Dehydrogenase variants, combined enzymes, bioelectrodes and their applications in the synthesis of S-configuration boson

Abstract

The present invention relates to the field of biotechnology, and in particular to dehydrogenase variants, enzyme combinations, bioelectrodes, and their use in synthesizing S-configuration bosonine. The present invention provides dehydrogenase variants, enzyme combinations, bioelectrodes, and their use in bosonine synthesis. By screening and mutating dehydrogenases, the present invention obtains enzyme mutants, enzyme combinations, and bioelectrodes that can be used for enzymatic electrobiosynthesis of bosonine. The enzyme mutants, enzyme combinations, and bioelectrodes are used in the synthesis of bosonine, resulting in high-purity bosonine with few byproducts and easy further purification, which is conducive to industrial promotion and application.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a dehydrogenase variant, a combined enzyme, a bioelectrode and applications thereof in synthesizing S-configuration boson. Background Art

[0002] Bose TM (Pro-Xylane TM Hydroxypropyl tetrahydropyrantriol (cas 439685-79-7), launched by L'Oréal in France in 2006, is the first green chemistry ingredient in the cosmetics industry. It promotes the synthesis of glycosaminoglycans (GAGs) in the dermis. The S-configuration of hydroxypropyl tetrahydropyrantriol (cas 868156-46-1) is more active than the R-configuration (Cavezza et al. 2009).

[0003] In the prior art, there are methods that selectively reduce β-acetone xylosidoside as a substrate, isopropanol as a reducing agent, and nicotinamide adenine dinucleotide phosphate (NADP) as a cofactor to obtain the S-configuration bosonine under the action of ketoreductase and alcohol dehydrogenase. There are methods that selectively reduce β-acetone xylosidoside as a substrate, sodium phosphite as a reducing agent, and NADP as a cofactor to obtain the S-configuration bosonine under the action of ketoreductase and phosphite dehydrogenase. There are also methods that selectively reduce β-acetone xylosidoside as a substrate, glucose as a reducing agent, and NADP as a cofactor to obtain the S-configuration bosonine under the action of ketoreductase and glucose dehydrogenase. These reducing agents will oxidize to byproducts such as acetone, phosphoric acid, and gluconolactone. Summary of the Invention

[0004] In view of this, the technical problem to be solved by the present invention is to provide a dehydrogenase variant, a combined enzyme, a bioelectrode and the application thereof in the synthesis of S-configuration boson.

[0005] The present invention provides a dehydrogenase variant, which comprises a dehydrogenase with an amino acid sequence as shown in SEQ ID NO: 1, wherein the arginine at position 285 is mutated to glycine or alanine.

[0006] The present invention provides a combination enzyme comprising at least one of the following combinations:

[0007] Combination 1: the dehydrogenase variant of claim 1 and a ketoreductase;

[0008] Combination 2: dehydrogenase and ketoreductase.

[0009] Furthermore, the dehydrogenase is selected from at least one or more of the following:

[0010] Dehydrogenase (DFDH01) having an amino acid sequence as shown in SEQ ID NO: 1; and / or

[0011] Dehydrogenase (DFDH02) having an amino acid sequence as shown in SEQ ID NO: 3; and / or

[0012] A dehydrogenase (DFDH03) consisting of a large subunit with an amino acid sequence as shown in SEQ ID NO: 5 and a small subunit with an amino acid sequence as shown in SEQ ID NO: 6; and / or

[0013] A dehydrogenase (DFDH04) consisting of a large subunit with an amino acid sequence as shown in SEQ ID NO: 8 and a small subunit with an amino acid sequence as shown in SEQ ID NO: 9; and / or

[0014] A dehydrogenase (DFDH05) composed of a large subunit having an amino acid sequence as shown in SEQ ID NO: 11 and a small subunit having an amino acid sequence as shown in SEQ ID NO: 12;

[0015] The amino acid sequence of the ketoreductase is shown in SEQ ID NO: 14.

