Cotton fiber length related GhTTL gene and molecular marker and application thereof

Abstract

The invention provides a cotton fiber length related GhTTL gene and a molecular marker and application thereof, and relates to the technical field of biology, the gene is subjected to genetic transformation, the GhTTL gene is overexpressed, and fiber data of cotton institute 49 (ZM49) in a wild type control group is subjected to statistical comparison to find that the GhTTL protein can promote the elongation of cotton fibers, and the amino acid sequence of the GhTTL protein is shown as SEQ ID NO.1. KASP genetic typing is carried out on SNP sites in a promoter region of a fiber development related gene GhTTL in cotton, the molecular marker capable of identifying cotton seeds with dominant fibers is developed, directional breeding of a large batch of cotton varieties can be assisted, cotton seeds with the dominant sites are obtained, the molecular marker serves as a reliable screening standard, and the screening method has the advantages that the screening efficiency is high, and the screening cost is low. And the breeding and seed selection efficiency and precision are improved.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a cotton fiber length-related GhTTL gene and a molecular marker and application thereof. Background Art

[0002] Single nucleotide polymorphism (SNP) refers to the variation of a single nucleotide in the genome, including substitution, transversion, deletion and insertion. In the agricultural field, it can be used for fine positioning of trait genes, molecular-assisted breeding, seed resource identification, etc. In the medical field, it can be used for molecular genetic mechanism research of diseases, disease gene positioning, drug sensitivity or disease susceptibility site screening, etc.

[0003] For SNP genotyping, KASP technology has quickly captured the market with its high flexibility, accuracy and cost-effectiveness since its launch. KASP refers to competitive allele-specific PCR, which can accurately perform biallelic typing of target SNPs and InDels at specific sites on a wide range of genomic DNA samples, including complex genomic DNA samples.

[0004] KASP technology does not require the synthesis of specific fluorescent primers for each SNP site. It is based on its own unique ARM PCR principle, allowing all site detections to be amplified using universal fluorescent primers. This greatly reduces the reagent cost of LGC KASP, and has both high accuracy and low usage costs. It also has better site adaptability than Taqman, and the results obtained are simpler and faster to analyze. Therefore, LGC KASP has very good applications in medical and agricultural testing.

[0005] In view of this, the present invention is proposed. Summary of the invention

[0006] One of the purposes of the present invention is to provide a protein, to propose for the first time the GhTTL gene related to cotton fiber development, and to develop KASP molecular markers in the promoter region of the GhTTL gene, to provide a gene related to cotton fiber development and suitable for the development of KASP molecular markers, and to provide a new idea for the fine positioning of identification or auxiliary identification of cotton fiber traits.

[0007] A second object of the present invention is to provide a nucleic acid molecule encoding the above-mentioned protein.

[0008] The third object of the present invention is to provide the use of the above-mentioned protein or the above-mentioned nucleic acid molecule in increasing the length and / or yield of cotton fibers or cultivating long-fiber and / or high-yield cotton.

[0009] A fourth object of the present invention is to provide a substance for detecting the SNP site in the above nucleic acid molecule for use in identifying or assisting in identifying cotton fiber length or cotton breeding.

[0010] The fifth object of the present invention is to provide the above-mentioned primer set for amplifying SNP sites; or the above-mentioned PCR reagent containing the primer pair; or any substance in the above-mentioned kit containing the primer pair or the PCR reagent.

[0011] A sixth object of the present invention is to provide a method for identifying or assisting in identifying the length of cotton fibers.

[0012] A seventh object of the present invention is to provide a method for breeding long-fiber cotton.

[0013] In order to achieve the above-mentioned purpose of the present invention, the following technical solutions are particularly adopted:

[0014] In a first aspect, the present invention provides a protein, the amino acid sequence of the protein is shown as SEQ ID NO.1.

[0015] In a second aspect, the present invention provides a nucleic acid molecule encoding the above-mentioned protein;

[0016] Preferably, the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO.2.

[0017] In a third aspect, the present invention provides the use of the above-mentioned protein or the above-mentioned nucleic acid molecule in increasing the length and / or yield of cotton fibers or cultivating long-fiber and / or high-yield cotton.

[0018] In a fourth aspect, the present invention provides the use of a substance for detecting SNP sites in the above-mentioned nucleic acid molecules in identifying or assisting in identifying cotton fiber length or cotton breeding, wherein the SNP sites include one or more of SNP sites Chr10-14335026, SNP sites Chr10-14334971, SNP sites Chr10-14334710 or Chr10-14333695.

[0019] Further, the SNP site Chr10-14335026 is an A / G mutation;

[0020] The SNP site Chr10-14334971 is a C / T mutation;

[0021] The SNP site Chr10-14334710 is a C / T mutation;

[0022] The SNP site Chr10-14333695 is a C / A mutation.

[0023] Furthermore, the material for detecting the SNP site in the nucleic acid molecule of claim 2 includes a primer set for amplifying the SNP site, a PCR reagent containing the primer pair, or a kit containing the primer pair or the PCR reagent.

