Nuclease mutants and uses thereof

By mutating the Trichoderma reesei nuclease to S165W, a highly efficient nuclease mutant was developed, solving the problem of removing biofilm dirt and odors from clothing in the daily chemical industry. It achieved high enzyme activity and stability under alkaline conditions, thus improving the washing effect.

CN119876091BActive Publication Date: 2026-03-03GUANGDONG VTR BIO TECH
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-22
Publication Date
2026-03-03

AI Technical Summary

Technical Problem

The daily chemical industry lacks effective types of nucleases, making it difficult to remove dirt and odors caused by biofilms adhering to clothing, and existing detergent compositions are not effective.

Method used

By mutating nucleases derived from Trichoderma reesei to S165W, their enzyme activity and stability were improved, and a nuclease mutant with high efficiency in degrading DNA was developed and applied to detergents and disinfectants.

Benefits of technology

It improves the storage stability and enzyme activity of nucleases, especially under alkaline conditions, and can effectively remove biofilm-related dirt and odors, thus enhancing the washing effect.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to a nuclease mutant and application thereof. The application carries out S165W mutation on a nuclease (amino acid sequence is shown as SEQ ID NO:1) derived from Trichoderma reesei Trichoderma reesei Compared with the wild-type nuclease, the nuclease mutant of the application has improved storage stability, higher enzyme activity at a temperature of 10 DEG C-55 DEG C, and improved enzyme activity under alkaline conditions. The application provides a new nuclease which can retain more than 75% of enzyme activity after storage for 1 week, and is beneficial to application in washing or disinfecting products in the daily chemical industry.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to nuclease mutants and their applications. Background Technology

[0002] Nucleases are a collective term for a series of enzymes that degrade deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) into mononucleotides and oligonucleotides. They can be mainly divided into specific nucleases and non-specific nucleases. In recent years, the application of nucleases in the daily chemical industry has gradually increased.

[0003] Some body grime and contaminants can adhere to clothing and form a biofilm. This biofilm makes the clothing sticky, attracting even more dirt to these sticky areas, causing the clothing to darken or yellow. Commercially available detergent compositions are often ineffective at removing this type of dirt.

[0004] Research has found that bacterial deoxyribonucleases can be used to disrupt and prevent biofilms. Currently, there is a lack of suitable nucleases for use in the daily chemical industry; therefore, there is an urgent need to develop nucleases applicable to this sector. Summary of the Invention

[0005] The purpose of this invention is to provide a nuclease mutant.

[0006] Another objective of this invention is to provide a nuclease gene.

[0007] Another object of the present invention is to provide applications for the above-mentioned nuclease mutants. The nuclease mutants provided by the present invention have a highly efficient degradation effect on deoxyribonucleic acid or nucleic acids, and can be applied in the daily chemical industry.

[0008] This invention relates to Trichoderma reesei. Trichoderma reesei The nuclease (amino acid sequence shown in SEQ ID NO:1) was mutated to S165W, and the nucleotide sequence of the gene encoding the parental nuclease is shown in SEQ ID NO:2.

[0009] SEQ ID NO:1:

[0010] APLPAPPGIPSEDTARTQLAGLTVAVVGSGTGYSRDLFPTWDAISGNCNAREYVLKRDGEGVQVNNACEAQSGSWISPYDNASFTNASSLDIDHMVPLKNAWISGASTWTTAQREALANDVSRPQLWAVSASSNRSKGDRSPDQWKPPLTSFYCTYAKSWIDVKSYYKLTITSAEKTALSSMLDTC.

[0011] SEQ ID NO:2:

[0012] .

[0013] The nuclease mutant according to the present invention has the amino acid sequence shown in SEQ ID NO:3.

[0014] SEQ ID NO:3:

[0015] APLPAPPGIPSEDTARTQLAGLTVAVVGSGTGYSRDLFPTWDAISGNCNAREYVLKRDGEGVQVNNACEAQSGSWISPYDNASFTNASSLDIDHMVPLKNAWISGASTWTTAQREALANDVSRPQLWAVSASSNRSKGDRSPDQWKPPLTSFYCTYAKSWIDVKWYYKLTITSAEKTALSSMLDTC.

[0016] The present invention provides a method for improving the activity and stability of a nuclease, the method comprising the step of mutating the nuclease with an amino acid sequence as shown in SEQ ID NO:1 by S165W.

[0017] The beneficial effects of this invention are as follows:

[0018] Compared with wild-type nucleases, the nuclease mutants of the present invention have improved storage stability, higher enzyme activity at temperatures of 10°C-55°C, and improved enzyme activity under alkaline conditions.

