KOD DNA polymerase mutant as well as production method and application thereof

Abstract

The invention provides a KOD DNA polymerase mutant as well as a production method and application thereof. The KOD DNA polymerase mutant has an amino acid sequence as shown in SEQ ID NO. 1. The production method comprises the following steps: culturing a recombinant host cell or a recombinant strain capable of secreting the KOD DNA polymerase mutant, and separating the KOD DNA polymerase mutant from the obtained culture product. The KOD DNA polymerase mutant disclosed by the invention has the characteristic of good amplification activity, and particularly has good amplification activity for large-fragment nucleic acid; the KOD DNA polymerase mutant is produced by adopting the production method disclosed by the invention, and the KOD DNA polymerase mutant has good soluble expression performance; the KOD DNA polymerase mutant disclosed by the invention has a good application prospect in the aspect of preparing a reagent and / or a kit for PCR (Polymerase Chain Reaction) amplification.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a KOD DNA polymerase mutant and a production method and application thereof. Background Art

[0002] Polymerase Chain Reaction (PCR) is a basic and key technology in modern molecular biology. It simulates the DNA replication process in vivo to achieve large-scale amplification of specific DNA fragments in vitro. Due to its high efficiency and specificity, PCR technology is widely used in gene cloning, genome sequencing, forensic identification, and diagnosis of genetic and infectious diseases.

[0003] KOD DNA polymerase, derived from Thermococcus kodakaraensis KOD1 strain, is a highly thermostable DNA polymerase that can be recombinantly expressed in Escherichia coli. The enzyme not only has DNA polymerase activity from 5' to 3', but also has exonuclease activity from 3' to 5', making it superior to Taq DNA polymerase in fidelity, about 50 times that of Taq enzyme. Compared with other existing DNA polymerases, its heat resistance and fidelity are stronger. Although KOD DNA polymerase has the above advantages, wild-type KOD DNA polymerase is limited in its ability to amplify long fragment DNA. Specifically, wild-type KOD DNA polymerase is less efficient when amplifying large fragment DNA fragments, which limits its use in applications that require amplification of long fragment DNA. Therefore, it is necessary to transform wild-type KOD DNA polymerase in order to improve its ability in amplifying long fragment DNA. Summary of the invention

[0004] In view of the deficiencies in the prior art, the present invention aims to provide a KOD DNA polymerase mutant and a production method and application thereof. The KOD DNA polymerase mutant of the present invention has the characteristics of good amplification activity, especially has good amplification activity for large fragments of nucleic acid; and the KOD DNA polymerase mutant is produced by the production method of the present invention, and the KOD DNA polymerase mutant has good soluble expression performance; the KOD DNA polymerase mutant of the present invention has good application prospects in preparing reagents and / or kits for PCR amplification.

[0005] The above objects of the present invention are achieved through the following technical solutions:

[0006] In a first aspect, the present invention provides a KOD DNA polymerase mutant, wherein the KOD DNA polymerase mutant has an amino acid sequence as shown in SEQ ID NO.1.

[0007] In a second aspect, the present invention provides a method for obtaining the KOD DNA polymerase mutant described in the first aspect, wherein the KOD DNA polymerase mutant is obtained by mutation of the wild-type KOD DNA polymerase at the following sites: T33N, F38I, E50D, T61K, T64R, V68A, Q72K, V80I, I107A, V127I, M137L, 153G, E154K, G167E, N175K, N176I, C223A, N229K, A231T, V282I, Q285K, T296A, T297E, L327F, K375R, Q382E, E385A, R476K, Y493F, R501 K, T522E, T524V, K526R, Y532F, I537L, S539A, M561K, A574L, L630I, D633H, K638E, V691I, R746K, S766G, T774K; and mutated in the following manner: KE is inserted between D235 and G236, L is inserted between R380 and R381, N is inserted between D552 and A553, and K is inserted at the end; wherein the wild-type KOD DNA polymerase has the amino acid sequence shown in SEQ ID NO.2.