[0024] Further, the primer set includes one or more of primer set 1, primer set 2, primer set 3 or primer set 4;

[0025] The nucleotide sequences of the primer set 1 are shown in SEQ ID NO.3 to SEQ ID NO.5 respectively;

[0026] The nucleotide sequences of the primer set 2 are shown in SEQ ID NO.6 to SEQ ID NO.8 respectively;

[0027] The nucleotide sequences of the primer set 3 are shown in SEQ ID NO.9 to SEQ ID NO.11 respectively;

[0028] The nucleotide sequences of the primer set 4 are shown in SEQ ID NO.12 to SEQ ID NO.14 respectively.

[0029] In a fifth aspect, the present invention provides any of the following substances:

[0030] The above-mentioned primer set for amplifying the SNP site;

[0031] or, the above-mentioned PCR reagent containing the primer pair;

[0032] Or, the above-mentioned kit containing the primer pair or the PCR reagent.

[0033] In a sixth aspect, the present invention provides a method for identifying or assisting in identifying cotton fiber length, comprising detecting the genotype of the SNP site in the above nucleic acid molecule in the cotton to be tested;

[0034] The fiber length of the cotton to be tested whose genotype is TT at the SNP site Chr10-14335026 is greater than or is a candidate greater than the cotton to be tested whose genotype is CC at the SNP site Chr10-14335026;

[0035] Or, the fiber length of the cotton to be tested whose genotype is GG at the SNP site Chr10-14334971 is greater than or is candidate greater than that of the cotton to be tested whose genotype is AA at the SNP site Chr10-14334971;

[0036] Or, the fiber length of the cotton to be tested whose genotype is GG at the SNP site Chr10-14334710 is greater than or is candidate greater than that of the cotton to be tested whose genotype is AA at the SNP site Chr10-14334710;

[0037] Or, the fiber length of the cotton to be tested whose genotype at the SNP site Chr10-14333695 is GG is greater than or may be greater than that of the cotton to be tested whose genotype at the SNP site Chr10-14333695 is CC.

[0038] In a seventh aspect, the present invention provides a method for breeding long-fiber cotton, comprising detecting the genotype of the SNP site in the nucleic acid molecule of claim 2 in cotton;

[0039] Select cotton with the genotype of SNP site Chr10-14335026 as TT for breeding to obtain target cotton;

[0040] Or, selecting cotton with a genotype of GG at the SNP site Chr10-14334971 for breeding to obtain target cotton;

[0041] Or, selecting cotton with a genotype of GG at the SNP site Chr10-14334710 for breeding to obtain target cotton;

[0042] Alternatively, cotton with a genotype of GG at the SNP site Chr10-14333695 is selected for breeding to obtain the target cotton.

[0043] The protein provided by the present invention is genetically transformed to construct vectors of GhTTL-WMV067 and GhTTL-016, and the GhTTL gene is overexpressed by using the Agrobacterium-mediated cotton genetic transformation method. The fiber data of the wild-type control group Zhongmian 49 (ZM49) are statistically compared to find that the GhTTL protein can promote the elongation of cotton fibers, and its amino acid sequence is shown in SEQ ID NO. 1. Another aspect of the present invention also provides the use of a substance for detecting the SNP site in the above nucleic acid molecule in identifying or assisting in identifying cotton fiber length or cotton breeding, and performing KASP gene typing on the SNP site in the promoter region of the fiber development-related gene GhTTL in cotton, and developing a molecular marker that can identify cotton varieties with superior fibers, which can assist in the directional breeding of large quantities of cotton varieties, and obtain cotton varieties with the superior sites, as a reliable screening standard, to improve the efficiency and accuracy of breeding and seed selection. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0045] Figure 1 A comparison chart of the fiber length phenotypes of ZM49 and GhTTL-OE provided in Example 1 of the present invention;

[0046] Figure 2 A comparison of the fiber phenotypes of the CRISPR / Cas9-mediated GhTTL gene editing line and ZM49 provided in Example 1 of the present invention;

[0047] Figure 3 This is an analysis diagram of the effect of SNP variation in the promoter region provided in Example 2 of the present invention on the expression level of the GhTTL gene;

[0048] Figure 4 This is a schematic diagram of KASP analysis marker typing of different samples provided in Example 4 of the present invention. DETAILED DESCRIPTION

[0049] Unless otherwise defined herein, scientific and technical terms used in conjunction with the present invention shall have the meanings commonly understood by those of ordinary skill in the art. The meaning and scope of the terms should be clear, however, in the case of any potential ambiguity, the definitions provided herein take precedence over any dictionary or external definitions. In this application, unless otherwise stated, the use of "or" means "and / or". In addition, the use of the term "including" and other forms is non-limiting.

[0050] The methods and techniques of the present invention are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated.

[0051] In one aspect, the present invention provides a protein, the amino acid sequence of the protein is shown in SEQ ID NO.1.

[0052] In this study, the GhTTL gene was discovered. The vectors of GhTTL-WMV067 and GhTTL-016 were constructed by genetic transformation of the gene. The GhTTL gene was overexpressed using Agrobacterium-mediated cotton genetic transformation. Statistical comparison of fiber data with that of the wild-type control group, Zhongmian 49 (ZM49), showed that GhTTL protein can promote the elongation of cotton fibers. Its amino acid sequence is shown in SEQ ID NO.1.

[0053] According to another aspect of the present invention, a nucleic acid molecule encoding the above protein is also provided.

