Biocontrol strain 2A1 as well as fungicide and application thereof

Abstract

The invention relates to a biocontrol strain 2A1 as well as a fungicide and application thereof. The biocontrol strain is a Penicillium fungus (Penicillium fruticose-cellaei) 2A1, and the preservation number of the biocontrol strain is CGMCC (China General Microbiological Culture Collection Center) NO.41539. The invention further discloses a preparation method of the biocontrol strain. The biocontrol inoculant contains the biocontrol strain or a fermentation broth thereof. The composition is specifically applied to prevention and treatment of wheat stem rot, wheat sharp eyespot, cotton verticillium wilt or rice blast. The biocontrol strain disclosed by the invention can be used for effectively inhibiting fusarium pseudograminearum, rhizoctonia cerealis R.cerealis, verticillium dahlii V.dahlii and magnaporthe oryzae M.oryzae, and is suitable for preventing and treating wheat stem rot, wheat sharp eyespot, cotton verticillium wilt and rice blast.

Description

Technical Field

[0001] The invention relates to a biocontrol strain 2A1, a bacterial agent and application thereof, and belongs to the technical field of agricultural biocontrol bacteria and the technical field of microorganisms. Background Art

[0002] Fusarium spp. is a large class of ascomycetes that produce sickle-shaped conidia. Its species are rich in diversity and include many plant pathogens. Among them, Fusarium graminearum can cause wheat head blight when infecting wheat, and Fusarium pseudograminearum can cause wheat stem rot when infecting wheat. These two types of Fusarium diseases on wheat not only cause serious yield losses, but the pathogens also produce a variety of mycotoxins including 3-acetyl-deoxynivalenol (3AcDON), 15-acetyl-deoxynivalenol (15AcDON) and nivalenol (NIV), which cause vomiting and decreased immune function in humans and animals, threatening the health of humans and animals.

[0003] Rhizoctonia cerealis is the main pathogen of wheat sheath blight, which is one of the most serious diseases in the world's temperate wheat-growing areas. In my country, sheath blight is an important constraint on wheat production in the middle and lower reaches of the Yangtze River and the Huanghuai wheat-growing areas. When sheath blight occurs at a mild level, it causes water loss and necrosis at the base of the wheat stem, leading to wheat lodging. When the disease is severe, it causes wheat to produce dry and white ears, greatly reducing wheat yields by 20% to 40%. At present, no wheat varieties with high resistance to sheath blight have been found, and prevention and control mainly rely on chemical fungicides such as triazoles and amides.

[0004] Verticillium dahliae is a soil-borne pathogenic fungus that can invade plant roots and colonize, proliferate and cause damage in the ducts, eventually leading to yellowing and wilting of leaves. Verticillium dahliae infects cotton and causes cotton wilt disease, which causes large-scale cotton yield reduction or even total crop failure, with a yield reduction of up to 20%-30%. The fungus has a wide host range. In addition to cotton, it can also infect more than 400 dicotyledonous plants, including important economic and vegetable crops such as tomatoes, potatoes, tobacco, sunflowers, eggplants, and lettuce, posing a huge threat to agricultural production.

[0005] Rice blast, caused by the rice blast fungus (Magnaporthe oryzae), is one of the main diseases in rice production and can cause a significant reduction in yield, with a 40%-50% reduction in yield in severe cases, or even a total loss of all rice. Rice blast can occur throughout the entire growth period of rice, with leaf blast and ear neck blast being the most common, of which ear neck blast has the most serious impact on yield. The risk of frequent rice blast in the Jianghuai rice-growing areas and the middle and lower reaches of the Yangtze River is extremely high, which can easily lead to a serious reduction in rice yield.

[0006] At present, the prevention and control of the above crop diseases mainly rely on chemical fungicides, but there are problems such as a small number of fungicides to choose from, large field dosage, and unstable control effect. Biological control has been widely recognized in global agricultural production as an environmentally friendly, safe for humans and animals, and economically effective prevention and control method. However, the biological control resources of existing technologies are limited, and it is of great significance to find new biological control strains.

[0007] After searching, it was found that the invention patent application with application number 202311867809.X and application publication number CN 118086064A disclosed a Penicillium aureum ZJU810, which can inhibit Fusarium graminearum and Fusarium pseudograminearum. It focuses on the prevention and control of wheat fusarium rust and inhibits the fungal toxins produced by wheat fusarium rust, but there is no reflection on whether it has a preventive and therapeutic effect on other crop diseases.

