Lipase mutant and application thereof in preparation of (S)-3-cyclohexene-1-formic acid

Abstract

The invention belongs to the field of biological pharmacy and biological conversion, and particularly relates to a lipase mutant and application thereof in preparation of (S)-3-cyclohexene-1-formic acid. The lipase CALB mutant disclosed by the invention is obtained by carrying out single-point mutation or combined mutation on the 40th site, the 134 site, the 154 site, the 189th site, the 278th site and the 281 site of an amino acid sequence as shown in SEQ ID NO.1. Compared with a wild type, the mutant has the advantage that the stereoselectivity is greatly improved when the mutant is used for catalyzing racemization 3-cyclohexene-1-methyl formate to produce (S)-3-cyclohexene-1-formic acid. Compared with a traditional chemical method for preparing (S)-3-cyclohexene-1-formic acid, the lipase CALB mutant provided by the invention is high in stereoselectivity, mild in reaction condition, environment-friendly, low in equipment requirement, capable of greatly reducing the production cost and wide in application prospect in industrial application.

Description

The present invention is a divisional application of Chinese patent application 202510027385.9, with a filing date of January 8, 2025. The name of the invention of the original application is “A lipase mutant and its application”. Technical Field

[0001] The invention belongs to the field of biopharmaceuticals and biotransformation, and particularly relates to a lipase mutant and application thereof in the preparation of (S)-3-cyclohexene-1-carboxylic acid. Background Art

[0002] Lipase has good catalytic ability in hydrolysis, transesterification, esterification, transesterification and other reactions, and is widely used in food, chemical, pharmaceutical, bioenergy and other industries. Lipases from microorganisms have become the main source of lipases in industrial applications. Antarctic Candida lipase B (CALB) is derived from Candida antarctica. CALB is widely used in food, pharmaceutical, chemical and other fields due to its excellent catalytic activity in ester synthesis, hydrolysis and transesterification.

[0003] (S)-3-Cyclohexene-1-carboxylic acid, as a chiral compound, is an important chemical reagent or pharmaceutical intermediate and is widely used in many fields such as medicine and chemical industry. (S)-3-Cyclohexene-1-carboxylic acid can be used to generate (S)-3,4-diaminocyclohexanecarboxylic acid, which is the key chiral building block of the coagulation factor Xa (fXa) inhibitor edoxaban (trade name: Savaysa). This drug is used to treat cancer-related venous thromboembolism. Compared with similar coagulation factor Xa inhibitor drugs such as rivaroxaban and apixaban, it has outstanding advantages such as less kidney burden, less bleeding risk, safety and reliability, and has broad market prospects. As the key intermediate of this drug, the efficient preparation technology of (S)-3-cyclohexene-1-carboxylic acid has become a research hotspot.

[0004] At present, there are mainly three methods for synthesizing chiral 3-cyclohexene-1-carboxylic acid: Diels-Alder reaction, chemical racemic acid splitting method and enzymatic asymmetric hydrolysis splitting of 3-cyclohexene-1-carboxylic acid methyl ester. Among them, Diels-Alder reaction is the main method for synthesizing chiral 3-cyclohexene-1-carboxylic acid at present, but butadiene is gas in the reaction and the product is not easy to separate, there are many reaction steps, and the final yield is low, and the method still needs to be further improved. The separation of the chemical racemic acid splitting method requires at least six recrystallization processes in acetone. This chemical splitting method not only consumes a large amount of acetone, but also the yield after splitting is only between 20-30%, and the economic performance is low. It can be seen that the use of chemical methods to synthesize chiral 3-cyclohexene-1-carboxylic acid has many operating steps, low yield and a large amount of acetone consumption. The use of bio-enzyme catalysis to split chiral compounds has the advantages of mild reaction conditions, high stereoselectivity, low pollution and simple operation, which makes it an important way to replace or supplement traditional chemical synthesis routes in the process of promoting sustainable development.

[0005] In 2004, Cihangir T et al. studied three enzymes: porcine liver esterase (PLE), horse liver esterase (HLE) and porcine pancreatic lipase (PPL), which have the function of hydrolyzing racemic 3-cyclohexene-1-carboxylic acid methyl ester. The results showed that the hydrolysis products of PLE and HLE were (S)-3-cyclohexene-1-carboxylic acid, and the ee values ​​exceeded 99% and reached 97% respectively; while the hydrolysis product of PPL was (R)-3-cyclohexene-1-carboxylic acid, and its ee value was 91%. However, these three enzymes are all derived from animals. As commercial enzymes, they face multiple challenges in practical applications, including: high cost, interference from isozymes, significant differences between batches, and potential risks of viral contamination.