[0008] In a third aspect, the present invention provides a nucleic acid molecule comprising a nucleotide fragment encoding the KOD DNA polymerase mutant described in the first aspect.

[0009] In some embodiments of the present invention, the nucleotide fragment has a base sequence as shown in SEQ ID NO.3.

[0010] In a fourth aspect, the present invention provides a recombinant expression vector comprising the nucleic acid molecule described in the third aspect.

[0011] In some embodiments of the present invention, the recombinant expression vector is formed by the recombination of the expression vector and the nucleic acid molecule described in the third aspect.

[0012] In some embodiments of the present invention, the expression vector is selected from the pET series expression vectors, preferably pET-32a plasmid, pET-28a plasmid or pET-41a plasmid.

[0013] In a fifth aspect, the present invention provides a recombinant host cell, wherein the recombinant host cell comprises the nucleic acid molecule described in the third aspect or the recombinant expression vector described in the fourth aspect.

[0014] In some embodiments of the invention, the host cell comprises a prokaryotic cell.

[0015] In some embodiments of the present invention, the host cell is a competent cell, preferably a BL21 (DE3) competent cell.

[0016] In a sixth aspect, the present invention provides a recombinant strain, wherein the recombinant strain comprises the recombinant host cell described in the fifth aspect.

[0017] In some embodiments of the present invention, the recombinant strain is obtained by transforming the recombinant expression vector described in the fourth aspect into a host bacterial species; preferably, the host bacterial species is selected from Escherichia coli.

[0018] In a seventh aspect, the present invention provides a method for producing the KOD DNA polymerase mutant according to the first aspect, the production method comprising the following steps:

[0019] The recombinant host cell of the fifth aspect or the recombinant strain of the sixth aspect is cultured, and the KOD DNA polymerase mutant is isolated from the obtained culture product.

[0020] In some embodiments of the present invention, the culture conditions include: the culture medium is selected from LB culture medium, preferably liquid LB culture medium; the culture temperature is 20-40° C.; and the inoculation amount is 0.5%-1.5%.

[0021] In some embodiments of the present invention, the separation comprises disrupting cells containing the KOD DNA polymerase mutant to release the KOD DNA polymerase mutant; preferably, the disruption is performed using an enzymatic and / or physical disruption method, preferably using an ultrasonic disruptor.

[0022] In some embodiments of the present invention, the separation includes centrifuging the culture medium to collect the bacteria before disrupting the cells containing the KOD DNA polymerase mutant, and resuspending the bacteria with a lysis buffer; preferably, the lysis buffer includes 20-50mM Tris-Cl, 50-500mM NaCl, 5%-10% glycerol, pH 7.8-8.8, and / or, when resuspending, the volume of the lysis buffer and the mass ratio of the bacteria is (50-1000)mL: (0.01-0.2)g.

[0023] In some embodiments of the present invention, the separation further comprises centrifuging the disrupted cell fluid and recovering the supernatant; preferably, the centrifugal speed of the centrifugation is 5000-15000 rpm, and / or the centrifugal time is 30-90 min.

[0024] In some embodiments of the present invention, the method further comprises purifying the isolated KOD DNA polymerase mutant; preferably, the purification is performed by affinity chromatography; more preferably, the purification comprises the following steps:

[0025] (1) The KOD DNA polymerase mutant to be purified was mixed with the Ni-NTA filler and incubated at 0-10°C for 10-20 min. Subsequently, the mixture was centrifuged at 1000-2000 rpm for 30-90 s and the liquid portion was collected.

[0026] Optionally, (2) collecting the filler obtained after centrifugation in step (1) and washing it sequentially with buffers containing 20 mM imidazole, 50 mM imidazole and 300 mM imidazole, collecting the washing liquid, and combining the washing liquid with the liquid portion collected in step (1).