[0016] In the present invention, in the process of synthesizing boson using an enzyme-electrochemical system, dehydrogenases are first screened and selected, and dehydrogenases suitable for synthesizing boson using an enzyme-electrochemical method are obtained from DFDH01 to DFDH05; experimental results show that a bioelectrode using a dehydrogenase with an amino acid sequence as shown in SEQ ID NO: 1 exhibits the strongest electroreduction ability; on this basis, the dehydrogenase with an amino acid sequence as shown in SEQ ID NO: 1 is mutated, and experimental results show that after the arginine at position 285 of the dehydrogenase with an amino acid sequence as shown in SEQ ID NO: 1 is mutated to glycine or alanine, the conversion rate and purity are further improved, wherein the bioelectrode with an amino acid sequence as shown in SEQ ID NO: 1 exhibits the strongest electroreduction ability. The optimal mutation of arginine at position 285 of the dehydrogenase shown in NO:1 to glycine resulted in a conversion rate of 99.5% after 5 hours of reaction and a residual β-acetone xyloside content of 0.46%. Compared with other existing technologies, the conductivity was lower, making it more suitable for purification. The finished product obtained through separation and purification had a purity of 99.41%, a content of 100.25%, a moisture content of 0.23%, and a conductivity of 4.91 μS / cm (other existing technologies resulted in excessively high conductivity, which increased the difficulty and cost of purification and reduced product quality).

[0017] In the present invention, the DFDH03 to DFDH05 all include large and small subunits. In the specific reaction of the present invention, the purified proteins of DFDH03 to DFDH05 are used to participate in the reaction. Without being treated with chemical substances, the large and small subunits function as dehydrogenases in the form of a complex. When treated with chemical substances, such as during electrophoresis, SDS acts on the protein, causing the large and small subunits to disaggregate and form the following: Figure 3 the electrophoretic pattern;

[0018] The present invention provides nucleic acids comprising nucleic acids encoding the dehydrogenase variants of the present invention and / or the combined enzymes of the present invention.

[0019] In the present invention, the nucleic acid encoding the dehydrogenase variant is shown in SEQ ID NO: 2.

[0020] The nucleic acid encoding the recombinant antigen described in the present invention can be DNA, RNA, cDNA or PNA. In an embodiment of the present invention, the nucleic acid is in the form of DNA. The DNA form includes cDNA, genomic DNA or artificially synthesized DNA. The DNA can be single-stranded or double-stranded. The nucleic acid can include nucleotide sequences with different functions, such as coding regions and non-coding regions such as regulatory sequences (e.g., promoters or transcription terminators). The nucleic acid can be linear or circular in topology. The nucleic acid can be a part of a vector (such as an expression or cloning vector), or a fragment. The nucleic acid can be obtained directly from a natural source, or can be prepared with the assistance of recombination, enzymatic methods or chemical techniques. The DNA can also be obtained by reverse transcription of the RNA.

[0021] In the present invention, the nucleic acid may be optimized or unoptimized; these optimizations include but are not limited to: codon usage preference, elimination of secondary structures that are not conducive to expression (such as hairpin structures), changes in GC content, CpG dinucleotide content, mRNA secondary structure, cryptic splicing sites, early polyadenylation sites, internal ribosome entry sites and binding sites, negative CpG islands, RNA unstable regions, repetitive sequences (direct repeats, inverted repeats, etc.) and restriction sites that may affect cloning.

[0022] The present invention also provides a transcription unit, which refers to a DNA sequence starting from a promoter and ending at a terminator. The promoter and terminator may also be flanked or interposed with regulatory segments, which may include a promoter, enhancer, transcription termination signal, polyadenylation sequence, replication origin, nucleic acid restriction site, and homologous recombination site operably linked to the nucleic acid sequence, such as a promoter enhancer and a poly(A) signal.

[0023] The present invention provides a recombinant vector comprising the nucleic acid of the present invention and a vector backbone.