[0006] In 2019, Dou Zhe and others used 3-cyclohexene-1-carboxylic acid methyl ester as a substrate to screen wild strains and successfully discovered a strain named Acinetobacter sp. JNU9335, which can selectively catalyze the hydrolysis of the substrate. The remaining (S)-3-cyclohexene-1-carboxylic acid methyl ester was further hydrolyzed under alkaline conditions to obtain the target product (S)-3-cyclohexene-1-carboxylic acid. 3.50g of racemic 3-cyclohexene-1-carboxylic acid methyl ester was added to 50mL of the reaction and reacted for 12h to finally obtain the target product with a yield of 40% and an ee value of up to 99%. In 2020, Dou Zhe et al. successfully obtained cyclohexene carboxylate hydrolase AcEst1 and its mutants. Using the crude enzyme powder of the mutant F78V / A202K / G326A with enhanced activity, 58.7g of racemic 3-cyclohexene-1-carboxylic acid methyl ester was catalyzed, and the remaining (S)-3-cyclohexene-1-carboxylic acid methyl ester was treated with alkaline hydrolysis to obtain 22.3g (S)-3-cyclohexene-1-carboxylic acid, with a yield of 38%, and the gas chromatography (GC) purity of the product was 99%, and the optical purity was as high as 99.5% ee. Later in 2021, Dou Zhe et al. disclosed a new carboxylesterase CarEst3 and its mutants, which have excellent catalytic ability and can process up to 500g / L of racemic 3-cyclohexene-1-carboxylic acid methyl ester. The final (S)-3-cyclohexene-1-carboxylic acid has a total yield of 37% and an optical purity of 99% ee.

[0007] Compared with the traditional chemical synthesis method, the method of preparing (S)-3-cyclohexene-1-carboxylic acid by bioenzyme catalysis has the advantages of mild reaction conditions, high enantiomeric selectivity, environmental friendliness and simple operation. However, the current method for preparing (S)-3-cyclohexene-1-carboxylic acid is limited to laboratory scale, and has defects such as low enzyme selectivity resulting in low product yield, which is not suitable for industrial production, and there is a lack of reports on the synthesis of (S)-3-cyclohexene-1-carboxylic acid catalyzed by lipase CALB. Therefore, it is necessary to screen mutants of lipase CALB with high catalytic efficiency and complementary enantiomeric selectivity to meet the needs of industrial production of (S)-3-cyclohexene-1-carboxylic acid. Summary of the invention

[0008] The present invention aims to overcome the defects of the prior art in which a process for preparing (S)-3-cyclohexene-1-carboxylic acid by utilizing biological enzyme catalysis, such as low enzyme selectivity, low product yield, low catalytic efficiency and difficulty in being applicable to industrial production. The present invention provides a lipase mutant, a mutant encoding gene, a recombinant vector containing the mutant encoding gene and a recombinant genetic engineering bacterium containing the mutant encoding gene, and applies the lipase mutant to the industrial production process for preparing (S)-3-cyclohexene-1-carboxylic acid.

[0009] To achieve the above-mentioned purpose, the present invention is implemented by the following technical solutions: A lipase CALB mutant is obtained by site-directed mutagenesis of the amino acids in the sequence shown in SEQ ID NO. 1, wherein the mutation site is one or more of the following: (1) position 40, (2) position 134, (3) position 154, (4) position 189, (5) position 278, and (6) position 281.

[0010] Preferably, the lipase CALB mutant is derived from the amino acid sequence shown in SEQ ID NO.1 by site-directed mutagenesis, and the mutation sites are one or two of the following: (2) position 134, (6) position 281.

[0011] Preferably, the mutant is obtained by mutation of one or more of the following sites in the amino acid sequence as shown in SEQ ID NO.1: (1) threonine at position 40 is mutated to lysine, (2) aspartic acid at position 134 is mutated to serine, (3) valine at position 154 is mutated to isoleucine, (4) isoleucine at position 189 is mutated to arginine, (5) lysine at position 278 is mutated to aspartic acid, and (6) alanine at position 281 is mutated to glutamine.