[0008] The inventor team of the present invention has obtained research results by developing biocontrol strains for preventing and controlling crop diseases, and now applies for a patent for the present invention. Summary of the invention

[0009] The main purpose of the present invention is to overcome the problems existing in the prior art and provide a biocontrol strain 2A1, which can effectively inhibit multiple pathogens such as Fusarium graminearum, Rhizoctonia graminearum, Verticillium dahliae, and Magnaporthe oryzae, thereby preventing and controlling corresponding crop diseases. At the same time, corresponding biocontrol agents and applications are also provided.

[0010] The technical solution of the present invention to solve the technical problem is as follows:

[0011] The invention discloses a biocontrol strain, which is Penicillium fructuariae-cellae 2A1, and is deposited in China General Microbiological Culture Collection Center with a deposit number of CGMCC No.41539.

[0012] Fermentation broth of the biocontrol strains described above.

[0013] The present invention also provides:

[0014] A method for preparing a biocontrol strain fermentation liquid comprises the following steps:

[0015] The first step is to culture the aforementioned biocontrol strain on a PDA culture medium plate, and then take a bacterial plate; put the bacterial plate into a PDB liquid culture medium, and culture it at 25°C±1°C with shaking to obtain a fermentation mixture.

[0016] The second step is to filter the fermentation mixture, centrifuge the obtained liquid to obtain the supernatant, and pass the supernatant through a bacterial filter to remove spores, thereby obtaining the biocontrol strain fermentation liquid.

[0017] Preferably, in the first step, the diameter of the bacterial plate is 5±1 mm, the number of bacterial plates: the volume of the PDB liquid culture medium = 5: 100±10 mL; the culture conditions are: the rotation speed is 200-250 r / min, and the time is at least 7 days.

[0018] Preferably, in the first step, the PDA medium is composed of the following components: 200 g potato, 15 g agar powder, 20 g glucose, and ddH2O fixed to 1 L; the PDB liquid medium is composed of the following components: 200 g potato, 20 g glucose, and ddH2O fixed to 1 L.

[0019] Preferably, in the second step, at least three layers of sterile filter cloth are used for filtration; the centrifugation conditions are: at 25°C±1°C, 5000-6000 rpm for at least 8 min; and the pore size of the bacterial filter is less than or equal to 0.22 μm.

[0020] The present invention also provides:

[0021] The above-mentioned biocontrol strain or its fermentation liquid is used for preparing biocontrol agents for inhibiting Fusarium graminearum, Rhizoctonia graminearum, Verticillium dahliae, and Magnaporthe oryzae.

[0022] The biocontrol strain or its fermentation liquid described above is used for preparing a biocontrol agent for preventing and controlling wheat stem base rot, wheat sheath blight, cotton verticillium wilt, or rice blast.

[0023] The present invention also provides:

[0024] A biocontrol agent contains the biocontrol strain or its fermentation liquid as described above.

[0025] The biocontrol agent described above is used for preventing and controlling wheat stem base rot, wheat sheath blight, cotton verticillium wilt, or rice blast.

[0026] The biocontrol strain Penicillium fructuariae-cellaei 2A1 of the present invention can effectively inhibit F. pseudograminearum, Rhizoctonia cerealis, V. dahliae and M. oryzae, and is suitable for preventing and controlling wheat stem base rot, wheat sheath blight, cotton verticillium wilt and rice blast. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The colony morphology of strain 2A1 in Example 1 of the present invention is shown in the figure on the left, and the back is shown on the figure on the right.

[0028] Figure 2 This is the phylogenetic tree of fungi constructed based on ITS genes in Example 1 of the present invention.

[0029] Figure 3 This is the phylogenetic tree of fungi constructed based on the BenA-CaM gene combination in Example 1 of the present invention.

[0030] Figure 4 The plate confrontation result diagram of strain 2A1 antagonizing various pathogens in Example 2 of the present invention is shown in FIG. CK group is a blank control.

[0031] Figure 5 This is a graph showing the inhibitory effect of fermentation broths of different concentrations of strain 2A1 in Example 3 of the present invention.

[0032] Among them, Figure A is the pseudo-Fusarium graminearum CF14047, Figure B is the Fusarium graminearum PH-1, and Figure C is the Rhizoctonia graminearum R0301; CK is the blank control.