[0027] In an eighth aspect, the present invention provides use of the KOD DNA polymerase mutant described in the first aspect or the KOD DNA polymerase mutant produced by the production method described in the seventh aspect in preparing reagents and / or kits for PCR amplification.

[0028] In a ninth aspect, the present invention provides a PCR amplification reagent, which comprises the KOD DNA polymerase mutant described in the first aspect or the KOD DNA polymerase mutant produced by the production method described in the seventh aspect.

[0029] In some embodiments of the present invention, the reagents further comprise at least one of PCR water, PCR reaction buffer and dNTPs.

[0030] In a tenth aspect, the present invention provides a PCR amplification kit, comprising the KOD DNA polymerase mutant described in the first aspect or the KOD DNA polymerase mutant produced by the production method described in the seventh aspect or the PCR amplification reagent described in the ninth aspect.

[0031] The beneficial effects of the present invention are as follows:

[0032] The KOD DNA polymerase mutant of the invention has the characteristics of good amplification activity, especially has good amplification activity for large-fragment nucleic acid; and the KOD DNA polymerase mutant is produced by the production method of the invention, and the KOD DNA polymerase mutant has good soluble expression performance; the KOD DNA polymerase mutant of the invention has good application prospects in preparing reagents and / or kits for PCR amplification. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 Shows some results of Blast on the NCBI website.

[0034] Figure 2 Some results of conservative site analysis using the Weblogo website (https: / / weblogo.berkeley.edu / logo.cgi) are shown.

[0035] Figure 3 The concentration test results of the wild-type KOD DNA polymerase and the KOD DNA polymerase mutant at the same concentration are shown; in the figure, M represents the KOD DNA polymerase standard, 1 represents the wild-type KOD DNA polymerase, and 2 represents the KOD DNA polymerase mutant.

[0036] Figure 4 The results of amplifying 5000b of nucleic acid using wild-type KOD DNA polymerase and KOD DNA polymerase mutants are shown; in the figure, M represents KOD DNA polymerase standard, 1 represents wild-type KOD DNA polymerase, and 2 represents KOD DNA polymerase mutant. DETAILED DESCRIPTION

[0037] The following examples further illustrate the technology of the present invention. These examples are for illustration and example of the present invention and are not intended to limit the scope of the present invention in any form.

[0038] Design a KOD DNA polymerase mutant and compare its amplification activity with that of the wild-type KOD DNA polymerase. The specific process is as follows:

[0039] (1) Design of KOD DNA polymerase mutant

[0040] By using the sequence of the wild-type KOD DNA polymerase (such as the sequence shown in SEQ ID NO.2), Blast was performed on the NCBI website, and only sequences with a homology of more than 70% were selected, and sequences that were exactly the same as the sequence shown in SEQ ID NO.2 were eliminated, and super-long sequences containing inteins were eliminated. Mutant sequences from invention patents or publicly published literature were eliminated, and sequences with more than 5 amino acid residues continuously inserted or deleted were eliminated. The remaining sequences after screening were downloaded, and Bioedit software was used to re-align using the ClustalW method. The alignment results were input into the Weblogo website (https: / / weblogo.berkeley.edu / logo.cgi) for conservation analysis to identify key sites that may affect enzyme activity and stability. Based on the SequenceLogo file obtained from the conservation analysis, only the most conservative amino acid residues were used for each amino acid site, and a KOD DNA polymerase mutant with multiple site mutations was constructed by site replacement. Among them, some of the results of Blast on the NCBI website are shown in Figure 1. Figure 1 As shown in Figure 2, some results of conservative site analysis using the Weblogo website (https: / / weblogo.berkeley.edu / logo.cgi) are shown in Figure 2. Figure 2 As shown. Relative to the wild-type KOD DNA polymerase, the mutation sites of the KOD DNA polymerase mutant are: T33N, F38I, E50D, T61K, T64R, V68A, Q72K, V80I, I107A, V127I, M137L, 153G, E154K, G167E, N175K, N176I, C223A, N229K, A231T, V282I, Q285K, T296A, T297E, L327F, K375R, Q382E, E385A, R476 K, Y493F, R501K, T522E, T524V, K526R, Y532F, I537L, S539A, M561K, A574L, L630I, D633H, K638E, V691I, R746K, S766G, T774K; mutations also occurred as follows: KE was inserted between D235 and G236, L was inserted between R380 and R381, N was inserted between D552 and A553, and K was inserted at the end.