[0012] A nucleic acid molecule comprising the coding sequence of the lipase CALB mutant as described above.

[0013] A recombinant vector comprising the coding sequence described above.

[0014] A recombinant genetically engineered bacterium, wherein the recombinant genetically engineered bacterium contains the recombinant vector as described above.

[0015] Preferably, the recombinant genetically engineered bacteria uses Escherichia coli as an expression host.

[0016] The invention provides a coding gene of a recombinant lipase CALB mutant, a recombinant vector containing the coding gene and a recombinant genetic engineering bacterium constructed by the recombinant vector, wherein the expression vector is pET28b(+) and the recombinant genetic engineering bacterium host is E.coliBL21(DE3).

[0017] The recombinant lipase CALB mutant of the present invention is prepared by mutating multiple specific amino acid sites of wild-type lipase CALB, with the purpose of enhancing its enantiomer resolution ability for racemic 3-cyclohexene-1-carboxylic acid methyl ester. First, the coding gene of wild-type Antarctic Candida albicans lipase B (its sequence is shown in SEQ ID NO.2) is connected to the expression vector pET28b (+) plasmid to construct a recombinant expression plasmid. Then the successfully constructed recombinant expression plasmid is transformed into E. coli BL21 (DE3). The recombinant expression plasmid containing the lipase CALB coding gene is used as a template, and genetic modification is carried out by site-directed mutagenesis technology, and then the successfully constructed recombinant plasmid is transformed into E. coli BL21 (DE3) to obtain a recombinant genetic engineering bacterium containing the coding gene of the recombinant lipase CALB mutant. The obtained recombinant genetic engineering bacterium is fermented and cultured, and expression is induced. The fermentation broth is centrifuged to obtain wet bacterial cells containing the recombinant lipase CALB mutant. The wet cells were resuspended in a phosphate buffer solution, ultrasonically disrupted in an ice bath, and the supernatant was collected by low-temperature centrifugation to finally obtain a crude enzyme solution of the lipase CALB mutant. The stereoselectivity of the mutant lipase CALB was compared with that of the wild-type lipase CALB to screen mutants with excellent resolution performance.

[0018] Use of the lipase CALB mutant as described above in the preparation of (S)-3-cyclohexene-1-carboxylic acid.

[0019] Preferably, the application is: phosphate buffer solution, 3-cyclohexene-1-carboxylic acid methyl ester, wet bacteria obtained by fermentation culture of recombinant genetically engineered bacteria containing a lipase CALB mutant encoding gene, or crude enzyme solution extracted after ultrasonic crushing of wet bacteria are evenly mixed, and a catalytic reaction is carried out to obtain (S)-3-cyclohexene-1-carboxylic acid.

[0020] Compared with the traditional chemical method for preparing (S)-3-cyclohexene-1-carboxylic acid, the lipase CALB mutant provided by the present invention has high stereoselectivity, mild reaction conditions, environmental friendliness, and low equipment requirements, which greatly reduces production costs and shows broad application prospects in industrial production. The lipase CALB provided by the present invention has high catalytic activity, so that the reaction conditions are mild, the substrate conversion rate is high, the enantiomeric selectivity is high, the production cost is reduced and it is environmentally friendly. The present invention can improve the catalytic activity and stereoselectivity of the lipase CALB for racemic 3-cyclohexene-1-carboxylic acid methyl ester by designing mutations at multiple different sites of amino acids. The present invention has the advantages of mild reaction conditions, high substrate concentration, high stereoselectivity, simple catalyst treatment steps, and environmental friendliness. For example, under 10°C conditions, 40g / L of the lipase CALB mutant can catalyze 70g / L of racemic 3-cyclohexene-1-carboxylic acid methyl ester within 6h, with a conversion rate of 52%, and eep The value is 72%.

[0021] Preferably, the reaction temperature of the catalytic reaction is 0-40° C., and the reaction time is 2-12 h.

[0022] As a further preference, the reaction temperature of the catalytic reaction is 10°C and the reaction time is 6 hours.

[0023] Preferably, the concentration of phosphate contained in the phosphate buffer solution is 50 to 200 mM.

[0024] More preferably, the concentration of phosphate in the phosphate buffer solution is 200 mM.