[0033] Figure 6 This is a graph showing the change in the number of spores germination of Pseudomonas graminearum CF14047 under different treatments in Example 4 of the present invention.

[0034] Figure 7 This is a diagram showing the incidence of wheat coleoptile stem rot under different treatments in Example 5 of the present invention.

[0035] Among them, the CK group was the blank control.

[0036] Figure 8 This is a diagram showing the incidence of wheat stem base rot under different treatments according to Example 6 of the present invention.

[0037] Fig. 9 This is a diagram showing the growth of wheat under different treatments according to Example 6 of the present invention. DETAILED DESCRIPTION

[0038] The present invention is further described below by way of examples, but the present invention is not limited to these examples. The reagents involved in the present invention are all commercially available. The experimental methods of the following examples are conventional methods unless otherwise specified.

[0039] Example 1

[0040] This example is about strain separation and identification.

[0041] The specific contents of this embodiment are as follows:

[0042] (1) Separation

[0043] The inventor team collected soil samples from a wheat field at a base of the Jiangsu Academy of Agricultural Sciences. Use a 0.9mm soil sieve to remove gravel and fallen leaves, weigh 5g of each soil sample and put it into a conical flask filled with 45mL of sterile water, and shake it at 150r / min on a shaker for 30 minutes. The above soil turbid solution was gradient diluted, and 100μL of the dilution with appropriate concentration was spread on a Martin medium plate, and cultured in a dark box at 25℃ for 4-7 days. According to the different colors and morphologies of the colonies grown, after three times of streaking purification, a pure strain was screened and obtained, which was numbered as strain 2A1.

[0044] (2) Identification

[0045] The morphological characteristics of strain 2A1 were identified, and the specific results are as follows:

[0046] (i) Morphological characteristics:

[0047] The colonies of strain 2A1 on PDA medium are round, compact, soft in texture, with complete edges. They are white at first, but due to the formation of a large number of spores, they become green in the middle and white in the outer circle. They grow radially, produce yellow pigment in the medium, and the back of the colonies is light yellow. Figure 1 shown.

[0048] (ii) Gene sequence characteristics:

[0049] Fungal DNA was extracted using a fungal genomic DNA extraction kit (Beijing Solebow Technology Co., Ltd.), and the genomic DNA of strain 2A1 was extracted as a template. PCR amplification was performed using universal primers for the ITS gene, and primers for the BenA and CaM genes as follows.

[0050] ITS gene universal primers:

[0051] ITS1:5'-tccgtaggtgaacctgcgg-3'(SEQ ID NO:1)

[0052] ITS4: 5'-tcctccgcttattgatatgc-3' (SEQ ID NO: 2)

[0053] The 25 μL reaction system was: 12.5 μL Taq PCR Mix premix (Shanghai Sangon Biotech Co., Ltd., the same below); 1 μL each of primers ITS1 and ITS4; 1 μL of strain 2A1 genome template; and 9.5 μL ddH2O.

[0054] The reaction conditions were: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 5 min.

[0055] BenA gene primers are:

[0056] Bt2a: 5'-ggtaaccaaatcggtgctgctttc-3' (SEQ ID NO: 3)

[0057] Bt2b: ​​5'-accctcagtgtagtgacccttggc-3' (SEQ ID NO: 4)

[0058] The 25 μL reaction system is: 12.5 μL Taq PCR Mix premix; 1 μL primers Bt2a and Bt2b; 1 μL strain 2A1 genome template; 9.5 μL ddH2O.

[0059] The reaction conditions were: 95°C for 5 min; 95°C for 30 s, 61.3°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 5 min.

[0060] The primers for CaM gene are:

[0061] CaM F: 5'-tcygagtacaaggaggcstt-3' (SEQ ID NO: 5)

[0062] CaM R: 5'-ccratggaggtcatracgtg-3' (SEQ ID NO: 6)

[0063] The 25 μL reaction system is: 12.5 μL Taq PCR Mix premix; 1 μL primers CaM F and CaM R each; 1 μL strain 2A1 genome template; 9.5 μL ddH2O.

[0064] The reaction conditions were: 95°C for 5 min; 95°C for 30 s, 54.7°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 5 min.

[0065] The PCR amplification product was sequenced (Sangon Biotechnology (Shanghai) Co., Ltd.) to obtain 555 bp ITS gene sequence, 501 bp BenA gene sequence and 562 bp CaM gene sequence.

