonly used in laboratories to separate and concentrate solutions. The basic principle is to use a rotating flask and a condenser tube, combined with the negative pressure state of a vacuum pump, to evaporate the solution during the rotation process, thereby effectively concentrating the solution.

[0110] As used herein, the term "washing to remove water" refers to a method of replacing the residual water in the feed liquid with a non-aqueous solvent.

[0111] The term "washing" as used herein refers to a method of dissolving the impurities to be separated using specific reagents.

[0112] As used herein, the terms "nucleic acid", "nucleic acid molecule", "nucleic acid sequence", "nucleotide sequence" and "polynucleotide" are used interchangeably and refer to a polymeric form of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. Thus, the term includes, but is not limited to, single-stranded or double-stranded DNA or RNA, genomic DNA, cDNA, DNA / RNA hybrids, or polymers comprising, consisting of, or consisting essentially of purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural or derived nucleotide bases.

[0113] The terms "protein", "peptide", "polypeptide" and "amino acid sequence" are used interchangeably and in their broadest sense refer to a polymeric form of two or more amino acid subunits, amino acid analogs or peptidomimetics. "Protein", "peptide", "polypeptide" and "amino acid sequence" contain at least two amino acids, and there is no limitation on the maximum number of amino acids. The term "amino acid" as used herein refers to natural and / or non-natural or synthetic amino acids, including D and L optical isomers and amino acid analogs.

[0114] Compared with the protein or amino acid sequence described herein, equivalents with one or more amino acid modifications are also included in the scope of the present invention, provided that the one or more amino acid modifications do not affect or substantially do not affect the activity of the protein or amino acid sequence. In this article, the amino acid modification can be an amino acid substitution, an amino acid deletion or an amino acid insertion. Amino acid substitutions can be conservative amino acid substitutions or non-conservative amino acid substitutions. Conservative substitutions (also known as conservative mutations, conservative substitutions or conservative variations) are amino acid substitutions in proteins that change a given amino acid to a different amino acid with similar biochemical properties (e.g., charge, hydrophobicity or size). In this article, "conservative substitutions" refer to amino acid residues that are replaced by another biologically similar residue. Examples of conservative substitutions include one hydrophobic residue such as isoleucine, valine, leucine or methionine replacing another; or one charged or polar residue replacing another, such as arginine replacing lysine, glutamic acid replacing aspartic acid, glutamine replacing asparagine, etc. Other illustrative examples of conservative substitutions include the following changes: alanine to serine; asparagine to glutamine or histidine; aspartic acid to glutamic acid; cysteine ​​to serine; glycine to proline; histidine to asparagine or glutamine; lysine to arginine, glutamine or glutamic acid; phenylalanine to tyrosine, serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine, and the like.

[0115] In this article, "expression" refers to the process by which a nucleic acid sequence is transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, amino acid sequence or protein. If the nucleic acid sequence is from genomic DNA, expression may include splicing mRNA in a eukaryotic cell.

[0116] When the term "encoding" is applied to a nucleic acid sequence, it means that if it can be transcribed to produce mRNA and / or translated to produce a polypeptide in its native state or when manipulated by methods well known to those skilled in the art, it is said to be a nucleic acid sequence that "encodes" a polypeptide. Therefore, a "coding sequence" is a nucleic acid sequence that has the above functions, which can be DNA or RNA (e.g., mRNA).

[0117] Herein, "coding gene" includes "coding sequence" and may optionally include other nucleotide sequence elements for regulating gene expression, such as promoter and terminator, etc. In the "coding gene", the coding sequence and other nucleotide sequence elements are arranged in a suitable order to promote the correct expression of the encoded protein.

[0118] "Homology" or "identity" refers to the sequence similarity between two polypeptides or between two nucleic acid sequences. The percent identity can be determined by comparing the positions in each sequence, which can be aligned for the purpose of comparison. When a position in the compared sequences is occupied by the same base or amino acid, the molecules are identical at that position. The degree of identity between sequences depends on the number of shared matching positions. Tools for comparing similarity between sequences are well known to those skilled in the art, for example, by importing a nucleic acid or amino acid sequence into ClustalW (available from https: / / genome..jp / tools bin / clustalw / ) and using ClustalW, the alignment and percent sequence identity of the nucleic acid or amino acid sequences provided herein can be obtained.

[0119] In this article, "homolog" and "homologous protein" can be used interchangeably, referring to a reference protein, which has a higher sequence identity in the amino acid sequence or coding sequence, and the two have a higher similarity in function, such as being able to achieve the same function, such as being able to catalyze the same reaction process. "Homologous protein" includes a protein having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with the reference protein. Alternatively, "homologous protein" includes a protein encoded by a polynucleotide having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with the coding sequence of the reference protein.

[0120] A "non-homologous protein" or "unrelated protein" has less than 40% identity, less than 30% identity or less than 25% identity with the amino acid sequence or coding sequence of the reference protein of the present invention.

[0121] The term "promoter" as used herein refers to an expression control sequence that controls the initiation and efficiency of transcription of a gene or transgene. A promoter can be, for example, constitutive, inducible, repressible, or tissue-specific. A promoter can contain genetic elements to which regulatory proteins and molecules such as RNA polymerase and transcription factors can bind. Promoters used herein include pTEFin (SEQ ID NO: 50), pGPD (SEQ ID NO: 51), and 8UASEXP (SEQ ID NO: 52).

[0122] The term "terminator" used in this article is a DNA sequence that gives RNA polymerase a transcription termination signal. Terminators can be divided into two categories, one of which can achieve termination without relying on protein cofactors. The other category relies on protein cofactors to achieve termination. This protein cofactor is called a termination factor, also commonly known as a p factor. The two types of terminators have common sequence characteristics. There is a palindromic sequence before the transcription termination point. The two repeated parts of the palindromic sequence (each 7 to 20 bp) are separated by several non-repeating bp segments. The symmetry axis of the palindromic sequence is generally 16 to 24 bp away from the transcription termination point. The terminators used in this article include the endogenous terminators Txpr2 and Tlip2 commonly used in Yarrowia lipolytica.

[0123] As used herein, the term "recombination" refers to the process of re-covalent combination of genetic information within or between DNA molecules. When applied to specific microorganisms, such as the Yarrowia lipolytica described in the present invention, the term "recombination" refers to the use of artificial intervention to make the Yarrowia lipolytica have certain different characteristics compared to the starting strain, such as improved zeaxanthin production capacity. Those skilled in the art will understand that "engineered microorganisms" are not limited to strains modified by genetic engineering means, and strains containing gene disruptions described in the present invention obtained by means such as UV mutagenesis or chemical mutagenesis should also be included in the scope of the "engineered microorganisms" described in the present invention.

[0124] The term "non-homologous end joining (NHEJ)" refers to the repair of double-stranded DNA by binding to the ends of double-stranded DNA breaks through a protein complex and recruiting the corresponding ATP-dependent DNA ligase. Compared with homologous recombination (HR), NHEJ does not require a homologous DNA repair template and does not rely on DNA replication. NHEJ is an important mechanism of genetic recombination in microorganisms, especially in Yarrowia lipolytica.