[0024] The sources of the vector backbone described in the present invention include plants, animals, bacteria, fungi, phages, or viruses, and the present invention is not limited to this. Specifically, the vector backbone described in the present invention is derived from bacteria or fungi. The recombinant vector described in the present invention refers to a recombinant nucleic acid vector, which is a recombinant DNA molecule that contains a desired coding sequence and an appropriate nucleic acid sequence or element that is essential for the expression of an operably linked coding gene in a specific host organism. In this specification, "plasmid" and "vector" can sometimes be used interchangeably because plasmid is the most commonly used vector form. In specific embodiments, the nucleic acid encoding the present invention can be constructed into various prokaryotic expression vectors, for example, pET series vectors, specifically pET28a.

[0025] The present invention provides a host cell, the genome of which is integrated with the nucleic acid of the present invention, or is transfected or transformed with the recombinant vector of the present invention.

[0026] The host cells provided herein may be derived from plants, animals, bacteria, fungi, bacteriophages, or viruses, but are not limited thereto. The present invention utilizes vectors constructed using recombinant DNA technology to transform or transfect host cells, such that the transformed host cells are capable of replicating protein-encoding vectors or expressing desired proteins. In specific embodiments of the present invention, the host cells are bacteria, specifically Escherichia coli, and more specifically Escherichia coli BL21 (DE3).

[0027] The present invention provides a bioelectrode comprising an electrode and a mixture applied to the electrode; the mixture comprises the dehydrogenase variant of the present invention, a methacryloylethyl viologen redox polymer, and polyethylene glycol diglycidyl ether;

[0028] The methacryloylethyl viologen redox polymer has a structure as shown in Formula I:

[0029]

[0030] Wherein, x represents the number of repeating units derived from methacryloylethyl viologen, and y represents the number of repeating units derived from vinylimidazole;

[0031] The methacryloylethyl viologen redox polymer is obtained from methacryloylethyl viologen and vinyl imidazole in a molar ratio of (4-9):1;

[0032] In a specific embodiment of the present invention, the methacryloylethyl viologen redox polymer is obtained from methacryloylethyl viologen and vinyl imidazole in a molar ratio of 6:1;

[0033] The electrode is selected from a glassy carbon electrode, a carbon paper electrode, a carbon cloth electrode, a carbon fiber electrode, a carbon mesh electrode, a carbon felt electrode or a titanium electrode; all of the above electrodes can be used for the enzymatic electrosynthesis of bosonine of the present invention. In a specific embodiment of the present invention, a glassy carbon electrode is used.

[0034] In a specific embodiment of the present invention, the methacryloylethyl viologen redox polymer is prepared by the following steps:

[0035] Step 1, 4,4'-bipyridine and iodoethane undergo a first reaction to obtain monoethyl viologen;

[0036] Step 2: Monoethyl viologen and methacryloyl chloride undergo a second reaction to obtain methacryloylethyl viologen;

[0037] Step 3: Methacrylethyl viologen and vinylimidazole are subjected to a third reaction using ammonium persulfate as an initiator and N,N,N',N'-tetramethylethylenediamine as a promoter to obtain the methacryloylethyl viologen redox polymer;

[0038] The method further comprises the step of terminating the reaction with glacial methanol after step 3.

[0039] The conditions of the first reaction are reflux at 60°C for 8 to 16 hours;

[0040] The conditions of the second reaction are reflux at 90°C for 8 to 16 hours;

[0041] The condition of the third reaction is 60°C;

[0042] In step 1, the concentration ratio of 4,4'-bipyridine to iodine ethane is 1:(2-3), specifically 24:56; in a specific embodiment of the present invention, the added amounts of 4,4'-bipyridine and iodine ethane are 24 mM and 56 mM, respectively;