[0041] The amino acid sequence of the KOD DNA polymerase mutant is shown in SEQ ID NO.1:

[0042] MILDTDYITEDGKPVIRIFKKENGEFKIEYDRNFEPYIYALLKDDSAIEDVKKITAERHGKVVRVKRAEKVKKKFLGRPIEVWKLYFTHPQDVPAIRDKIREHPAVVDIYEYDIPFAKRYLIDKGLIPMEGDEELKLLAFDIETLYHEGEEFGKGPILMISYADEEEARVITWKKIDLPYVDVVSTEKEMIKRFLKVVKEKDPDVLITYNGDNFDFAYLKKRAEKLGIKFTLGRDKEGSEPKIQRMGDRFAVEVKGRIHFDLYPVIRRTINLPTYTLEAVYEAIFGKPKEKVYAEEIAEAWETGEGLERVARYSMEDAKVTYELGKEFFPMEAQLSRLIGQSLWDVSRSSTGNLVEWFLLRKAYERNELAPNKPDERELARRLRESYAGGYVKEPERGLWENIVYLDFRSLYPSIIITHNVSPDTLNREGCKEYDVAPQVGHRFCKDFPGFIPSLLGDLLEERQKIKKKMKATIDPIEKKLLDYRQRAIKILANSFYGYYGYAKARWYCKECAESVTAWGREYIEMVIREIEEKFGFKVLYADTDGFFATIPGADNAETVKKKAKEFLKYINAKLPGLLELEYEGFYKRGFFVTKKKYAVIDEEGKITTRGLEIVRRDWSEIAKETQARVLEAILKHGDVEEAVRIVKEVTEKLSKYEVPPEKLVIHEQITRDLKDYKATGPHVAVAKRLAARGIKIRPGTVISYIVLKGSGRIGDRAIPFDEFDPTKHKYDAEYYIENQVLPAVERILKAFGYRKEDLRYQKTRQVGLGAWLKPKGKK

[0043] The amino acid sequence of wild-type KOD DNA polymerase is shown in SEQ ID NO.2 (GenBank: BAD84190.1, uniprot: P77933):

[0044] MILDTDYITEDGKPVIRIFKKENGEFKIEYDRTFEPYFYALLKDDSAIEEVKKITAERHGTVVTVKRVEKVQKKFLGRPVEVWKLYFTHPQDVPAIRDKIREHPAVIDIYEYDIPFAKRYLIDKGLVPMEGDEELKMLAFDIETLYHEGEEFAEGPILMISYADEEGARVITWKNVDLPYVDVVSTEREMIKRFLRVVKEKDPDVLITYNGDNFDFAYLKKRCEKLGINFALGRDGSEPKIQRMGDRFAVEVKGRIHFDLYPVIRRTINLPTYTLEAVYEAVFGQPKEKVYAEEITTAWETGENLERVARYSMEDAKVTYELGKEFLPMEAQLSRLIGQSLWDVSRSSTGNLVEWFLLRKAYERNELAPNKPDEKELARRRQSYEGGYVKEPERGLWENIVYLDFRSLYPSIIITHNVSPDTLNREGCKEYDVAPQVGHRFCKDFPGFIPSLLGDLLEERQKIKKKMKATIDPIERKLLDYRQRAIKILANSYYGYYGYARARWYCKECAESVTAWGREYITMTIKEIEEKYGFKVIYSDTDGFFATIPGADAETVKKKAMEFLKYINAKLPGALELEYEGFYKRGFFVTKKKYAVIDEEGKITTRGLEIVRRDWSEIAKETQARVLEALLKDGDVEKAVRIVKEVTEKLSKYEVPPEKLVIHEQITRDLKDYKATGPHVAVAKRLAARGVKIRPGTVISYIVLKGSGRIGDRAIPFDEFDPTKHKYDAEYYIENQVLPAVERILRAFGYRKEDLRYQKTRQVGLSAWLKPKGT