[0125] The term "Gibson assembly" is a recombination-based molecular cloning method for the in vitro assembly of DNA fragments. The core principle of Gibson assembly relies on three enzymes: DNA exonuclease, high-fidelity DNA polymerase, and thermostable DNA ligase. First, T5 exonuclease digests the DNA fragments in the chain direction from 5' to 3', and each DNA fragment forms a single-stranded protrusion. Since a part of these adjacent protruding fragments has homology, they can anneal complementary. Then, high-fidelity DNA polymerase fills the gaps in the annealed fragments, and thermostable DNA ligase finally seals the gaps in the assembled DNA to generate a double-stranded completely sealed DNA molecule. DETAILED DESCRIPTION OF THE INVENTION

[0127] I. Recombinant Yarrowia lipolytica

[0128] The present invention provides a recombinant Yarrowia lipolytica, which comprises, based on a starting strain, introduced genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase or a truncate thereof (tHMGR), β-carotene hydroxylase CrtZ_9GAMM, mevalonate-5-pyrophosphate decarboxylase (ERG19), β-carotene hydroxylase CrtZ_SACS2, and β-carotene hydroxylase CrtZ_SACS2-ERG6 fusion protein.

[0129] In certain embodiments, the number of copies of the gene encoding CarB introduced is 2, 3, 4 or 5, preferably 2; preferably, the genes of different copy numbers are the same.

[0130] In certain embodiments, the number of copies of the gene encoding CarE introduced is 2, 3, 4 or 5, preferably 2; preferably, the genes of different copy numbers are the same.

[0131] In certain embodiments, the phytoene dehydrogenase comprises the amino acid sequence shown in SEQ ID NO: 1 or the amino acid sequence of a homologous protein of SEQ ID NO: 1, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity with SEQ ID NO: 1 and retains the function of phytoene dehydrogenase.

[0132] In certain embodiments, the gene encoding phytoene dehydrogenase comprises the nucleotide sequence shown in SEQ ID NO: 10 or a degenerate sequence thereof, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 10.

[0133] In certain embodiments, the lycopene cyclase / phytoene synthase comprises the amino acid sequence shown in SEQ ID NO: 2 or the amino acid sequence of a homologous protein of SEQ ID NO: 2, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 2 and retains the function of lycopene cyclase / phytoene synthase.

[0134] In certain embodiments, the gene encoding lycopene cyclase / phytoene synthase comprises the nucleotide sequence shown in SEQ ID NO: 11 or a degenerate sequence thereof, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 11.

[0135] In certain embodiments, the geranylgeranyl diphosphate synthase comprises the amino acid sequence shown in SEQ ID NO:3 or the amino acid sequence of a homologous protein of SEQ ID NO:3, or an amino acid sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:3 and retains the function of geranylgeranyl diphosphate synthase.

[0136] In certain embodiments, the gene encoding geranylgeranyl diphosphate synthase comprises the nucleotide sequence shown in SEQ ID NO: 12 or a degenerate sequence thereof, or a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 12.

[0137] In certain embodiments, the diacylglycerol acyltransferase comprises the amino acid sequence shown in SEQ ID NO:4 or the amino acid sequence of a homologous protein of SEQ ID NO:4, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:4 and retains the function of diacylglycerol acyltransferase.

[0138] In certain embodiments, the gene encoding diacylglycerol acyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 13 or a degenerate sequence thereof, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 13.

[0139] In certain embodiments, the 3-hydroxy-3-methylglutaryl-CoA reductase or a truncate thereof comprises the amino acid sequence shown in SEQ ID NO:5 or the amino acid sequence of a homologous protein of SEQ ID NO:5, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:5 and retains the function of 3-hydroxy-3-methylglutaryl-CoA reductase.

[0140] In certain embodiments, the gene encoding 3-hydroxy-3-methylglutaryl-CoA reductase or a truncation thereof comprises the nucleotide sequence shown in SEQ ID NO: 14 or a degenerate sequence thereof or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 14.

[0141] In certain embodiments, the β-carotene hydroxylase CrtZ_9GAMM comprises the amino acid sequence shown in SEQ ID NO: 6 or the amino acid sequence of a homologous protein of SEQ ID NO: 6, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 6 and maintains the function of β-carotene hydroxylase.

[0142] In certain embodiments, the gene encoding β-carotene hydroxylase CrtZ_9GAMM comprises the nucleotide sequence shown in SEQ ID NO: 15 or a degenerate sequence thereof or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 15.

[0143] In certain embodiments, the mevalonate-5-pyrophosphate decarboxylase comprises the amino acid sequence shown in SEQ ID NO: 7 or the amino acid sequence of a homologous protein of SEQ ID NO: 7, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 7 and retains the function of mevalonate-5-pyrophosphate decarboxylase.

[0144] In certain embodiments, the gene encoding mevalonate 5-pyrophosphate decarboxylase comprises the nucleotide sequence shown in SEQ ID NO: 16 or a degenerate sequence thereof, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 16.

[0145] In some embodiments, the β-carotene hydroxylase CrtZ_SACS2 comprises the amino acid sequence shown in SEQ ID NO: 8 or the amino acid sequence of a homologous protein of SEQ ID NO: 8, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 8 and maintains the function of β-carotene hydroxylase.

[0146] In certain embodiments, the gene encoding β-carotene hydroxylase CrtZ_SACS2 comprises the nucleotide sequence shown in SEQ ID NO: 17 or a degenerate sequence thereof, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity with SEQ ID NO: 20 or 21. Preferably, the Yarrowia lipolytica comprises the nucleotide sequence shown in SEQ ID NO: 17 or a degenerate sequence thereof, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity with SEQ ID NO: 20 or 21.

[0147] In certain embodiments, the sterol methyltransferase comprises the amino acid sequence shown in SEQ ID NO:9 or the amino acid sequence of a homologous protein of SEQ ID NO:9, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:9 and retains the function of sterol methyltransferase.

[0148] In certain embodiments, the gene encoding sterol methyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 18 or a degenerate sequence thereof, or a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 18.

[0149] In certain embodiments, the starting strain of the recombinant Yarrowia lipolytica is Yarrowia lipolytica Po1f.

[0150] In certain embodiments, the introduction is carried out by integrating a donor DNA comprising a target gene and a gene selected from a resistance gene and a selection gene into the Yarrowia lipolytica genome through non-homologous end joining (NHEJ).

[0151] In certain embodiments, the resistance gene comprises a hygromycin gene.

[0152] In certain embodiments, the screening gene comprises the URA3 gene or the LEU2 gene.

[0153] In certain embodiments, the resistance gene or tag gene in the donor DNA comprises the same two LoxP sites (Lox71 and Lox66) in the front and back directions.

[0154] In certain embodiments, after the donor DNA is integrated into the Yarrowia lipolytica genome, the resistance gene or selection gene is recovered by transferring a Cre enzyme expression plasmid.

[0155] In certain embodiments, the promoters used in the expression cassette of the target gene include pTEFin, pGPD and 8UASEXP.

[0156] In certain embodiments, the terminators used in the expression cassette of the target gene are Txpr2 and Tlip2.

[0157] In certain embodiments, the recombinant Yarrowia lipolytica genome is inserted with the following DNA sequence or a combination of its fragments:

[0158] SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26.

[0159] In certain embodiments, the fragment is a sequence obtained by removing the resistance gene or the screening gene based on any one of SEQ ID NOs: 19-26.

[0160] In certain embodiments, the recombinant Yarrowia lipolytica of the present invention is shown in Table 1 below.

[0161] Table 1

[0162]

[0163]

[0164] In certain embodiments, the recombinant Yarrowia lipolytica is BOTA01026.