[0043] In step 2, the concentration ratio of monoethyl viologen and methacryloyl chloride is 1:(1.5-3), specifically 1:2; in a specific embodiment of the present invention, the added amounts of monoethyl viologen and methacryloyl chloride are 10 mM and 20 mM, respectively;

[0044] In step 3, the concentration ratio of the methacryloylethyl viologen and vinyl imidazole is (4-8):1; specifically 6:1; in a specific embodiment of the present invention, the added amounts of monoethyl viologen and methacryloyl chloride are 6 mM and 1 mM, respectively;

[0045] Furthermore, in the bioelectrode mixture of the present invention,

[0046] The concentration of the dehydrogenase variant according to claim 1 is 8 to 12 mg / ml, specifically 10 mg / ml;

[0047] The concentration of the methacryloylethyl viologen redox polymer is 35-45 mg / ml, specifically 40 mg / ml;

[0048] The concentration of polyethylene glycol diglycidyl ether is 2-4 mg / ml, specifically 3 mg / ml; in the present invention, the molecular weight of the polyethylene glycol diglycidyl ether is 400-600; in a specific embodiment of the present invention, the molecular weight of the polyethylene glycol diglycidyl ether is 500.

[0049] The present invention provides the use of at least one of the following I) to VII) in Bose synthesis:

[0050] 1), the dehydrogenase variant of the present invention;

[0051] II), the combined enzyme of the present invention;

[0052] III), the nucleic acid of the present invention;

[0053] IV), the recombinant vector of the present invention;

[0054] V), the host cell of the present invention;

[0055] VI), culturing the host cell of the present invention to obtain a culture;

[0056] VII), the bioelectrode according to the present invention.

[0057] The present invention provides a method for synthesizing boson, which comprises synthesizing boson using at least one of the following i) to vii):

[0058] i) the dehydrogenase variants of the present invention;

[0059] ii), the combined enzyme of the present invention;

[0060] iii), the nucleic acid of the present invention;

[0061] iv) the recombinant vector of the present invention;

[0062] v) the host cell of the present invention;

[0063] vi) culturing a culture obtained by culturing the host cell of the present invention;

[0064] vii) The bioelectrode according to the present invention.

[0065] The present invention provides dehydrogenase variants, enzyme combinations, bioelectrodes, and their use in boson synthesis. By screening and mutating dehydrogenases, the present invention obtains enzyme mutants, enzyme combinations, and bioelectrodes that can be used for enzymatic electrobiosynthesis of boson. The enzyme mutants, enzyme combinations, and bioelectrodes are used for the synthesis of boson, and the boson has high purity, few by-products, and is easy to further purify, which is conducive to industrial promotion and application. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] Figure 1 The synthetic route of methacryloylethyl viologen (MMEV) is shown;

[0067] Figure 2 The polymerization reaction formula of methacryloylethyl viologen redox polymer is shown;

[0068] Figure 3 Shown is the electrophoresis diagram of dehydrogenase DFDH01-05 protein.

[0069] Figure 4 shows the cyclic voltammogram of the dehydrogenase bioelectrode;

[0070] Figure 5 The conversion rate of electrocatalytic synthesis of S-configuration boson by DFDH01 enzyme / DFDH01-R285G enzyme is shown;

[0071] Figure 6 The liquid phase diagram of the electrocatalytic synthesis of S-configuration Bose-A by DFDH01 enzyme for 7 hours is shown;

[0072] Figure 7 The liquid phase diagram of the electrocatalytic synthesis of S-configuration Bose-like by DFDH01 enzyme for 24 hours;

[0073] Figure 8 The crystal structure of DFDH01 (2NAD) is shown, and the ball-and-stick model represents NAD;

[0074] Figure 9 The liquid phase diagram of the electrocatalytic synthesis of S-configuration Bose-like by DFDH01-R285G enzyme for 5 hours;

[0075] Figure 10 Shown is the liquid phase diagram of the 5-h electrocatalytic synthesis of S-configuration Bose-A by DFDH01-R285A enzyme. DETAILED DESCRIPTION

[0076] The present invention provides dehydrogenase variants, combined enzymes, bioelectrodes, and their use in the synthesis of S-configuration bosons. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve the desired results. It should be noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications herein without departing from the content, spirit, and scope of the present invention to implement and apply the technology of the present invention.