[0019] This invention provides a novel nuclease that retains more than 75% of its activity after one week of storage, which is beneficial for its application in detergents or disinfection products in the daily chemical industry. Detailed Implementation

[0020] To enable those skilled in the art to more clearly understand the technical solutions described in this invention, the following embodiments are provided for illustration. It should be noted that the following embodiments do not constitute a limitation on the scope of protection claimed by this invention.

[0021] Unless otherwise specified, the biological materials, reagents, or devices used in the following examples are all available from conventional commercial sources or can be obtained by existing known methods. Molecular biology experimental methods not specifically described in the following examples were performed according to the specific methods listed in J. Sambrook's *Molecular Cloning: A Laboratory Manual* (3rd Edition), or according to the kit and product instructions.

[0022] The nuclease mutant of the present invention is a polypeptide with nuclease activity and containing the KNAW-clade motif, exhibiting particularly good cleaning properties, such as being particularly effective in removing or reducing organic components, such as biofilm-associated DNA, from articles (e.g., textiles or hard surfaces); it also performs excellently in removing attached odor substances and can significantly reduce odors on fabrics caused by microbial activity.

[0023] The term "biofilm" refers to a microbial community embedded in an extracellular polymeric matrix attached to a surface. The extracellular polymeric matrix is ​​a polymeric aggregate typically composed of extracellular DNA, proteins, and polysaccharides. Biofilms may contain one or more microorganisms and include other trapped particles. These microorganisms can be Gram-positive or Gram-negative bacteria (aerobic or anaerobic); algae, protozoa, and / or yeast or filamentous fungi.

[0024] In some embodiments, the nuclease mutant of the present invention retains more than 75% of its enzyme activity when stored at pH 7.0 for one week.

[0025] In some embodiments, the nuclease mutant of the present invention retains enzyme activity at 10°C, 25°C, 35°C, 45°C, and 55°C in an alkaline environment of pH 9.0. In some embodiments, the nuclease mutant of the present invention retains more than 40% enzyme activity at 10°C-55°C in an alkaline environment of pH 9.0. Preferably, 35°C is the optimal reaction temperature for the nuclease mutant of the present invention in an alkaline environment of pH 9.

[0026] In some embodiments, the nuclease mutant of the present invention retains more than 60% of its enzyme activity under alkaline conditions with pH values ​​below 10.0, 9.0, and 8.0 at the optimal reaction temperature of 35°C.

[0027] Compared with wild-type nucleases, the nuclease mutants of the present invention have improved storage stability, higher enzyme activity at temperatures of 10°C-55°C, and improved enzyme activity under alkaline conditions.

[0028] The present invention also provides recombinant vectors comprising at least one polynucleotide, such as polynucleotides encoding polypeptides with nuclease activity provided by the present invention. In some embodiments, the present invention also provides expression vectors or expression cassettes comprising said polynucleotides, wherein said polynucleotides are operatively linked to one or more promoters required for effective gene expression and are operatively linked to a selection gene capable of enabling continuous culture of plasmid-infected host cells by growth in a culture medium containing antibiotics.

[0029] In some embodiments, the present invention also provides recombinant cells comprising the expression vector or expression cassette. To express and produce the target protein in the recombinant cells, at least one expression vector comprising at least one copy (and in some cases multiple copies) of a polynucleotide encoding a nuclease mutant of the present invention is transformed into a host cell.

[0030] The nuclease mutants of this invention can be generated in the host cells of any suitable microorganism (including bacteria and fungi). In one embodiment of this invention, the host cell is Pichia pastoris Y135.

[0031] Introducing a vector containing a polynucleotide sequence encoding a nuclease into recombinant cells and inducing the expression of the nuclease by these recombinant cells can be used in daily chemical products such as textiles and detergents.

[0032] In some embodiments of the present invention, the nuclease is secreted into a supernatant after induction culture, and then high-purity target protein is obtained from the supernatant or concentrated supernatant using existing protein purification methods. In a preferred embodiment of the present invention, high-purity target protein is obtained by HPLC purification.

[0033] In one embodiment of the invention, a method for preventing, reducing, or removing biofilms is also provided, the method comprising contacting the biofilm with a cleaning composition comprising the nuclease mutant of the present invention. The biofilm is on textiles or a hard surface, such as the surface of a laundry machine, tableware, or dishwashing machine.