[0165] II. Fermentation production of zeaxanthin by recombinant Yarrowia lipolytica

[0166] The invention provides a method for producing zeaxanthin by fermentation using recombinant Yarrowia lipolytica. The method comprises the steps of preparing seed liquid and fermenting and culturing.

[0167] In certain embodiments, the initial culture medium formula for the fermentation is 30-50 g / L glucose, 6-10 g / L potassium dihydrogen phosphate, 4.15-8.15 g / L magnesium sulfate heptahydrate, 11-19 g / L ammonium sulfate, 3-7 mL / L TMS solution, and 2-4 mL / L vitamin solution.

[0168] In certain embodiments, the initial culture medium formula for the fermentation is 40 g / L glucose, 8 g / L potassium dihydrogen phosphate, 6.15 g / L magnesium sulfate heptahydrate, 15 g / L ammonium sulfate, 5 mL / L TMS solution, and 3 mL / L vitamin solution.

[0169] In certain embodiments, the inoculation amount of the seed solution is 5-15% v / v, preferably 10% v / v.

[0170] In certain embodiments, the fermentation culture is stirred at a speed of 600-1200 rpm.

[0171] In certain embodiments, the fermentation culture has an aeration ratio of 1.0-1.5 VVM.

[0172] In certain embodiments, the dissolved oxygen control of the fermentation culture is set at about 20%.

[0173] In certain embodiments, the pH of the fermentation culture is about 5.5. Preferably, aqueous ammonia controls the pH of the fermentation process. Preferably, the concentration of aqueous ammonia is about 25%.

[0174] In certain embodiments, the fermentation culture is at a temperature of about 30°C.

[0175] In certain embodiments, the carbon source in the initial culture medium is depleted and feeding is initiated.

[0176] In certain embodiments, the feed medium formula is: glucose 450-530 g / L, potassium dihydrogen phosphate 10.8-14.8 g / L, magnesium sulfate heptahydrate 7.8-11.8 g / L, ammonium sulfate 147.2-187.2 g / L, 4-6 mL / L TMS solution, and 2-4 mL / L vitamin solution.

[0177] In certain embodiments, the feed medium formula is: 490 g / L glucose, 12.8 g / L potassium dihydrogen phosphate, 9.8 g / L magnesium sulfate heptahydrate, 167.2 g / L ammonium sulfate, 5 mL / L TMS solution, and 3 mL / L vitamin solution.

[0178] In certain embodiments, a constant dissolved oxygen feeding control strategy is adopted during the fed-batch culture, and the dissolved oxygen control value is about 20%.

[0179] In certain embodiments, the fermentation is terminated after about 120 hours of fed-batch culture.

[0180] In certain embodiments, the formula of TMS solution in the initial culture medium and the feed culture medium is: 3.6-7.6 g / L of ferrous sulfate heptahydrate, 9.5-13.5 g / L of zinc sulfate heptahydrate, 0.44-0.84 g / L of copper sulfate, 0.3-0.7 g / L of manganese chloride tetrahydrate, 0.74-1.14 g / L of cobalt chloride hexahydrate, 3.6-7.6 g / L of calcium chloride dihydrate, 0.76-1.16 g / L of sodium molybdate dihydrate, and 140-180 mL / L of 0.3-0.7 MEDTA.

[0181] In certain embodiments, the formula of TMS solution in the initial culture medium and the feed culture medium is: 5.6 g / L ferrous sulfate heptahydrate, 11.5 g / L zinc sulfate heptahydrate, 0.64 g / L copper sulfate, 0.5 g / L manganese chloride tetrahydrate, 0.94 g / L cobalt chloride hexahydrate, 5.6 g / L calcium chloride dihydrate, 0.96 g / L sodium molybdate dihydrate, 160 mL / L 0.5 M EDTA.

[0182] In certain embodiments, the vitamin solution formula in the initial culture medium and the feed culture medium is: biotin 0.1-0.3 g / L, p-aminobenzoic acid 0.6-1.0 g / L, niacin 3-5 g / L, inositol 8-12 g / L, calcium pantothenate 3-5 g / L, pyridoxine hydrochloride 3-5 g / L, and thiamine hydrochloride 3-5 g / L.

[0183] In certain embodiments, the vitamin solution formula in the initial culture medium and the feed culture medium is: biotin 0.2 g / L, p-aminobenzoic acid 0.8 g / L, niacin 4 g / L, inositol 10 g / L, calcium pantothenate 4 g / L, pyridoxine hydrochloride 4 g / L, and thiamine hydrochloride 4 g / L.

[0184] III. Extraction and purification of zeaxanthin from fermentation broth

[0185] The invention provides a method for extracting zeaxanthin from microbial fermentation liquid or fermentation cells.

[0186] In certain embodiments, the microorganism includes but is not limited to Yarrowia lipolytica, and the microorganism may include any microorganism that can be used for zeaxanthin production. The fermentation broth of any microorganism that can be used for zeaxanthin production is suitable for the method of the present invention to extract zeaxanthin.

[0187] In certain embodiments, the recombinant Yarrowia lipolytica is as described in I.

[0188] In certain embodiments, the fermentation production method is as shown in II.

[0189] In certain embodiments, the method for extracting zeaxanthin from microbial fermentation broth comprises: 1) pre-treating the fermentation broth or fermentation cells to obtain a precipitate; 2) washing the precipitate and removing water from the washing; and 3) leaching the precipitate.

[0190] In certain embodiments, the pretreatment of the fermentation broth or fermentation cells in step 1) comprises cell disruption and centrifugation.

[0191] In certain embodiments, the cell disruption method includes mechanical method, chemical method, and enzymatic method.

[0192] In certain embodiments, the chemical method uses an acid, a base, or an organic solvent to disrupt the cells.

[0193] In certain embodiments, the mechanical method includes high pressure homogenization and grinding.

[0194] In certain embodiments, in step 1), a high-pressure homogenizer is used to disrupt the cells.

[0195] In certain embodiments, the homogenization pressure is 600-1200 bar.

[0196] In some embodiments, the homogenization pressure is 800-1000 bar, such as about 800 bar, about 900 bar,

[0197] bar, about 1000bar.

[0198] In certain embodiments, the homogenization temperature is 5-40°C.

[0199] In certain embodiments, the homogenization temperature is 5-30°C, such as about 5°C, 10°C, 15°C, 20°C, 30°C.

[0200] In certain embodiments, the homogenization is performed 1-4 times, for example, 1 time, 2 times, 3 times, or 4 times.

[0201] In certain embodiments, the relative centrifugal force of the centrifugation in step 1) is 3000-12000 rcf.

[0202] In some embodiments, the relative centrifugal force is 4000-10000 rcf, such as about 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000 rcf.

[0203] In certain embodiments, the centrifugation temperature of the centrifugation in step 1) is 0-25°C.

[0204] In certain embodiments, the centrifugation temperature is 20-25°C, such as 21°C, 22°C, 23°C, 24°C or 25°C.

[0205] In certain embodiments, the centrifugation time in step 1) is 2-40 min.

[0206] In certain embodiments, the centrifugation time is 5-20 min, for example, about 5 min, 6 min, 7 min, 8 min, 9 min, 10 min, 11 min, 12 min, 13 min, 14 min, 15 min, 16 min, 17 min, 18 min, 19 min or 20 min.

[0207] In certain embodiments, pure water is used for precipitate washing in step 2).

[0208] In certain embodiments, in step 2), 1 to 4 times the mass (W / W) of pure water is added to the precipitate obtained in step 1) for washing, and the washing water phase is removed by centrifugation.