[0025] Preferably, the phosphate buffer solution comprises disodium hydrogen phosphate and sodium dihydrogen phosphate.

[0026] Preferably, the pH value of the phosphate buffer solution is 6-9.

[0027] As further preferred, the pH value of the phosphate buffer solution is 7.

[0028] Preferably, the concentration of methyl 3-cyclohexene-1-carboxylate is 20 to 140 g / L.

[0029] More preferably, the concentration of methyl 3-cyclohexene-1-carboxylate is 70 g / L.

[0030] Preferably, the concentration of the wet bacteria obtained by fermentation culture of the recombinant genetically engineered bacteria containing the gene encoding the lipase CALB mutant added in the catalytic reaction is 10-100 g / L.

[0031] As a further preference, the concentration of the wet bacteria obtained by fermentation culture of the recombinant genetically engineered bacteria containing the gene encoding the lipase CALB mutant added in the catalytic reaction is 40 g / L.

[0032] Preferably, the method for extracting (S)-3-cyclohexene-1-carboxylic acid in the enzyme catalytic reaction solution by an organic reagent comprises the following steps: After the enzyme catalyzed reaction was completed, an equal volume of 3M HCl was added to terminate the reaction, and then two volumes of the organic reagent ethyl acetate were added for extraction, and the extraction was performed 3 times in total. The organic phases after the extraction were combined, anhydrous sodium sulfate was added to dry to remove excess water, and the mixture was filtered and rotary evaporated to obtain (S)-3-cyclohexene-1-carboxylic acid.

[0033] Preferably, the method for preparing the wet cells comprises the following steps: The engineered bacteria containing the gene encoding the recombinant lipase CALB mutant were inoculated into an LB liquid culture medium containing ampicillin resistance at a final concentration of 50 μg / mL, and cultured at 37°C and 180 rpm for 10 to 12 hours. The inoculation amount was then inoculated into an LB liquid culture medium containing ampicillin resistance at a final concentration of 50 μg / mL at a volume concentration of 2%, and cultured at 37°C and 180 rpm until the bacterial OD600 was 0.6 to 0.8. IPTG with a final concentration of 1 mM was added, and the culture was induced at 28°C and 180 rpm for 12 hours. The culture was centrifuged at 4°C and 8000 rpm for 10 minutes, the supernatant was discarded, and the precipitate was collected to obtain the wet bacterial cells of the recombinant genetically engineered bacteria containing the gene encoding the recombinant lipase CALB mutant.

[0034] Preferably, the method for preparing the crude enzyme solution comprises the following steps: The wet cells obtained by fermentation culture of the engineered bacteria containing the gene encoding the recombinant lipase CALB mutant were resuspended by adding 9.6 mL of 200 mM sodium phosphate buffer solution with a pH of 7.0 for every 0.4 g of wet cells; the cell resuspension was ultrasonically disrupted in an ice bath at a power of 60 W for 2 seconds, with an interval of 4 seconds, and continuously disrupted for 10 minutes to obtain a cell disruption solution; the cell disruption solution obtained after ultrasonic disruption was centrifuged at 8000 rpm and 4°C for 10 minutes, and the supernatant obtained was the crude enzyme solution.

[0035] Therefore, the present invention has the following beneficial effects: (1) The present invention can improve the catalytic activity and stereoselectivity of lipase CALB for racemic 3-cyclohexene-1-carboxylic acid methyl ester by designing mutations at multiple different amino acid sites; (2) The present invention has the advantages of mild reaction conditions, high substrate concentration, high stereoselectivity, simple catalyst treatment steps, and environmental friendliness, and has reduced equipment requirements, greatly reducing production costs, and showing broad application prospects in industrial applications; (3) Compared with the traditional chemical method for preparing (S)-3-cyclohexene-1-carboxylic acid, the lipase CALB mutant provided by the present invention has high stereoselectivity and high conversion rate. Under the condition of 10°C, 40 g / L of the lipase CALB mutant can catalyze 70 g / L of racemic 3-cyclohexene-1-carboxylic acid methyl ester within 6 hours, and the conversion rate can reach up to 52%. p The value can reach up to 72%. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 This is the SDS-PAGE picture of lipase CALB.

[0037] Figure 2Schematic diagram of the bioenzymatic separation of racemic 3-cyclohexene-1-carboxylic acid methyl ester.