[0045] The nucleic acid sequence encoding the KOD DNA polymerase mutant (amino acid sequence shown in SEQ ID NO.1) is shown in SEQ ID NO.3:

[0046] ATGATCTTGGACACCGACTACATCACCGAAGACGGTAAACCGGTTATCCGT

[0047] ATCTTCAAGAAAGAGAACGGTGAGTTCAAGATCGAATACGACCGTAACTT

[0048] CGAACCGTACATCTACGCTCTGCTGAAAGACGACTCTGCGATCGAAGACGT

[0049] TAAGAAGATCACCGCAGAACGTCATGGTAAAGTTGTTCGTGTTAAACGTGC

[0050] TGAGAAAGTGAAAGAAATTCTTGGGTCGTCCGATCGAAGTTTGGAAAC

[0051] TGTACTTCACTCATCCGCAAGACGTTCCAGCGATCCGTGACAAGATCCGTG

[0052] AACATCCAGCGGTTGTTGACATCTACGAATACGACATTCCATTCGCGAAAC

[0053] GTTACCTGATCGACAAAGGTCTGATTCCAATGGAAGGTGAATGAAGAACTG

[0054] AAACTGCTGGCGTTCGACATCGAAACTCTGTACCACGAAGGTGAAGAGTTC

[0055] GGTAAAGGTCCGATCTTGATGATCAGCTACGCTGACGAAGAAGAAGCGCG

[0056] TGTTATCACCTGGAAAAAGATCGACCTGCCGTACGTTGACGTTGTTTCCAC

[0057] TGAGAAAGAAATGATCAAACGCTTTCTGAAAGTTGTTAAAGAGAAAGATC

[0058] CGGATGTTCTGATCACCTACAACGGTGACAACTTCGACTTCGCTTACCTGA

[0059] AGAAACGTGCGGAGAAACTGGGTATCAAATTCACTCTGGGTCGTGACAAA

[0060] GAAGGTTCTGAACCGAAGATCCAGCGTATGGGTGACCGTTTCGCGGTTGAA

[0061] GTTAAAGGTCGTATCCACTTCGATCTGTATCCGGTAATCCGTCGTACCATC

[0062] AACCTGCCGACCTACACCTTGGAAGCGGTTTACGAAGCGATCTTCGGCAAA

[0063] CCGAAAGAGAAAGTTTACGCGGAAGAAATCGCGGAAGCTTGGGAAACTGG

[0064] TGAAGGTTCGGAACGTGTTGCTCGTTACTCTATGGAAGATGCGAAAGTTAC

[0065] CTACGAACTGGGTAAAGAGTTCTTCCGATGGAAGCGCAGCTGTCTCGTCT

[0066] GATCGGTCAGTCTCTGTGGGAGTTTCTCGTTCTTCTACTGGTAACCTGGTT

[0067] GAATGGTTTCTGCTGCGTAAAGCGTACGAACGTAACGAACTGGCTCCGAAC

[0068] AAACCGGATGAACGTGAACTGGCGCGTCGTCTGCGTGAATCTTACGCGGGT

[0069] GGTTACGTTAAAGAACCGGAACGTGGCCTGTGGGAGAACATCGTTTACCTG

[0070] GACTTCCGTAGCCTGTATCCGTCTATCATCATCACTCACAACGTTAGTCCAG

[0071] ACACCTTGAACCGTGAAGGTTGCAAAGAGTACGATGTTGCTCCGCAGGTTG

[0072] GTCACCGTTTCTGCAAAGACTTCCCAGGTTTCATTCCGAGCCTGCTGGGTG

[0073] ATCTGCTCGAAGAACGTCAGAAGATCAAGAAGAAGATGAAAGCGACTATC

[0074] GATCCAATCGAGAAGAAACTGCTGGACTACCGTCAGCGTGCGATCAAGAT

[0075] CCTGGCGAACAGCTTCTACGGTTACTACGGCTACGCTAAAGCGCGTTGGTA

[0076] CTGCAAAGAATGCGCGGAATCTGTTACCGCGTGGGGTCGTGAATACATCG

[0077] AAATGGTTATCCGCGAAATCGAAGAGAAATTCGGCTTCAAAGTTCTGTATG