[0054] Nucleic acid molecules refer to polymeric forms of nucleotides of any length, including ribonucleotides and / or deoxyribonucleic acids. Examples of nucleic acid molecules include, but are not limited to, single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural or derived nucleotide bases.

[0055] In some specific embodiments, the nucleotide sequence of the nucleic acid molecule is shown as SEQ ID NO.2.

[0056] According to another aspect of the present invention, there is also provided the use of the above protein or the above nucleic acid molecule in increasing cotton fiber length and / or yield or cultivating long-fiber and / or high-yield cotton.

[0057] According to another aspect of the present invention, there is also provided an application of a substance for detecting SNP sites in the above-mentioned nucleic acid molecules in identifying or assisting in identifying cotton fiber length or cotton breeding, wherein the SNP sites include one or more of SNP sites Chr10-14335026, SNP sites Chr10-14334971, SNP sites Chr10-14334710 or Chr10-14333695.

[0058] KASP genotyping was performed on the SNP sites in the promoter region of the fiber development-related gene GhTTL in cotton, and molecular markers that can identify cotton varieties with superior fibers were developed. This can assist in the targeted breeding of large quantities of cotton varieties and obtain cotton varieties with this superior site. It can serve as a reliable screening standard and improve the efficiency and accuracy of breeding and selection.

[0059] In some specific embodiments, the SNP site Chr10-14335026 is an A / G mutation;

[0060] The SNP site Chr10-14334971 is a C / T mutation;

[0061] The SNP site Chr10-14334710 is a C / T mutation;

[0062] The SNP site Chr10-14333695 is a C / A mutation.

[0063] In some specific embodiments, the material for detecting the SNP site in the nucleic acid molecule of claim 2 includes a primer set for amplifying the SNP site, a PCR reagent containing the primer pair, or a kit containing the primer pair or the PCR reagent.

[0064] The primer set includes a FAM primer, a HEX primer and a Common primer, and the molar ratio of the FAM primer, the HEX primer and the Common primer is 2:2:5.

[0065] In some specific embodiments, the primer set includes one or more of primer set 1, primer set 2, primer set 3 or primer set 4;

[0066] The nucleotide sequences of the primer set 1 are shown in SEQ ID NO.3 to SEQ ID NO.5 respectively;

[0067] The nucleotide sequences of the primer set 2 are shown in SEQ ID NO.6 to SEQ ID NO.8 respectively;

[0068] The nucleotide sequences of the primer set 3 are shown in SEQ ID NO.9 to SEQ ID NO.11 respectively;

[0069] The nucleotide sequences of the primer set 4 are shown in SEQ ID NO.12 to SEQ ID NO.14 respectively.

[0070] According to another aspect of the present invention, there is also provided any one of the following substances:

[0071] The above-mentioned primer set for amplifying the SNP site;

[0072] or, the above-mentioned PCR reagent containing the primer pair;

[0073] Or, the above-mentioned kit containing the primer pair or the PCR reagent.

[0074] According to another aspect of the present invention, there is also provided a method for identifying or assisting in identifying the length of cotton fibers, comprising detecting the genotype of the SNP site in the above nucleic acid molecule in the cotton to be tested;

[0075] The fiber length of the cotton to be tested whose genotype is TT at the SNP site Chr10-14335026 is greater than or is a candidate greater than the cotton to be tested whose genotype is CC at the SNP site Chr10-14335026;

[0076] Or, the fiber length of the cotton to be tested whose genotype is GG at the SNP site Chr10-14334971 is greater than or is candidate greater than that of the cotton to be tested whose genotype is AA at the SNP site Chr10-14334971;

[0077] Or, the fiber length of the cotton to be tested whose genotype is GG at the SNP site Chr10-14334710 is greater than or is candidate greater than that of the cotton to be tested whose genotype is AA at the SNP site Chr10-14334710;

[0078] Or, the fiber length of the cotton to be tested whose genotype at the SNP site Chr10-14333695 is GG is greater than or may be greater than that of the cotton to be tested whose genotype at the SNP site Chr10-14333695 is CC.

[0079] According to another aspect of the present invention, there is also provided a method for breeding long-fiber cotton, comprising detecting the genotype of the SNP site in the nucleic acid molecule of claim 2 in cotton;

[0080] Select cotton with the genotype of SNP site Chr10-14335026 as TT for breeding to obtain target cotton;

[0081] Or, selecting cotton with a genotype of GG at the SNP site Chr10-14334971 for breeding to obtain target cotton;

[0082] Or, selecting cotton with a genotype of GG at the SNP site Chr10-14334710 for breeding to obtain target cotton;

[0083] Alternatively, cotton with a genotype of GG at the SNP site Chr10-14333695 is selected for breeding to obtain the target cotton.