[0034] The present invention also provides a detergent composition comprising (i) the nuclease mutant of the present invention; and (ii) at least one other enzyme, wherein the at least one other enzyme is selected from the group consisting of: acyltransferase, α-amylase, β-amylase, α-galactosidase, arabinosidase, aryl esterase, β-galactosidase, carrageenanase, catalase, cellobiase, cellulase, chondroitinase, keratinase, endo-β-1,4-glucanase, endo-β-mannanase, esterase, exo-mannanase, galactanase, and glucose. Amylase, hemicellulase, hyaluronidase, keratinase, laccase, lactase, ligninase, lipase, lipoxygenase, lysozyme, mannanase, metalloproteinase, nuclease, oxidase, oxidoreductase, pectic acid lyase, pectin acetylesterase, pectinase, pentosanase, peroxidase, phenol oxidase, phosphatase, phospholipase, polygalacturonase, polyesterase, protease, amylopectinase, reductase, rhamnogalacturonase, β-glucanase, tannic acidase, transglutaminase, xylan acetylesterase, xylanase, xyglucanase, and xylosidase.

[0035] The following describes a more specific embodiment.

[0036] The experimental materials, reagents, and nuclease assay methods used in the following examples are as follows:

[0037] 1. Strains and vectors: Strains containing the TRnuc nuclease gene and expression plasmid, such as Escherichia coli strain Top10, Pichia pastoris Y135, vector pPICZαA, and antibiotic Zeocin.

[0038] 2. Enzymes and kits: Primer start 2×Master Mix PCR polymerase, restriction endonucleases, plasmid extraction kit, and purification kit.

[0039] 3. Culture medium

[0040] The culture medium for *E. coli* was LB medium (1% peptone, 0.5% yeast extract, 1% NaCl, pH 7.0).

[0041] The selection media for Escherichia coli were LB+Amp medium (LB medium with ampicillin added to a final concentration of 100 μg / mL) and LB+Zeo medium (LB medium with Zeocin added to a final concentration of 25 μg / mL).

[0042] The yeast culture medium was YPD medium (1% yeast extract, 2% peptone, 2% glucose);

[0043] The yeast selection medium was YPD+Zeo medium (YPD+Zeo medium is YPD medium with Zeocin added to a final concentration of 100 μg / mL).

[0044] Yeast induction media BMGY (1% yeast extract, 2% peptone, 1.34% YNB, 0.00004% Biotin, 1% glycerol (v / v)) and BMMY (except that 0.5% methanol is used instead of glycerol, the other components are the same as BMGY).

[0045] Basic salt medium for recombinant yeast fermentation: 5% diammonium hydrogen phosphate, 0.5% potassium dihydrogen phosphate, 1.5% magnesium sulfate heptahydrate, 1.95% potassium sulfate, 0.1% calcium sulfate, and 0.03% defoamer. After autoclaving, add 4.35 mL of PTM1 per liter, where PTM1 (trace salt solution) contains: 0.6% copper sulfate, 0.018% potassium iodide, 0.3% manganese sulfate monohydrate, 0.02% sodium molybdate dihydrate, 0.002% boric acid, 0.05% cobalt chloride hexahydrate, 2% zinc chloride, 6.5% ferric sulfate heptahydrate, 0.5% concentrated sulfuric acid, and 0.02% biotin.

[0046] 4. Nuclease activity assay method

[0047] Nucleases hydrolyze phosphodiester bonds in single-stranded or double-stranded deoxyribonucleic acid (DNA), producing mononucleotides or oligonucleotides of 8-12 bases. The amount of DNA is directly proportional to absorbance; the degradation of DNA by nucleases increases absorbance. Therefore, the activity of nucleases is determined by measuring the difference in absorbance of the reaction solution using spectrophotometry. Depending on experimental requirements, different temperatures and pH levels can be adjusted for enzyme activity detection.

[0048] Using calf thymus DNA as a substrate, at 25°C and pH 5.0, a change of 0.001 absorbance per milliliter per minute at 260 nm constitutes one unit of enzyme activity (Kunitz unit).

[0049] Determination of optimal reaction temperature and pH, and storage stability testing.

[0050] The activity of nucleases was measured at pH 9.0 at 10℃, 25℃, 35℃, 45℃, 55℃ and 65℃, with the activity measured at 35℃ as a control. The relative activity of nucleases under different temperature conditions was calculated.

[0051] Optimal pH enzyme activity assay: The enzyme activity of nuclease was measured at 35℃ under pH 7.0, pH 8.0, pH 9.0, and pH 10.0 conditions.