[0077] The β-acetone xyloside used was homemade, and the method referred to patent CN113717997B; NAD (nicotinamide adenosine dinucleotide) was a commercial product of the company; other chemical reagents were purchased from Beijing Inokai Technology Co., Ltd.

[0078] Amino acid sequence of DFDH01 (Pseudomonas sp.101):

[0079]

[0080] Nucleotide sequence of DFDH01 (codon-optimized):

[0081]

[0082] Amino acid sequence of DFDH02 (Methylorubrum extorquens AM1):

[0083]

[0084] Nucleotide sequence of DFDH02 (codon optimized):

[0085]

[0086]

[0087] Amino acid sequence of the large subunit of DFDH03 (Rhodobacter capsulatus):

[0088]

[0089] Amino acid sequence of the small subunit of DFDH03 (Rhodobacter capsulatus):

[0090]

[0091] Nucleotide sequence of DFDH03 (Rhodobacter capsulatus):

[0092]

[0093] Amino acid sequence of the large subunit of DFDH04 (Thermotoga maritima):

[0094]

[0095] Amino acid sequence of the small subunit of DFDH04 (Thermotoga maritima):

[0096]

[0097] Nucleotide sequence of DFDH04 (codon optimized):

[0098]

[0099]

[0100] Amino acid sequence of the large subunit of DFDH05 (Thermus thermophilus):

[0101]

[0102] Amino acid sequence of the DFDH05 small subunit (Thermus thermophilus):

[0103]

[0104] DFDH05 nucleotide sequence (codon optimized):

[0105]

[0106] RDH G95L / D193Q / L209F Amino acid sequence:

[0107]

[0108] DFDH01-R285G-up:ctttatattgttaacactgctggtggtaaattatgtgatcgtg (SEQ ID NO: 15);

[0109] DFDH01-R285G-dn: acgatcacataatttaccaccagcagtgttaacaatataagc (SEQ ID NO: 16);

[0110] DFDH01-R285A-up:ctttatattgttaacactgctgctggtaaattatgtgatcgtg (SEQ ID NO: 17);

[0111] DFDH01-R285A-dn: cacgatcacataatttaccagcagcagtgttaacaatataag (SEQ ID NO: 18);

[0112] Amino acid sequence of DFDH01-R285G:

[0113]

[0114] Nucleotide sequence of DFDH01-R285G (codon optimized):

[0115]

[0116] The test materials used in the present invention are all common commercial products and can be purchased on the market. The present invention is further described below with reference to the following examples:

[0117] Example 1 Preparation of Redox Polymers

[0118] Weigh 3.78 g of 4,4'-bipyridine (cas 553-26-4, 24 mM) and dissolve it in 1 L of acetone. Add 8.73 ml of iodoethane (cas 75-03-6, 56 mM) dropwise with slow stirring. Then, heat under reflux at 60°C overnight to produce monoethyl viologen (MEV) as an orange solid, which was then dried and stored.

[0119] Dissolve 2.78 g of monoethyl viologen (10 mM) and 3.14 ml of methacryloyl chloride (cas920-46-7, 20 mM) in 1.5 L of acetonitrile, then heat under reflux at 90 ° C overnight to generate yellow solid methacryloyl ethyl viologen (MMEV, the synthesis route is as follows: Figure 1 ), keep in a dry place.