[0084] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0085] Cotton materials: 419 different varieties of cotton were selected, including Meiduomao, CC28, Anti-imperialist Cotton, Henan Cotton No. 1, Wan 3396, Tang Cotton 7401, Hebei Cotton No. 8, Daze Cotton, Shandong Cotton No. 1, Yun'an No. 4, Shen 547, Daihongdai, Hunan Selection No. 2, Dongting No. 3, Pumpkin Cotton, Zaoyang Bud-free, Chuibing Cotton (Nantong), Xuzhou 1818, Shanghai Cotton 204, 70-1437, Ci Cotton No. 9, Pengze No. 4, 70-24, Shaoyang Big Peach, Yan 64-1, Zhong 521, Zhi 6705, Xian Cotton 858, Esha 28, Xuzhou 514, Xuzhou 142, Simian No. 2, Xiaoxian 133 Long-staple, Shandai Series, Baoshan Big Peach, Bao 6716, Zhongmian Institute No. 12 (Zhong 381), Wuji Yizhihua, Hebei Cotton No. 1 No. 2, E Cotton No. 12, Dai 15×Duck Shed Cotton, China Cotton Research Institute No. 19 (Zhong 7886), Zhong 85271, Keyuan 1, Keyuan 4, Linqing 201, Wan Zao 686, Wan 231, China Cotton Research Institute No. 23, Nandan Badida Dahua, 208H-1, Su Cotton No. 1, Jinyuan 1081, Banong 212, Tu 71-113, Bu 3363, Zhongzhi BD13, Linqing 2350, Huazhong 106, China Cotton Research Institute No. 10 (Zhong 509), Heishan Cotton No. 1, Jinmian No. 2, Liao 113, Chirpan996, Liaomian No. 9, China Cotton Research Institute No. 16 (Zhong 375), Henan Vocational and Technical College 84-1, Liao 7334-7728, Hebei 91-28, Shaanxi 2754, Shaanxi 2812, Damian No. 20, Hebei Hekangyan, Hubei Q872, Henan Zao 275, Yun Zao 219, Yun 93 Kang 354, Yun 94H-32, Liaojin Cotton No. 3, Kuche 96515, Kashgar 736, Kuche T94-4, Handan 241, Yumian 19, Kuitun 353, Handan 284, Shuangjia 321, Xinlu Zao 10, Laoyang Cotton, Lingbao Cotton, Zhengzhou-385, Luodian Iron Seed, Shalu No. 1, Qinli 514, Yun K15 05, Ningmian No. 18 (Huadong 6555), Baizi from Wuren Township, Guidu'an County, Guiluo Chengda Cotton (1), Miaohua from Jidian Township, Lijiang County, Yunnan, Xinluzhong No. 5, Sukang 310, Yumian 18, Guoxin Cotton No. 3, Jinmian 38, Zhongzhi 86-6, Hongshi No. 5, Jianyang 303, Ningmian No. 9, Xinlu Zao 36, Bole No. 34, Shaanxi 4080, Ganmian No. 12, Zhongyihong 2 , Suyuan 04-3, Suyuan 04-129, J02508, Zhong R1052, Zhong R2058, Liao 4853, Lu 890, Liao 2277, Taiyuan 4, Zhongmian 49, Henan 79, Jiumian 2, Jinmian 36, Zhong 2201, Xinlu Zao 21, Xinlu Zao 28, Jin 7, Xinlu Zhong 34, Yishuhong, 73-782, Jingzhou Tui Chemical cotton, Shaanxi 689, Heda 65-125, Shaanxi 954, Rendong 67-86, Jiangsu cotton No. 1, Shaanxi Sanyuan 78-782, Pingtang Laoyanghua, 73-184, Beijing 432, Beichu Commune cotton, Kang 5, Xingtai W-2, Gan Zao 032, Zhong 5765, Zhong 6331, Jinong 355, Sichuan 169-6, Hubei 82-6078, Junmian No. 1,Shanghai 368, Dai 4554, Hunan Mayangyang Cotton, Bama Naliang Cotton, Chuan 206, Nandan Lihu Cotton, Suyuan 7252, Huazhongyuan 91-230, E901, Sanhu 84-1, Chuan 3593, E Cotton No. 19 (Taihu 0590), E4396, Liao 7003, Jin 417, Nantong 87-598, Tu 83-161, Zhong Shanghai Plant PI3910a, E Cotton 21, Xiao 2168, China Cotton Research Institute 30, JCG82, Shihezi 913, Zhong 203016, Xinyan 96-48, Keyi 7, Xinluzhong 8, Hongjijiaoyebairong, Shiyuan 345, Bamian 1, Dongting 1 VI3221, Liaoyang Green Velvet Cotton, Siyang 630, 70 Selection System 733, Jing 55173, Luyuan 3 43, Suyuan 04-162, China Cotton Research Institute 50, Xinlu Zao 31, China Cosmos 0114, China Huzhi PI9321, Henan Daling Dasi Cotton, Huixian Yiwohou, Datao Cotton, Yun 1812, Xuzhou No. 6, Daizi Cotton Short Fruit Branch, Xinlu Zao 