[0066] ITS gene sequence (SEQ ID NO:7):

[0067] gttacgacgaggatctgggtccacctcccacccgtgtttatcgtaccttgttgcttcggcgggcccgcctcacggccgccggggggcacccgcccccgggccc

[0068] gcgcccgccgaagacaccattgaactctgtctgaagattgcagtctgagcgattagctaaatcagttaaaactttcaacaacggatctcttggttccggcatcgatg

[0069] aagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgagtctttgaacgcacattgcgccccctggtattccggggggcatgcctgt

[0070] ccgagcgtcattgctgccctcaagcacggcttgtgtgttgggcccccgcccctccccccgggggggcgggcccgaaaggcagcggcggcaccgcgtccgg

[0071] tcctcgagcgtatggggcttcgtcacccgctctgtaggcccggccggcgcccgccggcgaccccaatcaatctttccaggttgacctcggatcaggtagggata

[0072] cccgctgaacttaagcatatcaaaaggcggaggaa

[0073] BenA gene sequence (SEQ ID NO:8):

[0074] ggtttcgtgcccgccaccaacactgcccaacataacaaagcagcccctccgattgcgagtctgaatggacaagatgtactgactcgaactacaggcagaccatt

[0075] gctggtgagcacggccttgacggcgatggccagtaagtttcttcgataccactcgacaataccactcgaacgcggaatggcggtctgatattttttggctaggtac

[0076] aatggtacctccgacctccagctcgagcgcttgaacgtctacttcacccacgtaagttgcgtatccagtcaatgccgaaataccgaatacgattctaatcgatggat

[0077] cttttgtttcttaggccagcggtgacaagtacgttccccgtgccgttctggtcgatctggagcccggtaccatggacgctgtccgtgccggtccctttggcaagctct

[0078] tccgtcccgacaacttcgtcttcggtcagtccggtgctggtaacaactgggccaagggtcacaccctgggagggta

[0079] CaM gene sequence (SEQ ID NO:9):

[0080] ggggagggaagctctcgacgcgtgcattgacaatctccgatcgaaaaaaaaacagtagactgaccagggccggttttcccgcttgtcaacaggacaaggatgg

[0081] cgatggtgagtgcagtcattcccgatagctcggaagagtggtctttgggccattggaacttgcgaaaacttcaaaaacagaatgactaaagttgcatactattaata

[0082] ggccaaatcaccaccaaggagctcggcactgtcatgcgctcgctcggccagaacccctccgagtctgagctgcaggatatgatcaacgaggtcgatgccgac

[0083] aacaacggcaccattgacttccccggtacgctcttaatatcccaagctgtcaccagctgctattttctctctcagacccaagactaattgcttttctgtgcgcccgtag

[0084] agttcctcaccatgatggcccgcaagatgaaggacaccgactcagaggaggagatccgggaggcgttcaaggtgttcgaccgtgacaacaacggctttatctc

[0085] cgccgctgagctccgccacgtcatgccccttccatcgg

[0086] The strain 2A1 was identified by phylogenetic methods. The above ITS gene sequences were compared by BLAST analysis, and the strain 2A1 was preliminarily identified as Penicillium sp. The sequencing results of the two genes BenA and CaM were then compared, and the sequences of different strains with higher homology were taken and the fungal sequences were combined by MEGA 11 using the neighbor-joining method to construct a phylogenetic tree. Finally, the strain 2A1 and Penicillium fructuariae-cellae were clustered in the same branch. The results are as follows Figure 2 and Figure 3 shown.

[0087] Based on morphological and gene sequence characteristics, strain 2A1 was finally identified as Penicillium fructuariae-cellae.

[0088] (3) Preservation

[0089] The strain 2A1 was sent to the China General Microbiological Culture Collection Center (CGMCC) for preservation, whose address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code 100101, and the preservation number is CGMCC NO.41539.

[0090] Example 2

[0091] In this example, the broad-spectrum antibacterial activity of strain 2A1 was determined by the plate confrontation method.

[0092] The specific contents of this embodiment are as follows:

[0093] The strain 2A1 and the pathogenic bacteria disc were inoculated at a distance of 5 cm on both sides of the PDA culture medium plate and cultured at 25°C for 3 days. The pathogenic bacteria disc inoculated alone was used as the control (i.e., CK group).

[0094] Inhibition rate (%) = (control pathogen diameter - treated pathogen diameter) / control pathogen diameter × 100.