[0120] 1.56 g of methacryloylethyl viologen (6 mM) was dissolved in 1 L of 50% tetrahydrofuran aqueous solution. 94 μl of 1-vinylimidazole (cas 1072-63-5, 1 mM) was added dropwise with slow stirring. Then, 7 μl of a 10% (w / v, where w is g; v is ml) aqueous ammonium persulfate (APS) solution and 0.5 μl of TEMED (N,N,N',N'-tetramethylethylenediamine) were added. Polymerization was carried out by heating at 60°C. The polymer solution was added to ice-cold methanol to precipitate the redox polymer (the synthesis of the redox polymer is shown in the following). Figure 2 Store refrigerated.

[0121] Example 2 Preparation of dehydrogenase bioelectrode

[0122] Dehydrogenase DFDH01 from Pseudomonas sp. 101 and dehydrogenase DFDH02 from Methylorubrum extorquens AM01 were selected and codon-optimized using the online tool OPTIMIZER (http: / / genomes.urv.es / OPTIMIZER / ) or JCat (https: / / www.jcat.de) before submission to Nanjing GenScript for whole-genome synthesis. Dehydrogenase DFDH03 from Rhodobacter capsulatus, dehydrogenase DFDH04 from Thermotoga maritima, and dehydrogenase DFDH05 from Thermus thermophilus were directly submitted for nucleotide sequence synthesis. All dehydrogenases were constructed into the pET-28a vector using the restriction enzymes NdeI and XhoI and then transformed into the BL21(DE3) expression host.

[0123] The obtained BL21 (DE3) glycerol culture was expanded in 500 ml LB liquid medium (Kan) at 37 ° C and 220 rpm to OD 600 =0.6-1.0, cooled to 20°C, and then 0.1 mM IPTG was added to induce expression for 16 h. The cells were collected by low-temperature centrifugation. 9 ml of disruption buffer (20 mM Na2HPO4 / NaH2PO4, 100 mM NaCl, pH 7.6) was added to 1 g of wet cells, resuspended, and then ultrasonically disrupted. The supernatant was centrifuged and affinity purified using Ni-NTA agarose gel (QIAGEN). The 250 mM imidazole eluate was collected and concentrated using a 10 kD ultrafiltration centrifuge tube, and the disruption buffer was replaced and concentrated to ~10 mg / ml (the electrophoresis diagram of the dehydrogenase DFDH01-05 protein is shown in Figure 2). Figure 3 ), aliquot and store at -80℃.

[0124] Mix 60 μl of concentrated enzyme solution (10 mg / ml), 60 μl of methacryloylethyl viologen redox polymer (40 mg / ml), and 100 μl of polyethylene glycol diglycidyl ether aqueous solution (PEGDEG, cas 39443-66-8, 3 mg / ml), add dropwise to a 7.5 cm × 3.5 cm glassy carbon electrode, and allow to dry overnight at room temperature. Five dehydrogenase bioelectrodes were obtained in sequence.

[0125] Example 3 Performance Test of Dehydrogenase Bioelectrode

[0126] The dehydrogenase bioelectrode prepared in Example 2 and a commercial silver chloride (Ag / AgCl) reference electrode were placed in an electrolyte (1 mM NAD, 100 mM Na2HPO4 / NaH2PO4, pH 7.0) and connected to a Shanghai Chenhua CHI600F electrochemical workstation with a scan rate of 100 mA / s. Figure 4 As shown in the cyclic voltammogram, the DFDH01 enzyme bioelectrode shows the strongest electroreduction ability, the DFDH02 enzyme bioelectrode and the DFDH03 enzyme bioelectrode show strong electroreduction ability and certain electrooxidation ability, while the DFDH04 enzyme bioelectrode and the DFDH05 enzyme bioelectrode show balanced electroredox ability.

[0127] The dehydrogenase bioelectrode and the platinum counting electrode form a polarization current loop, which in turn forms a measurement and control loop with the silver chloride (Ag / AgCl) reference electrode. Almost no current flows through the measurement and control loop, and it is not affected by the polarization loop current. This three-electrode system can achieve precise measurement or control of current and potential.