7, Yibabian, Shandong Cotton No. 2, China Cotton Research Institute No. 17 (Zhong 117), Shandong 1138, Zhongzhi 86-1, Ekang Cotton No. 8, Shaanxi 416, Shandong Cotton No. 6, China Cotton Research Institute 35, New Cotton 33B, Simian No. 3, Su Cotton 9108, China Cotton Research Institute 41, Si 168, Linqing 2352, Chad No. 3, Zhong 206, Nongguang No. 1, Turkmen Upland Cotton, Jiu Cotton No. 8, Jin Cotton 46, BJA592, Soviet Cotton 78 Series (89-57-4), MAR-7A-3, Express Cotton Expres s, King, US B-35, С1835, Bao 2367, phenol-free No. 1 ("low phenol"), Agricultural University Cotton No. 8, Jin Cotton 49, African Cotton E-40, GP203, Soviet Cotton 156 Series (91-671), Dezhou 973, Australian V2 / 757, F281, Green Fiber No. 1, China Cotton Research Institute 60, Miscot7803-52, Jifeng 908, Shandong Cotton Research Institute No. 28, GP135, E0908, Arkansas 971 (Zhongyin 971), Brown Fiber No. 1, Jin Cotton 34, Daizi Cotton No. 16, Australian SiV2, Delcot277-5, Brown 2-63, Si-6524, GZNn (wool), Hunan 83-238 (Hunan Cotton No. 13), Aizi Cotton 1517-70, AC321, V1, BP52, Super Chicken Feet German Cotton, Hunan Cotton 18, PD2165, Stone Anti 39, Rare Wool H10, Silver Cotton No. 1, Suyou 6036, Spotted Leaves, Agricultural University Cotton No. 7, Bole 07-11, China Cotton Research Institute 81, DES926, PD3246, N74-250, M-8124-1159, China RI015, PD6186, US 28114-313, 93 Foreign Introduction-14, HF5RUP, С3210, Columbia, German Cotton 2404, Pilose-3, Qik, Liaowu 1201 (low phenol), CF-43 / 2, Bukhara No. 6, Super Chicken Feet, M-8114-0224, Z37less, Babshaw1, Su BR6202Bt,PD97072, 149X, Delfos9169A, Desmotada, Jinnongdayuan 3-1, Soviet cotton 35 series (91-329-2), 93 foreign introduction-17, US 87-2, St213RNR, Qunke cotton ("0" type), L-5F45, MSCO-8, Andijan-60, DP90, Miscot 8711ne (no nectar glands), EmpireStrN2-4, V83-013, Cestam86-1 (Mexico), PD0113, Soviet cotton 118 series (89-73-2), Zhongzhi cotton No. 2 Rowden, Fergan 175, 93 foreign introduction-4, Brazil 006, Zhongwu 372 (low phenol), Cook1627 (shan), Greenlint, Xinluzhong 35, Nonglin 1, Ning 523, Local Cotton (Russia), Soviet cotton 12 series (91-359), Liaoyang hairy cotton, Cai Ke 510, chicken foot red leaf cotton, Li 771-436 (Li toxin-free), 41B006, Dunn HS120, Soviet 8909, Baimian No. 1, TYJ-98-35, GP81, Daizi cotton No. 15, Lambright GL-N, 108F, Bo cotton No. 3 ("1" type), Sizi cotton 453, gL2gl3, purple brown upland cotton, FH682, N73DeltapineNGF, Local cotton, Zhong 21371, Ji 169, Ari1327, Ari971, A41772BBt, SGK9708 (original), Daling cotton 69, Liaoyang hairy, Zhong Arc73, R01 Sandu 85, SA1064B1, K8J508, Zhong R773-310, Zhong R773-314, Zhong 1138E24, R8166S91, Zhongmian 43, Suyou 6108, Wangjiang long-staple cotton, Yuan 247-31, Ari3696, Suyou 6003, Qinyuan 93089, A971Bt, RT white cotton, Suyuan 7235, Wusan long-staple, RTN78, Ari3697, Zhong 1421, 4133Bt, Zhong 1441, brown 1-61, brown 128, Zhong Cotton 82, Brown S9B11, Brown S9B12, Hebei Cotton 668, Kuitun 80-2056W (Xinlu Zao-3), Langhuang F10 (white cotton), Su Cotton 12, Uganda 3, Changkang Cotton, 86-1 (72-100), Zhongwu 378, Xuzhou 553, Eguang Cotton, Hebei Cotton 11, TM-1, Double Peach Cotton ("0" type), Yahuang Li, Yu Cotton 1 No. 10, Langhuang F10 (brown cotton), Jimian 20, J02-247, CZA (70) 33, Handan 333, Jinmian 33, Zhongmian 36, Yumian 8, Yumian 21, Jinmian 20, Ganmian 11, Sumian 22, Sumian 9, Yinshan 6, Lumianyan 16, Jinmian 25, Ekangmian 10, Zhong 078, Jimian 17 and Emian 20.