[0095] The pathogens used in this example include: F. pseudograminearum, Fusarium graminearum, Rhizoctonia cerealis, Verticillium dahliae, and Magnaporthe oryzae.

[0096] The above pathogens were provided by the Institute of Plant Protection, Jiangsu Academy of Agricultural Sciences, among which Fusarium graminearum was numbered PH-1, F. pseudograminearum was numbered CF14047, and Rhizoctonia cerealis was numbered R0301.

[0097] The results are shown in Table 1 and Figure 4 shown.

[0098] Table 1. Inhibitory effect of strain 2A1 on different pathogens (%)

[0099]

[0100] The results showed that strain 2A1 had different degrees of inhibition on the growth of five pathogens. Among the Fusarium, strain 2A1 had the best inhibition effect on F. pseudograminearum, with an inhibition rate of 41.96%, and the inhibition rate on Rhizoctonia cerealis was 39.98%, and the inhibition rates on V. dahliae and M. oryzae were 54.23% and 50.70%, respectively. Except for F. graminearum, the inhibition rate of strain 2A1 on other pathogens was higher than 39%.

[0101] Example 3

[0102] This example detects the inhibitory effect of the fermentation broth of strain 2A1 on the growth of three pathogens.

[0103] The specific contents of this embodiment are as follows:

[0104] Strain 2A1 was cultured on a PDA medium plate, and then 5 5mm bacterial plates were placed in 100mL PDB liquid medium. After culturing at 25°C and 200r / min for 7 days, the culture was filtered with 3 layers of sterile filter cloth, centrifuged at 5000rpm for 8min at 25°C, and the supernatant was passed through a 0.22μm bacterial filter to remove spores. The resulting fermentation broth was stored at 4°C for later use. Note: The formula of PDA medium is as follows: 200g potato, 15g agar powder, 20g glucose, and ddH2O is fixed to 1L. The formula of PDB liquid medium is as follows: 200g potato, 20g glucose, and ddH2O is fixed to 1L.

[0105] The fermentation broth of the strain 2A1 was mixed with the cooled autoclaved PDA medium to obtain mixed medium with a volume ratio of 25%, 50% and 75% (v / v), and then 15 mL of the mixed medium was poured on a 9-cm culture dish. After the culture medium was cooled and solidified, the center of the plate was inoculated with Pseudomonas graminearum CF14047, Fusarium graminearum PH-1, and Rhizoctonia graminearum R0301, with 3 replicates for each concentration. At the same time, the PDA medium without mixed fermentation broth was used as a blank control. After culturing for 5 days in the dark at 25°C, the colony diameter was measured in a cross-cross manner, and the inhibition rate was calculated. The results are shown in Tables 2 and Figure 5 shown.

[0106] Table 2. Inhibitory effect of strain 2A1 fermentation broth on pathogen growth (%)

[0107]

[0108] The results showed that the fermentation broth of strain 2A1 at different concentration gradients inhibited the growth of Fusarium graminearum CF14047, Fusarium graminearum PH-1 and Rhizoctonia graminearum R0301. As the concentration of the fermentation broth increased, its inhibitory effect on pathogens also increased.

[0109] The fermentation broth of strain 2A1 has shown significant antibacterial effects on Pseudomonas graminearum CF14047 and Rhizoctonia graminearum R0301 at a concentration of 50%, with an inhibition rate of more than 70%, almost completely inhibiting the growth of pathogenic mycelium; when the concentration is increased to 75%, the fermentation broth of strain 2A1 can completely inhibit the growth of pathogenic mycelium. The fermentation broth of strain 2A1 significantly inhibited Fusarium graminearum PH-1 at a concentration of 75%, with an inhibition rate of more than 50%; the inhibitory effect of strain 2A1 fermentation broth 2 on Pseudomonas graminearum and Rhizoctonia graminearum is better than that on Fusarium graminearum.

[0110] Example 4

[0111] This example detects the inhibitory effect of the fermentation broth of strain 2A1 on the germination of spores of F. graminearum.

[0112] The specific contents of this embodiment are as follows:

[0113] Pseudofusomyces graminearum CF14047 was cultured on PDA medium at 25°C for 3 days, the mycelium was scraped into 100 mL of mung bean soup medium, and the culture was shaken at 175 rpm at 25°C for 3 days. The spores were filtered and centrifuged (5000 rpm, 8 min) with two layers of sterile filter cloth, the supernatant was removed, diluted with sterile water, and the spore concentration was calculated using a hemocytometer and adjusted to 5 × 10 6 Pieces / mL.