[0038] Figure 3 Schematic diagram of high-performance gas chromatography (GC) detection of the product S / R-3-cyclohexene-1-carboxylic acid after 6 hours of catalytic reaction by the recombinant lipase CALB mutant CALB-D134S / A281Q.

[0039] Figure 4 Schematic diagram of the conversion rate of wild-type lipase CALB and recombinant lipase CALB mutant.

[0040] Figure 5 Schematic diagram of the eep values ​​of wild-type lipase CALB and recombinant lipase CALB mutants. DETAILED DESCRIPTION

[0041] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments of the specification. Those of ordinary skill in the art will be able to implement the present invention based on these descriptions. In addition, the embodiments of the present invention involved in the following description are generally only embodiments of a part of the present invention, rather than all embodiments. Therefore, based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work should fall within the scope of protection of the present invention.

[0042] Example 1: Construction of genetically engineered bacteria E. coli BL21 (DE3) / CALB for lipase CALB The lipase B (CALB) gene sequence from Candida antarctica in the gene library (amino acid sequence as shown in SEQ ID NO.1, nucleotide sequence as shown in SEQ ID NO.2) was synthesized by whole gene synthesis and transferred into the vector pET28b (+) plasmid to obtain the pET28b (+)-CALB recombinant plasmid, which was then transformed into E. coli BL21 (DE3) to obtain the wild-type lipase CALB genetically engineered bacteria E. coli BL21 (DE3) / CALB, and the corresponding lipase was recorded as wild-type lipase CALB.

[0043] Example 2: Construction of recombinant esterase mutants by site-directed mutagenesis The genetically engineered bacteria E. coli BL21 (DE3) / CALB-muts were used to synthesize primers according to the mutation site, and site-directed mutagenesis was performed by PCR extension amplification using the pET28b (+) -CALB recombinant plasmid containing the gene encoding the antarctic Candida antarctica lipase B as a template (see Table 1 for site-directed mutagenesis primers).

[0044] Table 1: Nucleic acid sequences of primers Primer name Sequence (5'-3') T40K-R ATTTTACTGGTTCCAGGAAAGGGTACTACTGGA T40K-L TCCTGGAACCAGTAAAATAGGTTTACTAACGGA D134S-R CTTATGGCCTTTGCTCCTTCTTACAAAGGTACCG D134S-L AGGAGCAAAGGCCATAAGTCTGTCGACCTTTGA V154I-R GCAGTGTCCGCTCCTTCCAGGTGGCAACAAACC V154I-L GGAAGGAGCGGACACTGCCAAGGCGTCAAGTGG I189R-R TACTCAGCTACAGACGAAAGGGTTCAGCCTCAA I189R-L TTCGTCTGTAGCTGAGTATAGGTTAGTAGTGGG L278N-R GTCGCTGCCGCAGCCCTGAATGCTCCAGCAGCT L278N-L CAGGGCTGCGGCAGCGACCTTTTGTTCAGGGGT A281Q-R GCAGCCCTGCTGGCTCCACCAGCTGCCGCTATC A281Q-L TGGAGCCAGCAGGGCTGCGGCAGCGACCTTTTG .

[0045] The PCR reaction program was as follows: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, 72°C for 3 min, repeated for 30 cycles; 72°C for 10 min. The product after the PCR reaction was added with DpnI and placed at 37°C for 3 h. After the treatment, it was inactivated at 80°C for 10 min, then chemically transformed into E. coli BL21 (DE3) competent cells, spread on LB solid plates containing a final concentration of 50 mg / L ampicillin resistance, and cultured at 37°C for 12 h. Single colonies were randomly picked for sequencing analysis to obtain recombinant Escherichia coli E. coli BL21 (DE3) / CALB-muts containing the recombinant lipase CALB mutant genes, namely E. coli BL21 (DE3) / CALB-T40K, E. coli BL21 (DE3) / CALB-D134S, E. coli BL21 (DE3) / CALB-V154I, E. coli BL21 (DE3) / CALB-I189R, E. coli BL21 (DE3) / CALB-L278N, E. coli BL21 (DE3) / CALB-A281Q, and E. coli BL21 (DE3) / CALB-D134S / A281Q. The corresponding lipase CALB mutants were denoted as mutants CALB-T40K, CALB-D134S, CALB-V154I, CALB-I189R, CALB-L278N, CALB-A281Q, and CALB-D134S / A281Q.