[0209] In certain embodiments, the amount of pure water added is 2 to 3 times the mass (W / W) of Precipitation 1.

[0210] In certain embodiments, in step 2), an alcohol solvent is used for washing and removing water; preferably, the alcohol solvent is selected from one or more of acetonitrile, methanol, acetone, ethanol, and isopropanol; preferably, the alcohol solvent is acetonitrile.

[0211] In certain embodiments, in step 2), 1 to 4 times the weight (W / W) of an alcohol solvent is added to the precipitate after washing with pure water to wash and remove water, and the aqueous solution is removed by centrifugation.

[0212] In certain embodiments, the alcohol solvent is used in an amount of 2 to 3 times the weight (W / W) of the precipitate.

[0213] In certain embodiments, the washing and dewatering temperature is 10-80°C.

[0214] In certain embodiments, the washing and dewatering temperature is 10-60°C, for example, about 10°C, 15°C, 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, 50°C, 55°C or 60°C.

[0215] In certain embodiments, the extractant used for the leaching in step 3) is a low-carbon alcohol or ester; preferably, the extractant is ethylene dichloride.

[0216] In certain embodiments, the precipitate after washing and removing water is extracted 1 to 5 times using 1 to 10 times the weight (W / W) of the extractant.

[0217] In certain embodiments, the amount of the extractant used is 2-6 times the mass (W / W) of the precipitate 3, for example, about 2 times, 3 times, 4 times, 5 times or 6 times.

[0218] In certain embodiments, the extraction is performed 2-3 times.

[0219] In certain embodiments, the extraction vessel is a mechanically stirred tank.

[0220] In certain embodiments, the extraction time is 0.1-8 hours.

[0221] In certain embodiments, the extraction time is about 0.1, 0.5, 1, 2, 3, 4, 5, 6, 7 or 8 hours.

[0222] In certain embodiments, the extraction temperature is 0-80°C.

[0223] In certain embodiments, the extraction temperature is about 0°C, 10°C, 20°C, 30°C, 40°C, 50°C, 60°C, 70°C or 80°C.

[0224] In certain embodiments, the method for extracting zeaxanthin from a microbial fermentation broth further comprises: 4) a step of concentrating the extraction phase.

[0225] In certain embodiments, the extract is concentrated by evaporation.

[0226] In certain embodiments, the extract phase is concentrated by rotary evaporation.

[0227] In certain embodiments, the rotary evaporation temperature in step 4) is 0-60°C, for example, about 0°C, 10°C, 20°C, 30°C, 40°C, 50°C, 60°C.

[0228] In some embodiments, the rotary evaporation vacuum is 10-1000 mbar, for example, about 10, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 mbar.

[0229] In certain embodiments, the rotary evaporation temperature is 20-50°C, such as about 20°C, 25°C, 30°C, 35°C, 40°C, 45°C or 50°C.

[0230] In certain embodiments, the rotary evaporation vacuum is 20-60 mbar, such as about 20, 30, 40, 50 or 60 mbar.

[0231] In certain embodiments, the evaporation concentration container is a rotary evaporator.

[0232] In certain embodiments, the rotary evaporation operation is stopped when no more liquid drips out during the rotary evaporation.

[0233] In certain embodiments, the method for extracting zeaxanthin from a microbial fermentation broth further comprises: 5) a step of washing the concentrated slurry with a solvent.

[0234] In certain embodiments, the washing solvent in step 5) is selected from one or more of low-carbon hydrocarbons, alcohols, esters, and halogenated hydrocarbons; preferably, the washing solvent is ethanol.

[0235] In certain embodiments, in step 5), 1-50 times the mass (W / W) of a washing solvent is added to the concentrated slurry, the washing temperature is 0-100° C., and the washing time is 0.1-5.0 hours.

[0236] In certain embodiments, the amount of the washing solvent is 5-20 times that of the concentrated slurry, for example, about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 times.

[0237] In certain embodiments, the washing temperature is 30-60°C, such as about 30°C, 35°C, 40°C, 45°C, 50°C, 55°C or 60°C.

[0238] In certain embodiments, the washing time is 0.2-2.0 hours, such as about 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2.0 hours.

[0239] In certain embodiments, the method for extracting zeaxanthin from a microbial fermentation broth further comprises 6) filtering the concentrated slurry and optionally 7) drying the filter cake.

[0240] In certain embodiments, the concentrated slurry in step 6) is filtered to obtain a wet filter cake and a filtered mother liquor.

[0241] In certain embodiments, the step 7) further comprises washing the filter cake with hot ethanol before drying the filter cake.

[0242] In certain embodiments, in step 7), the filter cake is dried at a temperature of 30-100° C., a vacuum degree of 1-20 KPa, and a drying time of 12-24 hours.

[0243] In certain embodiments, the drying temperature of the filter cake is 30-60°C, such as about 30°C, 35°C, 40°C, 45°C, 50°C, 55°C or 60°C.

[0244] In some embodiments, the vacuum degree is 1-10 KPa, such as about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 KPa.

[0245] In certain embodiments, the drying time is 12-18 hours, such as about 12, 13, 14, 15, 16, 17 or 18 hours.

[0246] In certain embodiments, the filter cake drying container is a vacuum oven.

[0247] Example

[0248] The present invention will be more readily understood with reference to the following examples, which are included only to illustrate certain aspects and embodiments of the present invention and are not intended to limit the present invention.

[0249] Unless otherwise stated, the reagents used in this example are all commercially available materials or conventional materials.

[0250] Example 1 Construction of recombinant Yarrowia lipolytica producing zeaxanthin

[0251] 1.1 Starting strain

[0252] In the present embodiment, Yarrowia lipolytica Po1f was used as the starting strain, which was purchased from ATCC and numbered MAY-2613, and the genotype was MATA ura3-302leu2-270xpr-322axp2-deltaNU49XPR2::SUC2.

[0253] 1.2 Culture medium composition

[0254] Escherichia coli culture medium: LB-Amp culture medium, the formula is: peptone 10g, yeast extract 5g, NaCl 10g, deionized water 1L, add 100mg / L ampicillin (Amp) after sterilization; if it is a solid culture medium, add 2% (20g / L) agar powder.

[0255] Yarrowia lipolytica culture medium YPD medium: yeast extract 10g / L, peptone 20g / L, glucose 20g / L; if it is a solid culture medium, 2% (20g / L) agar powder should be added additionally.

[0256] Yarrowia lipolytica medium YPD-Hph: 500 mg / L hygromycin (Hph), 500 mg / L zeocin and 500 mg / L geneticin (G418) were additionally added to the sterile YPD medium.

[0257] Yarrowia lipolytica medium YPD-Nat: based on the sterile YPD medium, 1 g / L hygromycin (Hph), 1 g / L zeocin and 1 g / L geneticin (G418) were additionally added.

[0258] Yarrowia lipolytica culture medium SCD-Ura: yeast inorganic nitrogen source 1.7g / L, ammonium sulfate 5g / L, DOSuplement-Leu / -Trp / -Ura 0.62g / L, 0.1g / L L-leucine (Leu), 0.05g / L L-tryptophan (Trp), glucose 20g / L. If it is a solid culture medium, it is necessary to add 2% (20g / L) agar powder.

[0259] Yarrowia lipolytica culture medium SCD-Leu: yeast inorganic nitrogen source 1.7g / L, ammonium sulfate 5g / L, DOSuplement-Leu / -Trp / -Ura 0.62g / L, 0.02g / L uracil (Ura), 0.05g / L L-tryptophan (Trp), glucose 20g / L. If it is a solid culture medium, it is necessary to add 2% (20g / L) agar powder.