[0052] Example 1 Synthesis of the nuclease TRnuc gene and construction of the vector

[0053] Trichoderma reesei ( Trichoderma reesei The amino acid sequence of the nuclease TRnuc is shown in SEQ ID NO:1, and the nucleotide sequence is shown in SEQ ID NO:2. EcoRI and XbaI restriction sites were introduced at the 5' and 3' ends of the nuclease gene TRnuc and ligated into the pUC57-amp vector. pUC57-TRnuc and pUC57-NUC2 were inoculated into LBA medium and cultured for 24 hours. The plasmids were extracted, digested with EcoRI and XbaI, and the target gene fragment was recovered by gel digestion. The product was purified and recovered and ligated into the expression vector pPICzαA to obtain the expression vector pPICzαA-TRnuc.

[0054] Example 2: Site-directed mutagenesis of nucleases

[0055] Using pPICzαA-TRnuc as a template, PCR amplification was performed using the following primers:

[0056] S165W-F: aagtcgtggattgacgtcaagtggtattacaagttgactattacg (SEQ ID NO: 4),

[0057] S165W-R: cgtaatagtcaacttgtaataccacttgacgtcaatccacgactt (SEQ ID NO: 5).

[0058] PCR amplification results were detected by agarose gel electrophoresis, and the PCR products were purified and recovered. The original plasmid was digested with the restriction endonuclease DpnI, and the digested product was transformed into *E. coli* Top10 cells using a heat shock method. The recombinant transformants were verified by colony PCR, and the plasmids of the verified transformants were extracted and sequenced to identify the corresponding mutants. The mutant expression vector pPICzαA-TRnuc-S165W was obtained, and the plasmids of the verified transformants were used. The mutant plasmid was linearized with the PmeI endonuclease, the linearized plasmid fragment was purified, and it was transformed into *Pichia pastoris* Y135 competent cells by electroporation. YPD+Zeo medium was used for selection to obtain yeast recombinant transformants.

[0059] Example 3 Storage stability of nuclease mutants

[0060] Using toothpicks, the yeast recombinant transformants obtained in Example 2 were individually transferred to 24-well plates. 1 mL of BMGY medium was added to each well, and the plates were incubated at 30°C and 220 rpm for approximately 24 hours. The supernatant was then removed by centrifugation. 1.6 mL of BMGY medium was added to each well for induction culture. After 24 hours of incubation, the supernatant was collected by centrifugation. 200 μL of the supernatant was transferred to 96-well plates for nuclease activity assays. High-activity yeast recombinant transformants were obtained through high-throughput screening. The yeast recombinant mutants with the highest activity of the vectors pPICzαA-TRnuc and pPICzαA-TRnuc-S165W were named PP-TRnuc and PP-MUT1, respectively.

[0061] Storage stability test: The enzyme activity of the nuclease parent and its mutant was determined after one week of storage at pH 7.0 according to the formula (69% enzyme solution, 30% glycerol, 0.4% potassium sorbate, 0.1% sodium methyl methacrylate, and 0.5% Kathon).

[0062] Table 1. Stability determination of nuclease mutants

[0063] strains Storage enzyme activity retention rate PP-TRnuc 47.6% PP-MUT1 75.5% .

[0064] As can be seen from Table 1, the stability of the nuclease mutant PP-MUT1 obtained by mutation based on TRnuc in this invention is significantly improved, and the enzyme activity retention rate is increased to 75.5%.

[0065] Example 4: Optimal temperature and optimal reaction pH of parental nucleases and their mutants

[0066] The activity of nucleases was measured at pH 9.0 at 10℃, 25℃, 35℃, 45℃, 55℃ and 65℃, with the activity measured at 35℃ as a control. The relative activity of nucleases under different temperature conditions was calculated.

[0067] Table 2. Relative enzyme activities of nuclease PP-TRnuc and its mutant at various temperatures.

[0068] Temperature ℃ PP-TRnuc PP-MUT1 10 88.5% 81.4% 25 97.3% 96.5% 35 100% 100% 45 84.1% 91.3% 55 40.7% 46.5% 65 21.2% 32.4% .

[0069] The results are shown in Table 2. The optimal reaction temperature range of the nuclease provided by the present invention is 35℃, and its relative enzyme activity is higher at all low temperatures (10-25℃) than at high temperatures (55-65℃), indicating that it can maintain good enzyme activity in low-temperature environments.

[0070] Table 3. Relative enzyme activities of nuclease TRnuc and its mutant at various pH values.

[0071] pH TRnuc PP-MUT1 7.0 33.9% 33.1% 8.0 58.6% 60.9% 9.0 100% 100% 10.0 81.4% 84.3% .