[0078] CGGACACCGATGGTTTCTTCGCGACCATTCCAGGTGCTGACAACGCGGAAA

[0079] CCGTTAAGAAGAAAGCGAAAGAATTTCTGAAATACATCAACGCGAAACTG

[0080] CCAGGTTTGCTGGAACTGGAATACGAAGGTTTCTACAAACGTGGCTTCTTC

[0081] GTTACCAAGAAGAAGTACGCGGTTATCGACGAAGAAGGTAAGATCACCAC

[0082] TCGTGGTCTGGAAATCGTTCGTCGTGACTGGAGCGAAATCGCGAAAGAAA

[0083] CTCAGGCACGTGTTCTGGAAGCGATTCTGAAACACGGTGATGTTGAAGAA

[0084] GCTGTGCGTATCGTGAAAGAAGTTACCGAAAAACTGTCCAAATACGAAGT

[0085] TCCACCAGAGAAACTGGTTATCCACGAACAGATCACTCGTGACCTGAAAG

[0086] ACTACAAAGCGACTGGTCCGCACGTTGCAGTTGCGAAACGTCTGGCTGCTC

[0087] GTGGTATCAAGATCCGTCCAGGCACCGTTATCAGCTACATCGTTCTGAAAG

[0088] GTTCTGGTCGTATCGGTGATCGTGCTATCCCGTTCGACGAGTTCGATCCGA

[0089] CCAAACACAAATACGACGCGGAATACTACATCGAGAACCAGGTTCTGCCG

[0090] GCTGTTGAACGTATTCTGAAAGCGTTCGGTTACCGTAAAGAAGACCTGCGT

[0091] TACCAGAAGACTCGTCAGGTAGGTCTGGGTGCTTGGCTGAAACCGAAAGG

[0092] CAAGAAGTAA

[0093] (2) comparing the amplification activity of the KOD DNA polymerase mutant with that of the wild-type KOD DNA polymerase, specifically comprising the following steps:

[0094] (2-1) Obtain KOD DNA polymerase plasmid

[0095] The nucleic acid sequences encoding the above wild-type KOD DNA polymerase (amino acid sequence as shown in SEQ ID NO.2) and KOD DNA polymerase mutant (amino acid sequence as shown in SEQ ID NO.1) were sent to Nanjing Qingke Biotechnology Co., Ltd., and the nucleic acid sequences were synthesized into a commercial pET-28a expression vector based on T7 promoter, and the expression vector used contained an operon sequence that responded to IPTG-induced expression.

[0096] (2-2) Obtain competent cells expressing KOD DNA polymerase

[0097] 1) The wild-type KOD DNA polymerase plasmid and the KOD DNA polymerase mutant plasmid obtained in step (2-1) were added to 100 μL of BL21 (DE3) competent medium, ice-bathed for 30 minutes, heat-shocked at 42°C for 45 seconds, and then ice-bathed for 2 minutes. Then, 900 μL LB was added, incubated at 37°C and 220 rpm for 1 hour, and then the bacterial solution was spread on LB plates containing kanamycin resistance and cultured at 37°C overnight.

