Method for synthesizing RNA (Ribonucleic Acid) by controlling DNA (Deoxyribonucleic Acid) microarray through voltage addressing

Abstract

The invention discloses a method for synthesizing RNA (Ribonucleic Acid) by controlling a DNA (Deoxyribonucleic Acid) microarray through voltage addressing. According to the method, voltage addressing control and in-vitro transcription are combined to realize multiple selective synthesis of RNA. According to a designed DNA sequence, DNA is synthesized in situ or synthesized DNA is fixed on an electrode microarray by means of an arm molecule, and in-vitro transcription is triggered through electric control addressing to achieve the purpose of selectively synthesizing RNA. According to the invention, multi-batch RNA selective synthesis can be realized on the basis of not destroying the sequence of the microarray, and each sequence can generate a plurality of RNA molecular copies in the selective synthesis process for subsequent direct use or reverse transcription into a DNA sequence for use. In addition, by means of hybridization and bonding of RNA primers and existing sequences and digestion of DNA, in-situ synthesis of the RNA microarray can be achieved. A simplified process is provided for RNA synthesis, and the potential of reducing cost and improving yield is achieved.

Description

Technical Field

[0001] The invention relates to a method for synthesizing RNA by controlling a DNA microarray by voltage addressing, and belongs to the field of RNA synthesis. Background Art

[0002] In the field of synthetic biology, in vitro transcription is an important technology used to transcribe specific DNA templates into RNA products. This method has wide applications in the fields of RNA drug development, gene editing, and nucleic acid detection. At present, RNA polymerase-driven in vitro transcription is widely used due to its high efficiency and specificity. However, existing promoter-driven in vitro transcription systems usually rely on chemical reagents or temperature control conditions to regulate the transcription process, which not only has high costs, but may also be limited by complex operating and environmental conditions in some application scenarios.

[0003] RNA polymerase relies on specific promoter sequences, and in actual operation, improper template design may lead to low transcription efficiency. In addition, RNA polymerase may initiate transcription in non-specific regions, reducing the yield and purity of the target RNA. During in vitro transcription, truncated RNA, overly long RNA, or other non-specific RNA may be generated. These by-products not only affect the quality of the RNA product, but may also interfere with subsequent applications, such as nucleic acid detection or RNA drug development. Traditional in vitro transcription systems usually rely on fixed concentrations of chemical components (such as Mg 2+ , NTP, DNA template, etc.), lacking the ability of dynamic regulation. Once the transcription reaction is started, it is difficult to achieve real-time control, affecting the controllability of the experiment and the flexibility of the results. In vitro transcription products are susceptible to degradation by RNases. Even in a strictly nuclease-free environment, the instability of RNA may still limit its application, especially in scenarios of long-term storage or transportation. The template DNA has poor reusability, and the DNA template may be contaminated or degraded during in vitro transcription, resulting in low efficiency in template reuse and increasing experimental costs. The current T7 in vitro transcription method is usually designed for laboratory scale and is difficult to meet the needs of industrialization or high-throughput production. For example, system optimization and expansion of reaction volume often require a lot of time and resource investment. Due to the high activity of RNA polymerase, there may be unconsumed NTPs, template DNA and byproduct RNA in the reaction system, which complicates the purification of transcription products and increases subsequent processing costs. However, these problems provide a clear direction for the optimization and upgrading of promoter in vitro transcription technology. Summary of the invention

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide a method for voltage-addressed controlled DNA microarray synthesis of RNA, which can not only realize dynamic regulation of RNA synthesis and reuse of DNA templates, but also provide a new tool for nucleic acid detection and synthetic biology research, and solve the problems of poor reusability of template DNA for in vitro transcription of promoters, lack of flexibility in system regulation, and complex purification of transcription products.

[0005] Technical solution: To solve the above technical problems, the present invention provides a method for voltage-addressed control of DNA microarray synthesis of RNA, comprising the following steps:

[0006] Step 1, designing a DNA molecule, wherein the DNA structure includes a stem-loop structure or a linear structure;

[0007] Step 2, treating the electrode microarray chip to modify the arm molecules by chemical or electrochemical methods;

[0008] Step 3, synthesizing or fixing the DNA molecule on the electrode through chemical bonds;

[0009] Step 4, controlling the conformational changes of DNA through voltage addressing, thereby achieving selective in vitro transcription and synthesis of RNA.

[0010] Furthermore, the stem-loop structure includes a target sequence, a promoter sequence and a complementary sequence, and Ploy T / A.

[0011] Furthermore, the linear structure comprises the target sequence, the promoter complementary sequence, and Ploy T / A.

[0012] Furthermore, functional groups are modified at the Ploy T / A position, and the functional groups include thiol, amino, carboxyl, aldehyde, o-aminophenol, biotin, etc., which can be connected to the arm molecules on the electrode.

[0013] The electrode microarray chip may be a commercially available chip.