[0260] Yarrowia lipolytica medium BSM: 8g / L potassium dihydrogen phosphate, 7.5g / L ammonium sulfate, 6.15g / L magnesium sulfate heptahydrate, 3.4g / L urea, 3ml BSM vitamins, 5ml BSM metal elements, pH adjusted to 5.5 by adding NaOH or H2SO4. The BSM vitamin formula is: 0.2g / L biotin, 0.8g / L potassium p-aminobenzoate, 4g / L vitamin B3, 10g / L inositol, 4g / L vitamin B1, 4g / L vitamin B6, 4g / L calcium pantothenate. The BSM metal element formula is: 0.5M oxalic acid tetraacetic acid 160ml / L, zinc sulfate heptahydrate 11.5g / L, copper sulfate 0.64g / L, manganese chloride tetrahydrate 0.64g / L, cobalt chloride hexahydrate 0.94g / L, sodium molybdate dihydrate 0.96g / L, ferrous sulfate heptahydrate 5.6g / L, calcium chloride dihydrate 5.6g / L.

[0261] 1.3 Donor DNA construction method

[0262] The construction of donor DNA includes the following steps

[0263] 1) Construct a donor DNA template plasmid. Using pUC57 as the vector backbone, insert a resistance gene expression cassette or a screening gene expression cassette that can work in Yarrowia lipolytica (resistance genes include hygromycin gene hygromycin, screening genes include URA3 gene or LEU2 gene) and a target gene expression cassette that is expected to be integrated into the Yarrowia lipolytica genome using the Gibson method, and perform plasmid cloning and DNA amplification using Escherichia coli DH5α. The culture medium used is the Escherichia coli culture medium described in 1.2. The Gibson construction method is specifically as follows: first, amplify the backbone and the fragment to be inserted by the PCR method, and design primers so that the interface of the two DNA fragments to be connected has a 30-40bp homology region; then, these donor DNA fragments and the Gibson Master Mix (NEB) was mixed and incubated at 50°C for 60 minutes. T5 exonucleolysis will produce single-stranded 3' protruding ends, prompting the complementary terminal repeat sequences (overlapping regions) to anneal. Phusion polymerase will fill the gaps of the annealed fragments, and Taq DNA ligase can connect at the assembled DNA cuts. Finally, the incubated mixture was transferred into Escherichia coli to achieve plasmid DNA amplification. Lox71 and Lox66 sequences were introduced before and after the resistance gene or screening gene expression cassette, respectively, so that the resistance gene or screening gene can be recovered by transferring the Cre enzyme expression plasmid after the linear DNA is integrated into the genome. The promoters used in the target gene expression cassette include pTEFin (SEQ ID NO: 50), pGPD (SEQ ID NO: 51) and 8UASEXP (SEQ ID NO: 52). The terminators used in the target gene expression cassette are Txpr2 and Tlip2.

[0264] 2) Using the donor DNA template plasmid as a template, amplify the DNA fragment including the resistance gene or screening gene expression cassette and the target gene expression cassette by PCR (primers are shown in Table 3). The PCR reaction system used for amplification of the donor DNA fragment is: 50 μL reaction system contains 25 μL of Q5 DNA polymerase mix, 2.5 μL of upstream primer and downstream primer, 1 μL of template and 19 μL of ddH2O. The PCR cycle program is pre-denaturation at 98℃ for 2 minutes, denaturation at 98℃ for 10 seconds, annealing at 55℃ for 10 seconds, extension at 72℃ for 30 seconds / kb, 31 cycles; extension at 72℃ for 3 minutes, and storage at 4℃.

[0265] 3) The PCR product is purified by magnetic bead method, and the purified donor DNA can be directly transformed into Yarrowia lipolytica to achieve genome integration.

[0266] The donor DNA information in the present invention is shown in Table 2.

[0267] Table 2 Donor DNA information in the present invention

[0268]

[0269] All the DNAs in Table 2 are linear donor DNAs except DNA6336, which is a suicide plasmid that cannot replicate in yarrowia.

[0270] The primers used for amplification of the above donor DNA are shown in Table 3.

[0271] Table 3

[0272] Primer name SEQ ID NO Primer sequences hph_AF 27 aagtaccagctcccctcacttacc LIP_R 28 ccattcgatcgcatgctggtttc ADD_LEUF 29 aacaaccgattccaacaggttaccgt GSY_R 30 ctacgtttgcctcacatcgaactact ADD_R1 31 tcgcatctcgatgagctggc 18211-F 32 accgattccaaccagtgactttg 18211-R 33 gggacacaaatacgccgccaacccggtctgtatccacgacaaaaacatttgtc 17881_F 34 accagacaaatgtttttgtcgtggatacagaccgggttggcggcgtatttg 17881_R 35 attccaagttgctgcttgatggg

[0273] The integration information of donor DNA in the genome is shown in Table 4.

[0274] Table 4 Plasmid integration site information

[0275]

[0276] 1.4 Recovery of resistance or tag genes

[0277] The method for recovering the resistance or tag gene used in the present invention adopts the Cre-LoxP recombination system. After the recombinase plasmid (AP18860) driven by pTEFin to express Cre is transferred into Yarrowia lipolytica, the Cre recombinase can recognize the two LoxP sites (Lox 71 and Lox66) with the same front and back directions of the resistance or tag gene, thereby mediating the knockout of the gene between the two LoxP sites, and Lox71 and Lox66 will be retained on the genome as the Lox72 sequence after recombination. The AP18860 plasmid contains the pBR322 sequence and kanamycin resistance marker for replication in Escherichia coli, as well as the ORI1001 sequence and nourseothricin (Nat, nourseothricin) resistance marker for replication in Yarrowia lipolytica. The plasmid map is shown in Figure 1 shown.

[0278] 1.5 96-well plate fermentation method

[0279] 1) After yeast transformation, the transformants were inoculated into a 96-deep-well plate containing YPD medium and cultured in a shaker at 30°C and 800 rpm for 1 day.

[0280] 2) The obtained culture solution was subcultured into a new 96-deep-well plate containing fresh YPD or BSM medium and cultured in a shaker at 30°C and 800 rpm for 3 days.

[0281] 1.6 Extraction and detection methods of β-carotene and zeaxanthin in fermentation products

[0282] Take 20ul of bacterial solution, add 750μl of extraction solution (dimethyl sulfoxide: ethyl acetate: methanol = 1: 0.5: 1), shake at 2000rpm for 20 minutes, ultrasonic at 25℃ for 10 minutes, shake at 30℃ at 1500rpm for 60 minutes, then centrifuge at 25℃ at 4000rpm for 20 minutes, and take the supernatant for ultra-high performance liquid chromatography detection. The detection conditions are as follows:

[0283] 1) Chromatographic column: CHIRALPAK AD-H LC column 4.6mm*250 5μm;

[0284] 2) Mobile phase: A1: isopropanol B1: n-hexane;

[0285] 3) Injection volume: 2.5ul;

[0286] 4) Seal wash: 10% isopropyl alcohol;

[0287] 5) Needle wash: methanol: ethyl acetate = 1:1;

[0288] 6) Column temperature: 30°C;

[0289] 7) Flow rate: 0.7 ml / min;

[0290] 8) Gradient elution

[0291] The conditions are shown in Table 5;

[0292] Table 5: Gradient elution conditions

[0293] Time / min A / ％ B / ％ Flow rate / (ml / min) 0 5.5 94.5 0.7 10 5.5 94.5 0.7 40 15 85 0.7 41 5.5 94.5 0.7 45 5.5 94.5 0.7

[0294] 9) Running time: 45min;

[0295] 10) Wavelength: 452nm.