[0098] 2) Pick the strain on the LB plate into 4 mL of LB liquid medium and culture at 37°C and 180 rpm for 4 h; then transfer 4 mL of the bacterial solution to 500 mL of LB liquid medium and continue to culture at 37°C and 160 rpm for 4 h, then cool to 16°C and reduce the speed to 130 rpm, add IPTG at a final concentration of 0.5 mM, and induce expression for 16 h.

[0099] 3) The LB liquid medium obtained in step 2) was centrifuged at 3500rpm for 10min, the cells were collected, weighed, and the weight of the collection tube was subtracted to obtain the wet weight of each cell. Then, the cells were resuspended in 50mL lysis buffer (50mM Tris-Cl pH8.0, 300mMNaCl, 10% glycerol); the resuspended cells were then crushed using an ultrasonic crusher, and the ultrasonic conditions were: power 60W, time interval 6s, working 3s, and total duration 30min. After the ultrasonic crushing treatment, the cell crushing liquid was centrifuged at 9000rpm for 60min, and the supernatant was collected.

[0100] 4) The supernatant obtained in step 3) was mixed with 5 mL of Ni-NTA filler, and incubated with rotation at 4°C for 15 min. Subsequently, the mixture was centrifuged at 1500 rpm for 1 min, the liquid portion was collected, and the filler portion was washed with buffer containing 20 mM imidazole, 50 mM imidazole, and 300 mM imidazole in sequence, and the liquid portion obtained by washing the filler was collected at the same time, and the liquid collected after centrifugation was combined with the liquid obtained by washing the filler.

[0101] 5) The concentrations of the wild-type KOD DNA polymerase and the KOD DNA polymerase mutant in the two combined liquids obtained in step 4) are respectively detected, and the KOD DNA polymerase in the two combined liquids are adjusted to the same concentration using a buffer containing 300 mM imidazole. The KOD DNA polymerase concentration detection results in the two combined liquids after adjustment are as follows: Figure 3 The concentration was detected by electrophoresis identification of the liquid to be detected using the SDS-PAGE prefabricated gradient gel provided by Beijing Qingke Biotechnology Co., Ltd. according to its instructions (electrophoresis at 150V for 25 minutes), and then protein bands were stained using the rapid staining kit provided by Beijing Qingke Biotechnology Co., Ltd.

[0102] (2-3) Detection of KOD DNA polymerase activity

[0103] The mouse genome purchased from Promega was used as a template, and a pair of primers were designed for the 5 kb length region of the genome, wherein the sequence of the forward primer was: tttgagtccaggtacaggataac, and the sequence of the reverse primer was: cagttaggaaacagatacggatga; the reagents were prepared according to the PCR amplification system in Table 1 and the PCR amplification was performed according to the amplification program in Table 2. The wild-type KOD DNA polymerase was used as a control to perform amplification activity reference calculation, and the results are shown in Table 3, Figure 4 shown.

[0104] Table 1 PCR amplification system

[0105]

[0106] In Table 1, KOD FX Neo refers to wild-type KOD DNA polymerase or KOD DNA polymerase mutant

[0107] Table 2 Amplification procedures

[0108]

[0109] In Table 2, 30 sec. / kb means that the denaturation time is 30 s for every 1 kb of the nucleic acid sequence length of the template.

[0110] Table 3 Amplification activity results

[0111] KOD DNA polymerase Mutation effect (5kb) wild type 100％ Mutants 140％

[0112] As can be seen from Table 3, for a 5 kb template, the amplification activity of the KOD DNA polymerase mutant is 40% higher than that of the wild-type KOD DNA polymerase.