[0014] Furthermore, the electrode material is a conductive electrode material, including gold, platinum, silver, carbon (such as graphite, carbon nanotubes), titanium, some metal oxides (such as indium tin oxide), some metal nitrides (titanium nitride), etc.

[0015] Furthermore, the electrode surface is modified with chemical or electrochemical methods, wherein the chemical modification includes monolayer self-assembly, covalent bond binding, etc.; the electrochemical method includes cyclic voltammetry and chronoamperometry.

[0016] Furthermore, the arm molecule includes a diazonium salt molecule, a silane coupling agent, and avidin.

[0017] Furthermore, if Figure 2As shown, the voltage addressing control includes electrical switching or electrical assisted hybridization, etc.; electrical switching will cause the DNA chain to stand upright or lie flat on the electrode surface, thereby promoting or inhibiting (depending on spatial resistance) the promoter transcription and synthesis of RNA; electrical assisted hybridization will accelerate or inhibit the hybridization rate between the promoter and the DNA chain on the electrode, thereby affecting the in vitro transcription and synthesis of RNA.

[0018] Furthermore, in vitro transcription includes T3 promoter transcription, T7 promoter transcription, Sp6 promoter transcription, and the like.

[0019] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0020] 1. The present invention enables the DNA on the electrode to be reused;

[0021] 2. The present invention can selectively transcribe RNA by voltage control;

[0022] 3. The present invention can perform multiple rounds of transcription to produce a large number of RNA copies;

[0023] 4. The present invention can realize multiple batches of RNA selective synthesis without destroying the sequence of the microarray. Each sequence can generate multiple copies of RNA molecules during the selective synthesis process for subsequent direct use or reverse transcription into DNA sequences;

[0024] 5. In situ synthesis of RNA microarrays can also be achieved by using RNA primers to hybridize, bond and digest DNA with existing sequences;

[0025] 6. As a non-contact, precisely controlled and simplified method, the present invention can control the process of biological reactions under micro-scale and rapid response conditions, and has the potential to reduce costs and increase production. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is a schematic diagram of the DNA structure of the present invention;

[0027] Figure 2 A schematic diagram of the process of addressing and transcribing RNA of the present invention;

[0028] Figure 3 Schematic diagram of electrical switching (a), reaction time (b) and voltage optimization result (c);

[0029] Figure 4 Schematic diagram of electrical switching addressable transcription RNA and reverse transcription quantitative PCR results: Figure 4 a: negative voltage is applied to both electrodes simultaneously; Figure 4 b is to apply a negative voltage to the electrode where the DNA is located, numbered 150-A, and to apply a positive voltage to the electrode where the DNA is located, numbered 150-B; Figure 4c is applying a positive voltage to the electrode where the DNA is located, numbered 150-A, and applying a negative voltage to the electrode where the DNA is located, numbered 150-B; Figure 4 d: positive voltage is applied to both electrodes simultaneously;

[0030] Figure 5 This is the Sanger sequencing result when 150-A is selectively transcribed;

[0031] Figure 6 This is the Sanger sequencing result for 150-B selective transcription. DETAILED DESCRIPTION

[0032] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0033] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available, unless otherwise specified, and the techniques not described in detail are all carried out according to standard methods well known to those skilled in the art. The reagents and instruments mentioned in this application are all commercially available or available to the public in other ways. Other suitable tools or materials can be used to replace them respectively. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0034] Example 1

[0035] like Figure 2 As shown, this embodiment is a method for electrically switching addressing to control DNA microarray synthesis of RNA, comprising:

[0036] 1. Chip design

[0037] The electrode microarray chip is designed with silicon wafer as substrate, platinum as electrode material, electrode diameter of 1mm, and silicon dioxide as insulating layer. Electrode pattern is made on the substrate using photolithography technology, an insulating layer is formed around the electrode pattern, gold electrode leads and pins are made on the edge of the chip, and the chip and flexible cable are made using screen pressing technology to complete the production of microelectrode array chip.

[0038] 2. DNA sequence design

[0039] The DNA sequence was designed as a stem-loop structure with a length of 150 nt (shown in SEQ NO.1 and SEQ NO.2). The structure from the 5' end to the 3' end was the target sequence, the T7 promoter complementary sequence, PloyT, the modified NH2 C6 dT and the T7 promoter recognition sequence. Figure 1 As shown, DNA molecules can be fixed on the electrode through the formation of amide bonds between the amino group and the carboxyl group.