[0086] Example 1 GhTTL gene function verification

[0087] Identification of the GhTTL gene

[0088] In this example, resequencing of 419 populations combined with whole genome association analysis determined that there is an interval on chromosome D10 that is significantly correlated with fiber length. This interval contains a total of 10 genes. Stepwise functional verification of these genes showed that the GhTTL gene is a functional gene. Analysis determined that the candidate gene related to fiber development is GhTTL. The amino acid sequence of the GhTTL protein is shown in SEQ ID NO.1, and the nucleotide sequence encoding the GhTTL gene is shown in SEQ ID NO.2.

[0089] 2. Functional verification of GhTTL gene

[0090] By genetically transforming the gene, the GhTTL overexpression vector GhTTL-WMV067 and the gene editing vector GhTTL-016 were constructed. Using a cotton genetic transformation method mediated by Agrobacterium tumefaciens, the GhTTL overexpression material GhTTL-OE and the gene editing material GhTTL-CRISPR were created.

[0091] like Figure 1 As shown, A is the phenotypic comparison of mature fibers of GhTTL-OE and ZM49 (wild type WT) plants, scale bar = 1 cm; B is the expression analysis of GhTTL in overexpression (GhTTL-OE) plants. L1 to L5 represent biological replicates of the same variety. The expression level in the ZM49 sample was set to 1, and his3 was used as an internal control. The error bars represent the standard deviation (SD) of three independent experiments. C is the statistical analysis of the length of mature fibers of GhTTL-OE plants. The error bars represent the standard deviation based on 10 independent fiber length measurements. The t-test was used to determine the statistical significance (**P<0.01, ***P<0.001). By statistically comparing the fiber data of GhTTL-OE and the control group Zhongmian 49 (ZM49), it was clear that this gene can promote fiber elongation.

[0092] like Figure 2As shown, A is the CRISPR / Cas9 target sequence of the GhTTL gene and the sequencing verification results of different editing lines. B is the fiber phenotype of the GhTTL editing line (GhTTL-CRISPR) and the wild type (ZM49) at the fiber development stage (10DPA, 15DPA, 20DPA). C is the morphological characteristics of mature fibers of GhTTL-CRISPR and ZM49. D is the statistical analysis of fiber length of ZM49 and GhTTL-CRISPR lines at 10DPA and 15DPA. E is the statistical analysis of fiber length of ZM49 and GhTTL-CRISPR lines at 20DPA and mature fibers. Data are expressed as mean ± standard deviation (n = 10). Statistical significance was determined by Student-t test (*P < 0.05, **P < 0.01). L1, L2 and L3 represent biological replicates of the same variety. By statistically comparing the fiber data of GhTTL-CRISPR and ZM49, it was found that knocking out the GhTTL gene could inhibit fiber elongation.

[0093] Example 2 Identifying the SNP sites in the GhTTL promoter region

[0094] 1. SNP site confirmation

[0095] Through sequencing and sequence comparison, such as Figure 3 A in the middle shows the distribution map of polymorphic sites in the promoter region of the GhTTL gene. SNP site mutations were identified in the GhTTL promoter region, forming two haplotypes (Hap1 and Hap2); Figure 3 The box plot shown in B shows the association analysis between the two haplotypes in the GhTTL promoter region and the fiber length phenotype. In the box plot, the center line represents the median, the box represents the interquartile range, and the whiskers represent the data range. The two-tailed t-test was used to evaluate the statistical significance between the groups. The fiber length data of the two haplotypes were statistically analyzed, and it was found that the fiber length of the Hap1 type variety was significantly longer than that of the Hap2 type variety. Figure 3C in the figure shows qRT-PCR analysis of the relative expression level of GhTTL in different haplotype materials. The expression level of GhTTL in D054 was used as a reference (set to 1), and his3 was used as an internal control. The error bars represent the standard deviation (SD) of three biological replicates; D shows a luciferase reporter assay for detecting LUC expression driven by the GhTTL-P-Hap1 promoter, and E shows a luciferase reporter gene assay for detecting LUC expression driven by the GhTTL-P-Hap2 promoter. The ability of the two genotype promoters to drive gene expression was verified, indicating that the Hap1-type promoter drives GhTTL expression more strongly than the Hap2-type promoter, thereby promoting fiber elongation. The above results prove that the SNP site mutation in the GhTTL promoter region can cause significant changes in fiber length.

[0096] 2. Feasibility analysis of developing KASP molecular markers based on SNP loci

[0097] By analyzing the sequence, such as Figure 3 In A, it was found that SNP site 14335101 was not suitable for developing KASP markers because of multiple copies of the sequence. SNP sites Chr10-14335026, SNP site Chr10-14334971, SNP sites Chr10-14334710 and Chr10-14333695 can all be tried to develop KASP markers.

[0098] Example 3 Development of KASP molecular markers for SNP sites

[0099] Extract at least 150bp of flanking sequences upstream and downstream of the development site, and analyze the sequence copy number, sequence GC content, etc. of the site to be developed. Generally, the probability of successful development of markers for multi-copy sequences, high GC and high repetitive sequences is very low, so development is not performed.

[0100] 1. Primer design and synthesis

[0101] Bacthprimer 3 software was used to design KASP primers for SNP sites and flanking sequences. Each set of KASP markers consisted of 2 specific primers and 1 universal primer. The 5' end of specific primer 1F was connected to a FAM fluorescent linker sequence (GAAGGTGACCAAGTTCATGCT is the FAM fluorescent linker sequence), FAM is red, on the Y axis; the 5' end of specific primer 2F was connected to a HEX fluorescent linker sequence (GAAGGTCGGAGTCAAC GGATT is the HEX fluorescent linker sequence), HEX is blue, on the X axis. The following primers were synthesized by Huazhi Biotechnology Co., Ltd.