[0128] Example 4 Electrocatalytic Synthesis of S-Configuration Boson by DFDH01 Enzyme

[0129] Weigh 47.55g of β-acetone xyloside (500mM) and 0.33g of NAD (nicotinamide adenine dinucleotide, 1mM) and dissolve them in 450ml of pure water. Adjust the pH to 6.0 and dilute to 487.5ml. Add 12.5ml of ketoreductase RDH used in patent CN113717997B. G95L / D193Q / L209F The crude enzyme solution (10 U / ml) was crushed. The reaction solution was preheated to 38°C and inserted into the DFDH01 enzyme bioelectrode prepared in Example 2 and a commercial silver chloride (Ag / AgCl) reference electrode. A commercial platinum counter electrode was inserted into 100 mM Na2HPO4 / NaH2PO4, pH 7.0. A constant voltage of -0.7 V was maintained. During the reaction, a potentiometric titrator was used to monitor and adjust the reaction pH to 6.0.

[0130] During the reaction, a sample was diluted 40 times with 90% acetonitrile and subjected to high performance liquid chromatography (HPLC) to detect the formation of the product and calculate the conversion rate of β-acetone xyloside to S-configuration bosonine. Figure 5 and Figure 6 As shown, the conversion rate was 96.3% after 7 hours of reaction, and 3.4% of β-acetone xyloside remained. The reaction was extended to 24 hours ( Figure 7 ), the β-acetone xyloside residue can be further reduced to 0.69%, but the excessively long reaction time reduces the production efficiency and is not easy to scale up production in a factory.

[0131] Example 5 Rational design of DFDH01 enzyme

[0132] like Figure 8 As shown, the arginine (Arg) at position 285 of DFDH01 may hinder electron transfer. Primers DFDH01-R285G-up and DFDH01-R285G-dn, and DFDH01-R285A-up and DFDH01-R285A-dn were designed. Using pET28a-DFDH01 as a template, the Novezan Mut Express II Fast Mutagenesis Kit was used to mutate Arg285 to glycine (Gly) or alanine (Ala). Following Example 2, DFDH01-R285G and DFDH01-R285A enzyme bioelectrodes were prepared.

[0133] Example 6 Electrocatalytic Synthesis of S-Configuration Boson by DFDH01-R285G Enzyme

[0134] Weigh 47.55g of β-acetone xyloside (500mM) and 0.33g of NAD (nicotinamide adenine dinucleotide, 1mM) and dissolve them in 450ml of pure water. Adjust the pH to 6.0 and dilute to 487.5ml. Add 12.5ml of ketoreductase RDH G95L / D193Q / L209F The crude enzyme solution (10 U / ml) was crushed. The reaction solution was preheated to 38°C and inserted into the DFDH01-R285G enzyme bioelectrode prepared in Example 5 and a commercial silver chloride (Ag / AgCl) reference electrode. A commercial platinum counter electrode was inserted into 100 mM Na2HPO4 / NaH2PO4, pH 7.0. A constant voltage of -0.7 V was maintained. During the reaction, a potentiometric titrator was used to monitor and adjust the reaction pH to 6.0.

[0135] During the reaction, a sample was diluted 40 times with 90% acetonitrile and subjected to high performance liquid chromatography (HPLC) to detect the formation of the product and calculate the conversion rate. Figure 9As shown, the reaction yield was 99.5% after 5 hours, with 0.46% residual β-acetone xyloside. The finished product obtained after separation and purification had a purity of 99.41%, a content of 100.25%, a moisture content of 0.23%, and a conductivity of 4.91 μS / cm, meeting all acceptable standards. The conductivity of S-bosine produced by the chemoenzymatic process patented in CN113717997B ranged from 20 to 80 μS / cm. The conductivity of S-bosine synthesized by enzymatic electrocatalysis was significantly superior to that of the chemoenzymatic process (which resulted in excessively high conductivity, increased purification difficulty and cost, and reduced product quality).