[0296] By comparing the peak areas of zeaxanthin and β-carotene in the test object in liquid chromatography with the peak areas of the standard, the concentration can be calculated, which is expressed in mg / L in this patent.

[0297] Relative zeaxanthin titer calculation: average zeaxanthin concentration of target strain / average zeaxanthin concentration of starting strain. In this article, concentration and titer refer to the mass of the target substance per unit volume. In this article, the starting strain refers to the chassis strain that demonstrates the technical solution.

[0298] Calculation of zeaxanthin percentage (zeaxanthin%): (zeaxanthin concentration) / (zeaxanthin concentration+β-carotene concentration)×100%.

[0299] 1.7 BOTA01026 recombinant Yarrowia

[0300] The wild-type strain Po1f (ATCC number MAY-2613) was used as the starting strain, and the plasmid DNA6336 (SEQ ID NO: 19) expressing the complete β-carotene pathway genes (CarB / CarRP / CrtE) was introduced to obtain the β-carotene production starting strain BOTA01023. The DNA6336 plasmid map is shown in Figure 2 DNA6336 is a circular plasmid with only the pBR322 sequence for replication in E. coli. After sequencing the whole genome of BOTA01023, it was found that the plasmid was successfully integrated into the site Locus 1 500bp upstream and downstream.

[0301] Subsequently, based on the BOTA01023 strain, the CarB gene expression was introduced into the genome. The linear donor DNA ADD5278 (SEQ ID NO: 20) carrying the CarB gene was transformed into the strain BOTA01023 to obtain the strain BOTA01025. ADD5278 was amplified by the SOE (Gene splicing by overlap extension, overlap extension PCR technology, https: / / doi.org / 10.1038 / nprot.2007.132) method. First, the LEU2 expression cassette was amplified using primers 18211-F and 18211-R, and then the CarB expression cassette was amplified using primers 17881-F and 17881-R. Subsequently, the two fragments were overlapped and spliced ​​using primers 18211-F and 17881-R using these two fragments as templates. After verification by whole genome sequencing, the integration site of the linear donor DNA ADD5278 was Locus 2.

[0302] Subsequently, based on the BOTA01025 strain, the DGA1 gene expression was introduced into the genome. First, the above-mentioned tag gene recovery method was used to obtain a tag gene recovery strain, and then the linear donor DNA ADD6303 (SEQ ID NO: 21) with the DGA1 gene was transformed into the strain BOTA01025, and DGA1 was overexpressed to obtain the strain BOTA01027. The amplification primers of ADD6306 are ADD_LEUF and GSY_R. After verification by whole genome sequencing, the integration site of the linear donor DNA ADD6306 is Locus3.

[0303] Subsequently, based on the BOTA01027 strain, tHMGR gene expression was introduced into the genome. First, the above-mentioned tag gene recovery method was used to obtain a tag gene recovery strain, and then the linear donor DNA ADD5976 (SEQ ID NO: 22) was transformed into the strain BOTA01027 to overexpress tHMGR to obtain the strain BOTA01017 ( Figure 3 ). The amplification primers of ADD5976 are ADD_LEUF and GSY_R. After whole genome sequencing verification, the integration site of the linear donor DNA ADD5976 is Locus4, and two copies of tHMGR (ADD5976) were found to be integrated at the Locus 4 site, which is due to the NHEJ integration method used.

[0304] Using BOTA01017 as the base strain, CrtZ_9GAMM (transformation linear donor DNA ADD6957, SEQ ID NO: 23) was introduced into the genome to obtain strain BOTA01018, which successfully achieved the conversion of β-carotene to zeaxanthin with a yield of 107 mg / L ( Figure 4 ). The PCR amplification primers for linear donor DNA ADD6957 were hph_AF and LIP_R. After verification by whole genome sequencing, the genomic insertion site of ADD6975 was Locus 5.

[0305] In BOTA01018, after obtaining a strain with recovered tagged genes using the above-mentioned tag gene recovery method, CrtE and ERG19 were simultaneously overexpressed in the genome (converted linear donor DNA ADD7684, SEQ ID NO: 24) to obtain strain BOTA01021. The strain was tested using a 96-well plate fermentation method, and the yield of zeaxanthin was further increased to 210 mg / L. Compared with BOTA01018, the yield of zeaxanthin was increased by 96% ( Figure 4 ), where the amplification primers for the linear donor DNA ADD7684 were ADD_LEUF and GSY_R. After verification by whole genome sequencing, the genomic insertion site of ADD7684 was Locus 6.

[0306] In BOTA01021, after obtaining a strain with recovered tag genes using the above-mentioned tag gene recovery method, the linear donor DNA ADD7670 (SEQ ID NO: 25) with codon-optimized version 2 of CrtZ_SACS2 was transformed into BOTA01021 to obtain strain BOTA01019. The amplification primers of ADD7670 were ADD_LEUF and GSY_R. After verification by whole genome sequencing, the genomic insertion site of ADD7670 was Locus 7. The strain BOTA01019 was tested using a 96-well plate fermentation method, and the yield of zeaxanthin was increased by 152% compared with BOTA01021 ( Figure 5 ).

[0307] In BOTA01019, after obtaining a strain with recovered tagged genes using the above-mentioned tag gene recovery method, the linear donor DNA ADD9423 (SEQ ID NO: 26) was transformed into BOTA01019 to obtain strain BOTA01026. This design contains CrtZ_SACS2 and ERG6 connected by a flexible linker sequence APGRY (SEQ ID NO: 53). The amplification primers of ADD9423 are ADD_LEUF and ADD_R1. The results of the 96-well plate fermentation test showed that the fusion-expressed CrtZ can significantly increase the proportion of zeaxanthin in carotenoids. Using BOTA01019 as the chassis, after overexpressing CrtZ fused with ERG6, the proportion of zeaxanthin in BOTA01026 was 81%, which was 39% higher than that of BOTA01019 ( Figure 6 ).

[0308] Example 2 Preparation of fermentation broth

[0309] 2.1 First level 500ml shake bottle fermentation

[0310] Culture medium: YPD medium. Filling volume is 20%, inoculation volume is 1% v / v, shaker speed is 200 rpm (26 mm amplitude), culture at 30°C for 24-28 hours.

[0311] 2.2 Fermentation and conversion of zeaxanthin in 3L fermenter

[0312] The formula of the initial fermentation medium is: glucose 40g / L, potassium dihydrogen phosphate 8g / L, magnesium sulfate heptahydrate 6.15g / L, ammonium sulfate 15g / L, TMS solution 5mL / L, vitamin solution 3mL / L. The inoculation amount is 10% (v / v), the stirring speed is 600-1200rpm, the ventilation ratio is 1.0-1.5VVM, and the dissolved oxygen control is set to 20%. The pH of the fermentation process is controlled at 5.5 with 25% ammonia water. At 30°C, the carbon source in the initial culture medium is exhausted after 24-28 hours of cultivation, and feeding begins. The formula of the feed medium is: glucose 490g / L, potassium dihydrogen phosphate 12.8g / L, magnesium sulfate heptahydrate 9.8g / L, ammonium sulfate 167.2g / L, TMS solution 5mL / L, vitamin solution 3mL / L. During the fed-batch culture, a constant dissolved oxygen feeding control strategy is adopted, and the dissolved oxygen control value is 20%. The fermentation is terminated after 120 hours of fed-batch culture.