[0102] The sequence information of KASP typing molecular marker primers for the four SNP loci is as follows:

[0103] Chr10-14335026:

[0104] Specific primer 1F (SEQ ID NO. 3): GAAGGTGACCAAGTTCATGCTGTTCACACACAAATGGCGATCCT;

[0105] Specific primer 2F (SEQ ID NO. 4): GAAGGTCGGAGTCAACGGATTGTTCACACACAAATGGCGATCCC;

[0106] Universal primer R (SEQ ID NO. 5): CTACTAGCACGGACAAAGGAAAAG.

[0107] Chr10-14334971:

[0108] Specific primer 1F (SEQ ID NO. 6): GAAGGTGACCAAGTTCATGCTCAAGTTTTGCTTTTCCTTTGTCCG;

[0109] Specific primer 2F (SEQ ID NO. 7): GAAGGTCGGAGTCAACGGATTACAAGTTTTGCTTTTCCTTTGTCCA;

[0110] Universal primer R (SEQ ID NO. 8): TGTTGTGAACCAGCCAAACCATCTAC.

[0111] Chr10-14334710:

[0112] Specific primer 1F (SEQ ID NO. 9): GAAGGTGACCAAGTTCATGCTCATGCACGTAACCTTTTTCCTAAGC;

[0113] Specific primer 2F (SEQ ID NO. 10): GAAGGTCGGAGTCAACGGATTCCATGCACGTAACCTTTTTCCTAAGT;

[0114] Universal primer R (SEQ ID NO. 11): GAATAATCGATGAGAGAACTTTCCAC.

[0115] Chr10-14333695:

[0116] Specific primer 1F (SEQ ID NO. 12): GAAGGTGACCAAGTTCATGCTAAAAGACAAAAGATAGGCAAAATCAAG;

[0117] Specific primer 2F (SEQ ID NO. 13): GAAGGTCGGAGTCAACGGATTAAAAGACAAAAGATAGGCAAAATCAAT;

[0118] Universal primer R (SEQ ID NO. 14): ACATGGGTGATTTCCAACATGAATG.

[0119] 2. Establishment of KASP method

[0120] 1) Sample DNA extraction

[0121] DNA extraction of samples was performed using a standard magnetic bead method, which mainly included the following steps:

[0122] A1. Add 4mm steel balls to the sample well plate, cover with silicone cover, and grind at 1400rpm for 2min.

[0123] A2. After grinding, add 400ul lysis solution into the well plate and incubate for 1h;

[0124] A3. After warm bath, centrifuge at 3600 rpm for 10 min, place in LGC automated magnetic bead extractor, and run the plant DNA extraction program;

[0125] A4. Confirm that there are no errors during program operation, complete the DNA extraction process, and seal the DNA for storage for later use.

[0126] 2) KASP amplification:

[0127] The genomic DNA of the above-mentioned sample to be tested was used as a template, and KASP amplification was performed using KASP typing molecular marker primers. Primer working solution: The primer powders of FAM primers, HEX primers and Common primers were dissolved to 100 μM, 12 μl of FAM primers, 12 μl of HEX primers and 30 μl of Common primers were mixed, and then 46 μl of water was added to obtain a primer working solution, wherein the concentration of FAM primers was 12 μmol / L, the concentration of HEX primers was 12 μmol / L, and the concentration of Common primers was 30 μmol / L.

[0128] The KASP amplification system is shown in Table 1. The microplate type is a micro-well membrane, and the unit is μL. The Douglas platform is used for PCR amplification, and the PCR amplification conditions are shown in Table 2.

[0129] Table 1 KASP amplification system

[0130] Components Dosage DNA template (10~20ng / ul) 0.8ng(drying) 2×PCR MIX 0.40μL Primer working solution 0.01μL Double distilled water 0.39μL Total reaction volume 0.8μL

[0131] Table 2 KASP amplification conditions

[0132]

[0133] Among them, the number of PCR cycles is appropriately increased according to the typing situation.

[0134] 3) Fluorescence scanning: Use ARAYA to scan the fluorescence signal of the reaction system; then use INTELLICS for data analysis and genotyping.

[0135] Example 4 Assay to verify the correlation between KASP molecular marker and fiber length

[0136] 94 materials randomly selected from the initial 419 materials were selected, including homozygous and heterozygous genotypes of Hap1 and Hap2. All 94 samples were tested using four molecular markers.

[0137] KASP marker validation was performed using 94 samples on the Douglas Scientific Array Tape system. The PCR system was assembled using NEXAR and operated according to the amplification system and conditions shown in Tables 1 and 2. After the PCR reaction was completed, ARAYA was used to scan the fluorescence signal of the reaction system; then INTELLICS was used for data analysis and genotyping.

[0138] The schematic diagram of marker typing is as follows Figure 4 As shown, the A-type typing indicates that the sample contains a homozygous site of the reference genotype at this KASP marker site (marked in red in the typing diagram, located in the upper left corner of the figure), the B-type typing indicates that the sample contains a homozygous site of the mutant genotype at this KASP marker site (marked in blue in the typing diagram, located in the lower right corner of the figure), and the heterozygous typing indicates that the sample contains A and B heterozygous alleles at this KASP marker site (marked in purple in the typing diagram, located near the 45-degree axis of the coordinate axis). The genotypes of each sample are shown in Table 3.