[0046] Example 3: Preparation of wet bacterial cells of genetically engineered bacteria of recombinant lipase CALB mutants The recombinant E. coli BL21 (DE3) / CALB-muts containing the recombinant lipase CALB mutant gene obtained in Example 2 was inoculated into 10 mL LB test tube culture medium containing a final concentration of 50 μg / mL ampicillin resistance, and cultured at 37°C, 180 rpm for 10-12 h, and then inoculated into 100 mL LB shake flask culture medium containing a final concentration of 50 μg / mL ampicillin resistance at a 2% (v / v) inoculum amount, and cultured at 37°C, 180 rpm until the bacterial OD600 reached 0.6-0.8, and IPTG was added at a final concentration of 1 mM. After culturing at 28°C for 12 h, the mixture was centrifuged at 4°C, 8000 rpm for 10 min, the supernatant was discarded, and the precipitate was collected to obtain wet bacterial cells of recombinant E. coli containing the recombinant lipase CALB mutant gene. The wet bacterial cells can be directly used as a biocatalyst or used to prepare a crude enzyme solution. The same method was used to prepare recombinant Escherichia coli BL21 (DE3) / CALB wet cells containing the gene expressing the recombinant lipase CALB.

[0047] Example 4: Preparation of crude enzyme solution of recombinant esterase and its mutants Preparation of crude enzyme solution of recombinant lipase CALB: The wet cells collected according to the method in Example 3 are resuspended in 9.6 mL of 200 mM sodium phosphate buffer solution with a pH of 7.0 for every 0.4 g of wet cells, and ultrasonically disrupted in an ice bath (60 W power, continuous 2 s, intermittent 4 s, continuous disruption for 10 min), and then a cell disruption solution is obtained. The cell disruption solution obtained after ultrasonic disruption is centrifuged at 8000 rpm and 4°C for 10 min, and the supernatant obtained is the required crude enzyme solution of recombinant lipase CALB. The SDS-PAGE image of the cell disruption supernatant and precipitate of E. coli BL21 (DE3) / CALB (i.e., the SDS-PAGE image of lipase CALB) is as shown below. Figure 1 As shown. Among them, Figure 1 From the left, lane 1 is the protein molecular weight marker, lane 2 is the crude enzyme sample of the original strain lipase CALB, and lane 3 is the crushed precipitate sample of the original strain lipase CALB. Figure 1 Recombinant lipase CALB can be found in a soluble form.

[0048] Example 5: Determination of Stereoselectivity of Lipase CALB The wet cells of the wild-type lipase CALB and the recombinant lipase CALB mutants CALB-T40K, CALB-D134S, CALB-V154I, CALB-I189R, CALB-L278N, CALB-A281Q, and CALB-D134S / A281Q obtained in Example 3 were used to catalyze the racemic 3-cyclohexene-1-carboxylic acid methyl ester.

[0049] The enzyme catalytic system and catalytic conditions are as follows: add 40g / L wet bacteria, add 70g / L racemic 3-cyclohexene-1-carboxylic acid methyl ester, use 200mM sodium phosphate buffer with pH 7.0 to form a 10mL reaction system, react at 10°C and 700rpm for 6h, take 100μL of the reaction solution after the reaction is completed, add an equal volume of 100μL 3M HCl to terminate the reaction, extract with ethyl acetate three times, add a total of 800μL ethyl acetate, centrifuge at 12000rpm for 1min, separate the aqueous phase and the organic phase, collect the organic phase and add a certain amount of anhydrous sodium sulfate to dry and remove water, centrifuge at 12000rpm for 1min, and take 200μL of supernatant. The schematic diagram of the bioenzymatic separation of racemic 3-cyclohexene-1-carboxylic acid methyl ester is shown below. Figure 2 shown.