[0136] Example 7 Electrocatalytic Synthesis of S-Configuration Boson by DFDH01-R285A Enzyme

[0137] Weigh 47.55g of β-acetone xyloside (500mM) and 0.33g of NAD (nicotinamide adenine dinucleotide, 1mM) and dissolve them in 450ml of pure water. Adjust the pH to 6.0 and dilute to 487.5ml. Add 12.5ml of ketoreductase RDH G95L / D193Q / L209F The crude enzyme solution (10 U / ml) was crushed. The reaction solution was preheated to 38°C and inserted into the DFDH01-R285A enzyme bioelectrode prepared in Example 5 and a commercial silver chloride (Ag / AgCl) reference electrode. A commercial platinum counter electrode was inserted into 100 mM Na2HPO4 / NaH2PO4, pH 7.0. A constant voltage of -0.7 V was maintained. During the reaction, a potentiometric titrator was used to monitor and adjust the reaction pH to 6.0.

[0138] During the reaction, a sample was diluted 40 times with 90% acetonitrile and subjected to high performance liquid chromatography (HPLC) to detect the formation of the product and calculate the conversion rate. Figure 10 As shown, the conversion rate was 99.2% after 5 hours of reaction, and the residual β-acetone xyloside was 0.71%. The finished product was separated and purified, with a purity of 99.22%, a content of 99.24%, a moisture content of 0.33%, and a conductivity of 4.56 μS / cm. All indicators were qualified.

[0139] The above are only preferred embodiments of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A dehydrogenase variant, characterized in that Its amino acid sequence is based on that shown in SEQ ID NO: 1, with the arginine at position 285 mutated to glycine or alanine.

2. A combined enzyme, characterized in that include: The dehydrogenase variant and ketoreductase according to claim 1; the amino acid sequence of the ketoreductase is shown in SEQ ID NO:

14.

3. Nucleic acid, characterized in that Encoding the dehydrogenase variant according to claim 1 and / or the combined enzyme according to claim 2.

4. A recombinant vector, characterized in that Comprising the nucleic acid of claim 3 and a vector backbone.

5. A host cell, characterized in that Genome integration of the nucleic acid according to claim 3, or transfection or transformation of the recombinant vector according to claim 4.

6. A bioelectrode, characterized in that Comprising an electrode and a mixture coated on the electrode; the mixture comprises the dehydrogenase variant according to claim 1, methacryloylethyl viologen redox polymer and polyethylene glycol diglycidyl ether; The methacryloylethyl viologen redox polymer has a structure as shown in Formula I: Formula I; Wherein, x represents the number of repeating units derived from methacryloylethyl viologen, and y represents the number of repeating units derived from vinylimidazole; The methacryloylethyl viologen redox polymer is obtained from methacryloylethyl viologen and vinyl imidazole in a molar ratio of (4-9):

1.

7. The bioelectrode according to claim 6, characterized in that In the mixture, The concentration of the dehydrogenase variant according to claim 1 is 8-12 mg / ml; The concentration of the methacryloylethyl viologen redox polymer is 35-45 mg / ml; The concentration of polyethylene glycol diglycidyl ether is 2~4 mg / ml.

8. Application of at least one of the following I) to VII) in Bose synthesis: 1), the dehydrogenase variant according to claim 1; II), the combined enzyme according to claim 2; III), the nucleic acid according to claim 3; IV), the recombinant vector according to claim 4; V), the host cell according to claim 5; VI), culturing a culture obtained by culturing the host cell according to claim 5; VII) The bioelectrode according to claim 6 or 7.

9. A method for synthesizing boson, characterized in that: The method comprises synthesizing boson using at least one of the following i) to vii): i), the dehydrogenase variant according to claim 1; ii), the combined enzyme according to claim 2; iii) the nucleic acid according to claim 3; iv) the recombinant vector according to claim 4; v) The host cell according to claim 5; vi), culturing a culture obtained by culturing the host cell according to claim 5; vii) The bioelectrode according to claim 6 or 7.

Images