[0113] It should be noted that the embodiments described above are only used to explain the present invention and do not constitute any limitation of the present invention. The present invention has been described with reference to the embodiments, but it should be understood that the words used therein are descriptive and explanatory words, rather than restrictive words. The present invention may be modified as specified within the scope of the claims of the present invention, and the present invention may be revised without departing from the scope and spirit of the present invention. Although the present invention described therein relates to specific methods, materials and embodiments, it does not mean that the present invention is limited to the specific examples disclosed therein, on the contrary, the present invention can be extended to all other methods and applications with the same functions.

Claims

1. A KOD DNA polymerase mutant, characterized in that: The KOD DNA polymerase mutant has an amino acid sequence as shown in SEQ ID NO.

1.

2. The method for obtaining the KOD DNA polymerase mutant according to claim 1, characterized in that: The KOD DNA polymerase mutant is a wild-type KOD DNA polymerase with mutations at the following sites: T33N, F38I, E50D, T61K, T64R, V68A, Q72K, V80I, I107A, V127I, M137L, 153G, E154K, G167E, N175K, N176I, C223A, N229K, A231T, V282I, Q285K, T296A, T297E, L327F, K375R, Q382E, E385A, R476K, Y493 F, R501K, T522E, T524V, K526R, Y532F, I537L, S539A, M561K, A574L, L630I, D633H, K638E, V691I, R746K, S766G, T774K; and mutated in the following manner: KE is inserted between D235 and G236, L is inserted between R380 and R381, N is inserted between D552 and A553, and K is inserted at the end; wherein the wild-type KOD DNA polymerase has the amino acid sequence shown in SEQ ID NO.

2.

3. A nucleic acid molecule, characterized in that The nucleic acid molecule comprises a nucleotide fragment encoding the KOD DNA polymerase mutant according to claim 1; preferably, the nucleotide fragment has a base sequence as shown in SEQ ID NO.

3.

4. A recombinant expression vector, characterized in that: The recombinant expression vector comprises the nucleic acid molecule described in claim 3; preferably, the recombinant expression vector is recombined by an expression vector and the nucleic acid molecule described in claim 3; more preferably, the expression vector is selected from the pET series expression vectors, preferably pET-32a plasmid, pET-28a plasmid or pET-41a plasmid.

5. A recombinant host cell, characterized in that The recombinant host cell comprises the nucleic acid molecule of claim 3 or the recombinant expression vector of claim 4; preferably, the host cell comprises a prokaryotic cell.

6. A recombinant strain, characterized in that: The recombinant strain comprises the recombinant host cell of claim 5; preferably, the recombinant strain is obtained by transforming the recombinant expression vector of claim 4 into a host bacterial species; more preferably, the host bacterial species is selected from Escherichia coli.

7. The method for producing the KOD DNA polymerase mutant according to claim 1, characterized in that: The production method comprises the following steps: Cultivate the recombinant host cell according to claim 5 or the recombinant strain according to claim 6, and isolate the KOD DNA polymerase mutant from the obtained culture product.

8. The production method according to claim 7, characterized in that: The culture conditions include: the culture medium is selected from LB culture medium, preferably liquid LB culture medium; the culture temperature is 20-40°C; the inoculation amount is 0.5%-1.5%; And / or, the separation comprises disrupting the cells containing the KOD DNA polymerase mutant to release the KOD DNA polymerase mutant; preferably, the disruption is performed by an enzymatic and / or physical disruption method, preferably by using an ultrasonic disruptor; And / or, the method further comprises purifying the isolated KOD DNA polymerase mutant; preferably, purifying by affinity chromatography.

9. Use of the KOD DNA polymerase mutant according to claim 1 or the KOD DNA polymerase mutant produced by the production method according to any one of claims 7 to 8 in the preparation of reagents and / or kits for PCR amplification.

10. A PCR amplification reagent, characterized in that: The reagent comprises the KOD DNA polymerase mutant according to claim 1 or the KOD DNA polymerase mutant produced by the production method according to any one of claims 7 to 8.

Images