[0313] TMS solution formula: ferrous sulfate heptahydrate 5.6g / L, zinc sulfate heptahydrate 11.5g / L, copper sulfate 0.64g / L, manganese chloride tetrahydrate 0.5g / L, cobalt chloride hexahydrate 0.94g / L, calcium chloride dihydrate 5.6g / L, sodium molybdate dihydrate 0.96g / L, 0.5M EDTA 160mL / L.

[0314] Vitamin solution formula: biotin 0.2g / L, p-aminobenzoic acid 0.8g / L, niacin 4g / L, inositol 10g / L, calcium pantothenate 4g / L, pyridoxine hydrochloride 4g / L, thiamine hydrochloride 4g / L.

[0315] Example 3 Fermentation Broth Purification

[0316] Experimental example

[0317] The fermentation liquid was harvested 1917g (containing 2892mg zeaxanthin, the spectrum is as follows Figure 7 The homogenization temperature was controlled below 30°C, and the mixture was homogenized three times at 800 bar. 1908 g of the crushed liquid was obtained (containing 2888 mg of zeaxanthin, as shown in the spectrum). Figure 8 As shown); centrifuge at 8000rcf for 10 min at room temperature to harvest 1213g of wet bacteria; add 1213g of purified water to the bacteria, centrifuge at 8000rcf for 10 min at room temperature to harvest 1730g of aqueous phase (containing 3mg of zeaxanthin, as shown in the spectrum Fig. 9 693 g of acetonitrile was added to the centrifuged solid phase, and the mixture was centrifuged at 8000 rcf for 10 min at room temperature to obtain 782 g of aqueous phase (containing 23 mg of zeaxanthin, as shown in the spectrum). Fig.10 ), centrifuged solid phase 398g; used 6 times the mass of dichloroethane (2388g), extracted at 25°C for 2 hours three times, and harvested a total of 2702g of extract (containing 2406mg of zeaxanthin, the spectrum is shown in Fig.11 As shown), the remaining residue is 81g (containing 202mg zeaxanthin, the spectrum is as shown Fig.12 The extract was concentrated at 30°C and 60 mbar until no liquid was distilled out to obtain 66 g of concentrated slurry; 1320 g of ethanol was added to the concentrate and stirred at 50°C for 0.5 hours; the concentrated slurry was filtered and the filter cake was washed with hot ethanol to obtain a mother liquor (containing 146 mg of zeaxanthin, as shown in the spectrum Fig.13 The wet cake was placed in a 60°C oven, the vacuum was set to 2KPa, and after drying for 18 hours, 2452 mg of reddish brown solid powder (containing 2255 mg of zeaxanthin, as shown in the spectrum) was obtained. Fig.14 As shown), the purity of zeaxanthin was 92% and the downstream purification yield was 78%.

[0318] Comparative Example 1

[0319] 1000g of fermentation liquid (containing 1872mg of zeaxanthin) was harvested, the homogenization temperature was controlled below 30°C, high-pressure homogenization was performed three times at 800bar, and 995g of crushed liquid (containing 1866mg of zeaxanthin) was harvested; 376g of wet bacteria were harvested after centrifugation at 8000rcf for 10min at room temperature; 376g of purified water was added to the bacteria, and the mixture was centrifuged at 8000rcf for 10min at room temperature to harvest 472g of aqueous phase (containing 1mg of zeaxanthin) and 277g of centrifuged solid phase; 554g of methanol was added to the centrifuged solid phase, and the mixture was centrifuged at 8000rcf for 10min at room temperature to harvest 622g of light phase (containing 7mg of zeaxanthin) and 202g of centrifuged solid phase; 6 times the mass of dichloroethane (1212g) was used, The extraction was carried out at 25°C for 2 hours in three times, and a total of 1315g of extract (containing 1684mg of zeaxanthin) and 34g of raffinate (containing 45mg of zeaxanthin) were harvested in three times; the extract was concentrated at 30°C and 60mbar until no liquid was distilled out to obtain 21g of concentrated slurry; 420g of ethanol was added to the concentrate, and stirred at 50°C for 0.5 hour; the concentrated slurry was filtered, and the filter cake was washed with hot ethanol to obtain a mother liquor (containing 24mg of zeaxanthin); the wet filter cake was placed in a 60°C oven, the vacuum degree was set to 2KPa, and after drying for 18 hours, 1982mg of reddish-brown solid powder (containing 1348mg of zeaxanthin) was obtained, the purity of zeaxanthin was 68%, and the downstream purification yield was 72%.

[0320] Comparative Example 2

[0321] 1000 g of fermentation liquid (containing 1785 mg of zeaxanthin) was harvested, the homogenization temperature was controlled below 30°C, and high-pressure homogenization was performed three times at 800 bar to harvest 992 g of broken liquid (containing 1782 mg of zeaxanthin); centrifugation was performed at 8000 rcf for 10 min at room temperature to harvest 412 g of wet bacteria; 412 g of purified water was added to the bacteria, and the mixture was centrifuged at 8000 rcf for 10 min at room temperature to harvest 508 g of aqueous phase (containing 1 mg of zeaxanthin) and 309 g of centrifuged solid phase; 618 g of methanol was added to the centrifuged solid phase, and the mixture was centrifuged at 8000 rcf for 10 min at room temperature to harvest 713 g of light phase (containing 6 mg of zeaxanthin) and 212 g of centrifuged solid phase; 6 times the mass spectrometry was used. The mixture was added with 1272 g of dichloroethane, and extracted at 25°C for 2 hours in three times, yielding a total of 1439 g of extract (containing 1624 mg of zeaxanthin) and 42 g of raffinate (containing 56 mg of zeaxanthin) in three times; the extract was concentrated at 30°C and 60 mbar until no liquid was distilled out to obtain 21 g of concentrated slurry; the concentrated slurry was filtered, and the filter cake was washed with dichloroethane to obtain a mother liquor (containing 21 mg of zeaxanthin); the wet filter cake was placed in a 60°C oven, the vacuum degree was set to 2 KPa, and after drying for 18 hours, 2893 mg of a reddish-brown solid powder (containing 1302 mg of zeaxanthin) was obtained, the zeaxanthin purity was 45%, and the downstream purification yield was 73%.

[0322] Comparative Example 3

[0323] 1000 g of fermentation liquid (containing 1862 mg of zeaxanthin) was harvested, the homogenization temperature was controlled below 30°C, and high-pressure homogenization was performed three times at 800 bar to harvest 988 g of broken liquid (containing 1855 mg of zeaxanthin); centrifugation was performed at 8000 rcf for 10 min at room temperature to harvest 408 g of wet bacteria; 408 g of purified water was added to the bacteria, and the mixture was centrifuged at 8000 rcf for 10 min at room temperature to harvest 522 g of aqueous phase (containing 3 mg of zeaxanthin) and 288 g of centrifuged solid phase; 576 g of methanol was added to the centrifuged solid phase, and the mixture was centrifuged at 8000 rcf for 10 min at room temperature to harvest 682 g of light phase (containing 8 mg of zeaxanthin) and 177 g of centrifuged solid phase; 6 times The mass of isopropanol (1062g) was extracted at 25°C for 2 hours in 3 times, and a total of 1170g of extract (containing 1135mg of zeaxanthin) and 62g of raffinate (containing 596mg of zeaxanthin) were harvested in 3 times; the extract was concentrated at 30°C and 60mbar until no liquid was distilled out to obtain 32g of concentrated slurry; the concentrated slurry was filtered, and the filter cake was washed with isopropanol to obtain a mother liquor (containing 36mg of zeaxanthin); the wet filter cake was placed in a 60°C oven, the vacuum degree was set to 2KPa, and after drying for 18 hours, 1817mg of reddish-brown solid powder (containing 763mg of zeaxanthin) was obtained, the purity of zeaxanthin was 42%, and the downstream purification yield was 41%.