[0114] 5 mL of the fermentation broth of strain 2A1 (obtained according to the method in Example 3) was mixed with 5 mL of spore solution of F. graminearum CF14047 (5×10 6 Spores / mL) were mixed in a ratio of 1:1 (v / v) and placed in a 50 mL sterile tube. In addition, PDB liquid culture medium and YEPD liquid culture medium were used as controls, respectively. All test tubes were shaken (180 rpm) at 25°C in the dark, and the spore germination rate was detected 7 hours and 10 hours after culture. The germination of 40 conidia was evaluated. The calculation formula for the conidia germination inhibition rate is: I (%) = [(Nc-Nt) / Nc] × 100%, where Nc is the number of germinated spores in the control group, and Nt is the number of germinated spores in the treatment group.

[0115] The results are shown in Table 3 and Figure 6 shown.

[0116] Table 3. Inhibitory effect of strain 2A1 fermentation broth on CF14047 spore germination (%)

[0117]

[0118] The results showed that compared with the control group, the fermentation broth of strain 2A1 significantly inhibited the germination of the spores of Fusarium graminearum CF14047. After 7 hours of treatment, the germination of the spores was 100% inhibited. After 10 hours of treatment, the inhibition rate was as high as 95.28%, indicating that the fermentation broth of strain 2A1 has a good inhibitory effect on the germination of the spores of Fusarium graminearum CF14047.

[0119] Example 5

[0120] This example detects the inhibitory effect of the fermentation liquid of strain 2A1 on the stem rot pathogen on wheat coleoptiles.

[0121] The specific contents of this embodiment are as follows:

[0122] Soak Huaimai 33 seeds for 2 hours and rinse with sterile water three times. Place 3 sterile filter papers at the bottom of the culture dish and soak them. Cover each dish with 11 wheat seeds and place them in a 25°C incubator for 12 hours of light and 12 hours of darkness. When the wheat coleoptile grows 3 cm, cut a small wound on the top of the coleoptile and drop 2 μL of spore solution of Fusarium graminearum CF14047 (spore solution concentration is 5×10 6 spores / mL, spore solution was obtained according to the method in Example 3), 2 μL of sterile water was added to the blank control, and the coleoptile was wrapped with a sterile cotton ball on the second day, and 150 μL of strain 2A1 fermentation liquid (fermentation liquid was obtained according to the method in Example 3) was added to the cotton ball. The control was not wrapped with cotton balls. After 6 days of growth, the height and fresh weight of the wheat seedlings were measured, and the length of the lesions was measured. The results are shown in Table 4 and Figure 7 shown.

[0123] Table 4. Effect of the fermentation liquid of strain 2A1 on the growth of stem base rot pathogens on coleoptiles (cm)

[0124]

[0125] The results showed that compared with the control group (CK), the length of wheat lesions after fermentation liquid treatment was significantly different from that of the control group (CK), and the length of lesions was significantly lower than that of the control group, indicating that the fermentation liquid of strain 2A1 significantly reduced the infection of the pathogen Fusarium graminearum CF14047 on wheat plants.

[0126] Example 6

[0127] This example is a potted plant protection test of the fermentation liquid of strain 2A1 against Fusarium graminearum CF14047.

[0128] The specific contents of this embodiment are as follows:

[0129] (1) Preparation of diseased rice grains

[0130] The pseudo-graminearum Fusarium CF14047 was activated on PDA medium, and the bacterial cake was cut at the edge of the colony. The bacterial cake was inoculated into mung bean soup and cultured at 25°C and 175 r / min for 3 days. The mycelium was filtered by three layers of sterile filter cloth, and the conidia concentration was adjusted to 5×10 5 Conidia / mL, 10mL spore liquid was inoculated for every 50g of millet, and cultured in the dark at 25℃ for 5-7d to obtain diseased rice grains. The special matrix for seedling cultivation (purchased from Jiangsu Xingnong Matrix Technology Co., Ltd.) was placed in a 121℃ oven for 6h for sterilization to obtain a sterile matrix. The diseased rice grains and the sterile matrix were uniformly mixed at a mass ratio of 0.5% to obtain a contaminated matrix for standby use.