[0050] The supernatant contains: (S)-3-cyclohexene-1-carboxylic acid methyl ester, (R)-3-cyclohexene-1-carboxylic acid methyl ester, (S)-3-cyclohexene-1-carboxylic acid, (R)-3-cyclohexene-1-carboxylic acid. The contents of substrates ((S)-3-cyclohexene-1-carboxylic acid methyl ester, (R)-3-cyclohexene-1-carboxylic acid methyl ester) and products ((S)-3-cyclohexene-1-carboxylic acid and (R)-3-cyclohexene-1-carboxylic acid) are detected by high performance gas chromatography (GC), and the conversion rate and ee are calculated. p The schematic diagram of high performance gas chromatography (GC) detection of the product S / R-3-cyclohexene-1-carboxylic acid after 6 hours of catalytic reaction of the recombinant lipase CALB mutant CALB-D134S / A281Q is shown in the figure. Figure 3 The conversion rate diagram of wild-type lipase CALB and recombinant lipase CALB mutant is shown in Figure 4 As shown. ee of wild-type lipase CALB and recombinant lipase CALB mutant p The value diagram is as follows Figure 5 shown.

[0051] ee p The value is calculated as follows: ee p / %=(Sp-Rp) / (Sp+Rp), Sp represents the content of (S)-3-cyclohexene-1-carboxylic acid, and Rp represents the content of (R)-3-cyclohexene-1-carboxylic acid.

[0052] The GC detection method is as follows: Trace1610 gas chromatograph (Thermo Fisher Trace1610); chiral gas column: B-DM (0.25 mm × 30 m × 0.12 mm), injection port temperature: 250 ° C; FID detector temperature: 250 ° C; air flow rate 350 mL / min, tail gas flow rate 40 mL / min; constant pressure: 137.9 kPa; constant flow 1 mL / min. Column box heating program: initial temperature 50 ° C, hold for 2 min, heat up to 120 ° C at 6 ° C / min, hold for 2 min, heat up to 144 ° C at 2 ° C / min, hold for 2 min.

[0053] from Figures 2 to 5 The results showed that compared with the wild-type lipase CALB, the selectivity of the lipase CALB with single-site mutations (T40K, D134S, V154I, I189R, L278N, A281Q) was significantly improved, and the selectivity and conversion rate of the lipase CALB with combined site mutations (D134S / A281Q) were better than those of the wild-type, with the highest conversion rate reaching 52% and ee p The maximum value can reach 72%, which shows that the present invention can significantly improve the activity and selectivity of lipase CALB by designing mutations at multiple different amino acid sites.

[0054] In summary, the present invention creatively discovered that by designing mutations at multiple different amino acid sites, the activity and stereoselectivity of lipase CALB in catalyzing racemic 3-cyclohexene-1-carboxylic acid methyl ester can be improved, which is more conducive to the activity of producing (S)-3-cyclohexene-1-carboxylic acid, reduces production costs and is environmentally friendly, is conducive to large-scale production through microbial fermentation, and is more suitable for commercial and industrial applications.

[0055] The above description is only a detailed description of the preferred embodiments and principles of the present invention. For ordinary technicians in this field, according to the ideas provided by the present invention, there will be changes in the specific implementation methods, and these changes should also be regarded as the protection scope of the present invention.

Claims

1. A lipase CALB mutant, characterized in that: The mutant is derived from the amino acid sequence shown in SEQ ID NO.1 by site-directed mutagenesis, and the mutation site is one of the following: (1) Lysine at position 278 is mutated to aspartic acid.

2. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the lipase CALB mutant according to claim 1.

3. A recombinant vector, characterized in that: The recombinant vector contains the coding sequence of the lipase CALB mutant according to claim 1.

4. A recombinant genetically engineered bacterium, characterized in that: The recombinant genetically engineered bacteria contains the recombinant vector according to claim 3.

5. A recombinant genetically engineered bacterium according to claim 4, characterized in that: The recombinant genetic engineering bacteria uses Escherichia coli as an expression host.

6. Use of the lipase CALB mutant according to claim 1 in the preparation of (S)-3-cyclohexene-1-carboxylic acid.

7. The use according to claim 6, characterized in that: The application is as follows: phosphate buffer solution, 3-cyclohexene-1-carboxylic acid methyl ester, wet bacteria obtained by fermentation culture of recombinant genetic engineering bacteria containing lipase CALB mutant encoding gene or crude enzyme solution extracted after ultrasonic crushing of wet bacteria are evenly mixed, and catalytic reaction is carried out to obtain (S)-3-cyclohexene-1-carboxylic acid.

8. The use according to claim 7, characterized in that: The reaction temperature of the catalytic reaction is 0-40°C, and the reaction time is 2-12h.

Images