[0324] Comparative Example 4

[0325] The fermentation liquid was harvested 1000g (containing 1735mg zeaxanthin), the homogenization temperature was controlled to be lower than 30°C, and the high pressure homogenization was performed three times at 800bar to harvest 991g of the crushed liquid (containing 1733mg zeaxanthin); the mixture was centrifuged at 8000rcf for 10min at room temperature to harvest 378g of wet cells; 378g of purified water was added to the cells, and the mixture was centrifuged at 8000rcf for 10min at room temperature to harvest 445g of the aqueous phase (containing 2mg zeaxanthin) and 306g of the centrifuged solid phase; 6 times the mass of dichloroethane (1836g) was used, and the mixture was extracted at 25°C for 2 hours in 3 times, and a total of 1967g of the extract (containing 734mg zeaxanthin) was harvested in 3 times, and the residual residue was 100g. 162g of residue (containing 876mg of zeaxanthin); the extract was concentrated at 30°C and 60mbar until no liquid was distilled out to obtain 18g of concentrated slurry; 360g of ethanol was added to the concentrate and stirred at 50°C for 0.5 hour; the concentrated slurry was filtered and the filter cake was washed with hot ethanol to obtain a mother liquor (containing 34mg of zeaxanthin); the concentrated slurry was filtered and the filter cake was washed with hot ethanol to obtain a mother liquor (containing 36mg of zeaxanthin); the wet filter cake was placed in a 60°C oven and the vacuum degree was set to 2KPa. After drying for 18 hours, 979mg of reddish-brown solid powder (containing 617mg of zeaxanthin) was obtained, the purity of zeaxanthin was 63%, and the downstream purification yield was 36%.

Claims

1. A method for extracting zeaxanthin from microbial fermentation broth or fermentation cells, characterized in that: The method comprises: 1) pre-treating fermentation liquid or fermentation cells to obtain precipitate; 2) washing the precipitate and removing water from the washing; and 3) the steps of precipitation and leaching.

2. The method according to claim 1, wherein pure water is used for precipitate washing in step 2).

3. The method according to claim 1 or 2, wherein in step 2), an alcohol solvent is used for washing and removing water; preferably, the alcohol solvent is selected from one or more of acetonitrile, methanol, acetone, ethanol, and isopropanol; preferably, the alcohol solvent is acetonitrile.

4. The method according to any one of claims 1 to 3, wherein the extractant used for the leaching in step 3) is a low-carbon alcohol or ester; preferably, the extractant is ethylene dichloride.

5. The method according to any one of claims 1 to 4, wherein the method further comprises: 4) The step of concentrating the extract phase.

6. The method according to any one of claims 1 to 5, wherein the method further comprises the step of 5) washing impurities with a concentrated slurry solvent.

7. The method according to any one of claims 1 to 6, wherein the solvent for washing the impurities in step 5) is selected from one or more of low-carbon hydrocarbons, alcohols, esters, and halogenated hydrocarbons; preferably, the solvent for washing the impurities is ethanol.

8. The method according to any one of claims 1 to 7, wherein the method further comprises: 6) filtering the concentrated slurry by suction and optionally 7) drying the filter cake.

9. The method according to any one of claims 1 to 8, wherein the step 7) further comprises washing the filter cake with hot ethanol before drying the filter cake.

10. The method according to any one of claims 1-9, wherein the pretreatment of the fermentation broth or fermentation cells in step 1) comprises cell disruption and centrifugation; preferably, a high-pressure homogenizer is used for cell disruption; preferably, the homogenization pressure is 600-1200 bar and the homogenization temperature is 5-40°C.

11. The method according to claim 10, wherein the relative centrifugal force of the centrifugation is 3000-12000 rcf, the centrifugation temperature is 0-25°C, and the centrifugation time is 2-40 min.

12. The method according to any one of claims 1 to 11, wherein in step 2), 1 to 4 times the mass (W / W) of pure water is added to the precipitate obtained in step 1) for washing, and the washing water phase is removed by centrifugation.

13. The method according to any one of claims 1 to 12, wherein in step 2), 1 to 4 times the mass (W / W) of an alcohol solvent is added to the precipitate after washing with pure water to wash and remove water, and the aqueous solution is removed by centrifugation; preferably, the washing and dehydration temperature is 10-80°C.

14. The method according to any one of claims 1 to 13, wherein in step 3), the precipitate after washing and dehydration is extracted 1 to 5 times using 1 to 10 times the mass (W / W) of the extractant; preferably, the extraction temperature is 0 to 80°C; preferably, the extraction time is 0.1 to 8 hours.

15. The method according to any one of claims 1-14, wherein in step 4), the extract phase is concentrated by evaporation; preferably, the extract phase is concentrated by rotary evaporation; preferably, the rotary evaporation temperature is 0-60°C, and the rotary evaporation vacuum is 10-1000mbar.

16. The method according to any one of claims 1 to 15, wherein in step 5), 1 to 50 times the mass (W / W) of a washing solvent is added to the concentrated slurry, the washing temperature is 0 to 100°C, and the washing time is 0.1 to 5.0 hours; preferably, the amount of the washing solvent is 5 to 20 times that of the concentrated slurry.

17. The method according to any one of claims 1 to 15, wherein the filter cake is dried at a temperature of 30-100°C, a vacuum degree of 1-20 KPa, and a drying time of 12-24 hours in step 7).

18. The method according to any one of claims 1 to 17, wherein the microorganism is Yarrowia lipolytica; preferably, the Yarrowia lipolytica is a recombinant Yarrowia lipolytica.

19. The method of claim 18, wherein the recombinant Yarrowia lipolytica comprises introduced genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase or a truncate thereof (tHMGR), β-carotene hydroxylase from Pantoea stewartii (CrtZ-9GAMM), mevalonate-5-pyrophosphate decarboxylase (ERG19), and 1,2-dihydro-3-methylglutaryl-CoA reductase (DGA1). solfataricus) and the genes of β-carotene hydroxylase (CrtZ_SACS2) and β-carotene hydroxylase CrtZ_SACS2-ERG6 fusion protein; preferably, the copy number of the gene encoding phytoene dehydrogenase introduced is 2; preferably, the copy number of the gene encoding geranylgeranyl diphosphate synthase introduced is 2; preferably, the recombinant Yarrowia lipolytica genome is inserted with a combination of the following DNA sequences or fragments thereof: SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26; preferably, the starting strain for the construction of the recombinant Yarrowia lipolytica is Polf.

20. The method according to claim 19, wherein the fragment is a sequence obtained by removing a resistance gene or a screening gene based on any one of SEQ ID NOs: 26-32, 35.

21. The zeaxanthin product obtained by extraction according to any one of claims 1 to 20; preferably, the purity of the product is >90%.

Images