[0131] (2) Inhibitory effect of the fermentation liquid of strain 2A1 on wheat stem rot

[0132] The disinfected Huaimai 33 seeds were placed in a culture dish lined with moist filter paper, and germinated at 26°C and 12h / 12h alternating light and dark conditions until the seeds turned white. The white seeds were planted in a bacterial matrix; a blank control was set up, in which one treatment was sown in a sterile matrix as a negative control, and the remaining treatments were sown in a bacterial matrix as a positive control; 16 grains of wheat were planted in each pot, and 3 pots were planted per treatment; the wheat was cultured at 26°C, 12h light, and 12h dark conditions. When the wheat grew to about 3cm, the 2A1 group was irrigated with 20mL / pot of the fermentation liquid of strain 2A1 (the fermentation liquid was obtained according to the method in Example 3), the blank control group was irrigated with PDB liquid culture medium, and the drug control group was irrigated with a suspension of chloramphenicol (Zhengzhou Leading Chemical Co., Ltd.). After 30 days of growth, the occurrence of wheat stem base rot and the growth of wheat were investigated. The results are shown in Table 5. Figure 8 , Fig. 9 shown.

[0133] Table 5. Effect of strain 2A1 fermentation liquid on wheat growth (cm)

[0134]

[0135] The results showed that compared with the positive control, the incidence of wheat stem base rot in the fludioxonil group and the 2A1 group was reduced to varying degrees. The length of the root lesions in the fludioxonil group and the 2A1 group was lower than that in the positive control, and the incidence of wheat in the fludioxonil group was lower than that in the 2A1 group. The plant height and fresh weight of wheat in the 2A1 group were higher than those in the CK group and slightly lower than those in the fludioxonil group.

[0136] In addition to the above embodiments, the present invention may also have other implementation modes. Any technical solution formed by equivalent replacement or equivalent transformation falls within the protection scope required by the present invention.

Claims

1. A biocontrol strain, which is Penicillium fructuariae-cellaei 2A1, is deposited in the China General Microbiological Culture Collection Center with a deposit number of CGMCC NO.41539.

2. The fermentation liquid of the biocontrol strain according to claim 1.

3. A method for preparing a biocontrol strain fermentation broth, comprising the following steps: The first step is to culture the biocontrol strain according to claim 1 on a PDA medium plate, and then take a bacterial plate; put the bacterial plate into a PDB liquid medium, and culture it at 25°C ± 1°C with shaking to obtain a fermentation mixture; The second step is to filter the fermentation mixture, centrifuge the obtained liquid to obtain the supernatant, and pass the supernatant through a bacterial filter to remove spores, thereby obtaining the biocontrol strain fermentation liquid.

4. The method for preparing a biocontrol strain fermentation broth according to claim 3, characterized in that, in the first step, the diameter of the bacterial plate is 5±1 mm, the number of bacterial plates: the volume of the PDB liquid culture medium = 5: 100±10 mL; the culture conditions are: the rotation speed is 200-250 r / min, and the time is at least 7 days.

5. according to the preparation method of a kind of biocontrol strain fermentation liquid of claim 3, it is characterized in that, in the first step, described PDA medium is composed of the following components: potato 200g, agar powder 15g, glucose 20g, ddH2O is settled to 1L; described PDB liquid medium is composed of the following components: potato 200g, glucose 20g, ddH2O is settled to 1L.

6. The method for preparing a biocontrol strain fermentation liquid according to claim 3, characterized in that: In the second step, at least three layers of sterile filter cloth are used for filtration; the centrifugation conditions are: at 25°C±1°C, 5000-6000 rpm for at least 8 minutes; the pore size of the bacterial filter is less than or equal to 0.22 μm.

7. Use of the biocontrol strain according to claim 1 or the fermentation liquid according to claim 2 for preparing a biocontrol agent for inhibiting Fusarium graminearum, Rhizoctonia graminearum, Verticillium dahliae, and Magnaporthe grisea.

8. Use of the biocontrol strain according to claim 1 or the fermentation liquid according to claim 2 for preparing a biocontrol agent for preventing and controlling wheat stem base rot, wheat sheath blight, cotton Verticillium wilt, or rice blast.

9. A biocontrol agent comprising the biocontrol strain according to claim 1 or the fermentation liquid according to claim 2.

10. Use of the biocontrol agent according to claim 9 for preventing and controlling wheat stem base rot, wheat sheath blight, cotton Verticillium wilt, or rice blast.

Images