[0072] Subsequently, optimal pH enzyme activity was determined. The nuclease activity was measured at 35℃ under pH conditions of 7.0, 8.0, 9.0, and 10.0. The enzyme activity measured at pH 9.0 was used as a control, and the relative enzyme activity under different pH conditions was calculated. The results are shown in Table 3. The optimal pH for both the nuclease TRnuc and the mutant was 9.0.

[0073] Example 5 Application Testing

[0074] The nuclease PP-TRnuc and its mutant PP-MUT1 were applied to laundry detergent formulations to compare their performance in removing fabric odors.

[0075] Nucleases PP-TRnuc and PP-MUT1 were added to a standard commercial laundry detergent (fragrance-free) at a ratio of 0.5% to prepare a laundry detergent sample containing nucleases. The formula of this standard commercial laundry detergent is shown in Table 4.

[0076] Table 4 Laundry Detergent Formula

[0077] Raw material name Amount added (%) Liquid caustic soda (32%) 1.2 sulfonic acid 3 AES 12 AEO-9 2 Sodium cocoate 4 APG 1 Sodium citrate 0.5 Sodium polyacrylate 1 Kathon 0.1 Industrial salt 1.5 softened water 73.7 .

[0078] Collect adult shirts, any material, collected after exercise or physical labor, and left for 1-2 days. Cut each garment vertically into four pieces. Three selected volunteers independently rate the odor of each piece of clothing, assigning scores of 0, 1, 2, 3, 4, and 5 respectively: no odor, barely perceptible odor, slight odor, moderate odor, noticeable odor, and strong odor. The lower the score, the less odor there is.

[0079] Weigh 20 grams of laundry detergent without added nuclease as a blank control. Then weigh 20 grams of laundry detergent samples containing PP-TRnuc and PP-MUT1 respectively, and add them to four washing machines of the same model. Add clothes whose odor has been evaluated to the four washing machines and record the results. Select the same cotton fabric program for washing. After washing, place the clothes to be tested in punctured resealable bags and hang them at 25°C for 48 hours.

[0080] After hanging for 48 hours, three selected volunteers independently rated the odor of each garment and recorded the scores. The results are shown in Table 5.

[0081] Table 5 Odor Removal Performance of PP-TRnuc and PP-MUT1 on Clothing

[0082] .

[0083] As shown in Table 5, the laundry detergent (blank group) could only partially remove odors from the surface of clothing. Comparing the laundry detergent group with added nucleases TRnuc and PP-MUT1, it can be found that adding the nuclease mutant of this invention effectively improves the odor removal ability of the laundry detergent, showing a more significant effect on removing odors from clothing. This embodiment demonstrates that the nuclease mutant performs excellently in disrupting microbial biofilms and removing attached odor substances, significantly reducing odors on fabrics caused by microbial activity.

[0084] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.

Claims

1. A nuclease mutant, characterized in that, The amino acid sequence of the nuclease mutant is set forth in SEQ ID NO:

3.

2. A nuclease gene, characterized in that, The nuclease mutant of claim 1.

3. Use of the nuclease mutant of claim 1 for removing or reducing a biofilm formed by a microbial community embedded or attached to an object, wherein, The microorganism is a prokaryote or a eukaryote.

4. Use according to claim 3, characterized in that, The nuclease mutant of claim 1 is contacted with the biofilm at a temperature of 10°C to 55°C under alkaline conditions.

5. Use according to claim 3, characterized in that, The nuclease mutant of claim 1 is contacted with the biofilm at a temperature of 35°C at a pH of 8.0 to 10.

0.

6. A detergent composition characterized in that, The detergent composition comprises (i) the nuclease mutant of claim 1.

7. A method for improving the enzymatic activity and stability of a nuclease, characterized by, The method is mutating a nuclease having an amino acid sequence set forth in SEQ ID NO: 1 at S165W.

8. A method of producing a nuclease, characterized by, The method comprises the steps of expressing a gene encoding the nuclease mutant of claim 1 in a host cell and purifying the expressed nuclease.

9. The method of producing a nuclease according to claim 8, wherein, The method further comprises the steps of constructing a recombinant expression vector comprising the gene encoding the nuclease mutant of claim 1 and introducing the recombinant expression vector into the host cell.

Citation Information

Patent Citations

  • Polynucleotides encoding novel nuclease, compositions thereof and methods for eliminating DNA from protein formulations

    CN117881772A

  • Novel compositions for disrupting biofilms

    US20220354932A1