[0139] By sorting out and analyzing the detection results of the four KASP molecular markers developed, it can be clearly shown that all four molecular markers are polymorphic, but in terms of typing and specificity, the marker typing designed with the SNP site 14335026 (Chr10-14335026) is heterozygous and tends to be FAM homozygous, and the VIC homozygous cluster is not concentrated enough, and the typing effect is average. The marker typing of the other three sites (Chr10-14334971, Chr10-14334710 and Chr10-14333695) all have good typing effects and the genes have a strong correlation, and the typing effects are also highly unified, proving that the molecular marker has a high accuracy.

[0140] Table 3 KASP molecular marker detection results of different samples

[0141]

[0142]

[0143]

[0144]

[0145] Among them, N stands for not detected.

[0146] As shown in Table 3, samples numbered 3, 10, 12, 24, 28, 31, 39, 48, 54, 55, 59, 61, 62, 66, 72, 80, 85 and 90 do not meet the conditions for mutation screening of each SNP site for cotton with long fiber traits in terms of genotype. The test results of the four SNP sites of samples with other numbers are consistent, and all of them are cotton with long fiber traits. At the same time, the above results are compared with the field fiber length phenotypes of each sample. It is found that compared with the fiber length of samples numbered 3, 10, 12, 24, 28, 31, 39, 48, 54, 55, 59, 61, 62, 66, 72, 80, 85 and 90, the cotton fiber length of other samples shows different degrees of elongation, which is consistent with the results of genotyping.

[0147] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A protein, characterized in that The amino acid sequence of the protein is shown in SEQ ID NO.

1.

2. A nucleic acid molecule encoding the protein of claim 1; Preferably, the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO.

2.

3. Use of the protein according to claim 1 or the nucleic acid molecule according to claim 2 in increasing the length and / or yield of cotton fibers or cultivating long-fiber and / or high-yield cotton.

4. Use of a substance for detecting SNP sites in the nucleic acid molecule of claim 2 in identifying or assisting in identifying cotton fiber length or cotton breeding, wherein the SNP sites include one or more of SNP sites Chr10-14335026, SNP sites Chr10-14334971, SNP sites Chr10-14334710 or Chr10-14333695.

5. The use according to claim 4, characterized in that: The SNP site Chr10-14335026 is a T / C mutation; The SNP site Chr10-14334971 is a G / A mutation; The SNP site Chr10-14334710 is a G / A mutation; The SNP site Chr10-14333695 is a G / T mutation.

6. The use according to claim 4 or 5, characterized in that: The material for detecting the SNP site in the nucleic acid molecule of claim 2 includes a primer set for amplifying the SNP site, a PCR reagent containing the primer pair, or a kit containing the primer pair or the PCR reagent.

7. The use according to claim 6, characterized in that: The primer set includes one or more of primer set 1 for amplifying SNP site Chr10-14335026, primer set 2 for amplifying SNP site Chr10-14334971, primer set 3 for amplifying SNP site Chr10-14334710, or primer set 4 for amplifying SNP site Chr10-14333695; The nucleotide sequences of the primer set 1 are shown in SEQ ID NO.3 to SEQ ID NO.5 respectively; The nucleotide sequences of the primer set 2 are shown in SEQ ID NO.6 to SEQ ID NO.8 respectively; The nucleotide sequences of the primer set 3 are shown in SEQ ID NO.9 to SEQ ID NO.11 respectively; The nucleotide sequences of the primer set 4 are shown in SEQ ID NO.12 to SEQ ID NO.14 respectively.

8. Any of the following substances: The primer set for amplifying a SNP site according to claim 6; Or, the PCR reagent containing the primer pair according to claim 6; Or, the kit containing the primer pair or the PCR reagent according to claim 6.

9. A method for identifying or assisting in identifying the length of cotton fibers, characterized in that: The method comprises detecting the genotype of the SNP site in the nucleic acid molecule of claim 2 in the cotton to be tested; The fiber length of the cotton to be tested whose genotype is TT at the SNP site Chr10-14335026 is greater than or is a candidate greater than the cotton to be tested whose genotype is CC at the SNP site Chr10-14335026; Or, the fiber length of the cotton to be tested whose genotype is GG at the SNP site Chr10-14334971 is greater than or is candidate greater than that of the cotton to be tested whose genotype is AA at the SNP site Chr10-14334971; Or, the fiber length of the cotton to be tested whose genotype is GG at the SNP site Chr10-14334710 is greater than or is candidate greater than that of the cotton to be tested whose genotype is AA at the SNP site Chr10-14334710; Or, the fiber length of the cotton to be tested whose genotype at the SNP site Chr10-14333695 is GG is greater than or may be greater than that of the cotton to be tested whose genotype at the SNP site Chr10-14333695 is CC.

10. A method for breeding long-fiber cotton, characterized in that: The method comprises detecting the genotype of the SNP site in the nucleic acid molecule of claim 2 in cotton; Select cotton with the genotype of SNP site Chr10-14335026 as TT for breeding to obtain target cotton; Or, selecting cotton with a genotype of GG at the SNP site Chr10-14334971 for breeding to obtain target cotton; Or, selecting cotton with a genotype of GG at the SNP site Chr10-14334710 for breeding to obtain target cotton; Alternatively, cotton with a genotype of GG at the SNP site Chr10-14333695 is selected for breeding to obtain the target cotton.

Images