[0040] SEQ ID NO.1 (No.: 150-A):

[0041] GTCCATACCTTAGATGCGTTAGCATTAATCCTCAGTTCGTTCTCGTCGACAATG

[0042] GCGGAACTGGCGACGTGACTGTCGCCCCAAGCAACTTCGCTAACGGCCCTATAGTGAGTCGTATTATTTTT / iNH2C6dT / TTTTTAATACGACTCACTATAGGG

[0043] SEQ ID NO.2 (No.: 150 - B):

[0044] GTCCATACCTTAGATGCGTTAGCATCCTCAGTTCGTTCTCGTCCACTTAAACCC

[0045] ATCATTGATCACGCCAGACTGTCGCCCCAAGCAACTTCGCTAACGGCCCTATAGTGAGTCGTATTATTTTT / iNH2C6dT / TTTTTAATACGACTCACTATAGGG

[0046] Forward primer (5’ - 3’): SEQ ID NO.3:

[0047] GTCCATACCTTAGATGCGTTAGC

[0048] Reverse primer (5’ - 3’): SEQ ID NO.4:

[0049] CCGTTAGCGAAGTTGCTTGG

[0050] Probe 1 (5’ - 3’): SEQ ID NO.5:

[0051] FAM - ACGTCGCCAGTTCCGCCATTGTCG - BHQ

[0052] Probe 2 (5’ - 3’): SEQ ID NO.6:

[0053] HEX - CCACTTAAACCCATCATTGATCACGCCA - BHQ

[0054] 3. Electrode modification

[0055] Prepare an acetonitrile solution containing 2mM 4-carboxybenzenediazonium tetrafluoroborate and 0.5M tetrabutylammonium tetrafluoroborate, and place in an ice bath away from light for 10 minutes. Use a three-electrode system, working electrode (microelectrode array chip electrode), reference electrode (Ag / AgCl electrode), counter electrode (platinum wire electrode), immerse the electrodes in the solution, and use cyclic voltammetry, voltage (0.6V~-0.6V), scan rate of 100mV / s, scan 4 times until stable. Then rinse the electrodes with a large amount of ultrapure water and blow dry with nitrogen.

[0056] 4. DNA fixation

[0057] Prepare 20μL of spotting solution: 10μL 100μM DNA sequence (150-A or 150-B), 4μL 100mM EDC (1-ethyl-(3-dimethylaminopropyl) carbodiimide), 2μL 50mM NHS (N-hydroxysuccinimide), 4μL 10mM HEPES (4-hydroxyethylpiperazineethanesulfonic acid) buffer. Take 0.5μL of the prepared spotting solution for each electrode, then place it in a wet box and leave it at room temperature overnight. Then wash it with 2×SSC, 0.1% SDS, then wash it with 1×SSC and then transfer it to deionized water for rinsing 3 times, blow dry it with nitrogen, and then store it in a refrigerator at 4℃.

[0058] 5. Configure T7 transcription reaction system and reverse transcription quantitative PCR reaction system

[0059] T7 transcription reaction system includes: 4 μL NTP S (10mM), 2μL of 10× Reaction Buffer, 1μL of T7 RNA polymerase (5U / μL), 1μL of RNase Inhibitor (40U / μL), and enzyme-free water to make up to 20μL. The reaction temperature was 37°C.

[0060] The reverse transcription quantitative PCR reaction system (Nanjing Novozyme Biotechnology Co., Ltd., catalog number Q223) includes: 1 μL of the sample to be tested, 10 μL of 2×One Step U + Mix a , 0.4 μL of upstream and downstream primers (10 μM, SEQ ID NO.3 and SEQ ID NO.4), 0.2 μL of probe (10 μM, SEQ ID NO.5 and SEQ ID NO.6), 0.5 μL of One Step U + Enzyme Mix b , and enzyme-free water was added to 20 μL. The reaction procedure included: reverse transcription at 55°C for 15 min; pre-denaturation at 95°C for 30 s; 45 cycles of reaction: denaturation at 95°C for 10 s, and amplification at 60°C for 30 s.

[0061] 6. Optimize response time and voltage

[0062] The configured T7 transcription reaction system was covered on the electrodes, and in vitro transcription was performed at 37°C. A negative voltage was applied to the electrode where the DNA numbered 150-A was located, and a positive voltage was applied to the electrode where the DNA numbered 150-B was located. First, the reaction time was optimized, and the applied voltage was set to -1.5V and the time was set to 1 to 5 minutes. The results were as follows: Figure 3 In order to ensure the stability of the experiment and the small difference between 1 and 2 minutes, the reaction time was finally determined to be 1.5 minutes. Under the condition of a reaction time of 1.5 minutes, the voltage was optimized, and the voltage range was -2V to 2V. The results are as follows Figure 3 , and finally determined the applied voltage to be -1.5V.

[0063] 7. The electrically controlled addressable DNA microarray is used to synthesize RNA by in vitro transcription. A negative voltage is applied to the electrode that needs to synthesize RNA, and a positive voltage is applied to the electrode that does not need to synthesize RNA. After in vitro transcription, reverse transcription quantitative PCR is used for quantitative analysis. The results are as follows: Figure 4 . Figure 4 a Negative voltage was applied to both electrodes simultaneously, and the reverse transcription quantitative PCR test showed that two RNAs were successfully transcribed; Figure 4 b A negative voltage is applied to the electrode where the DNA numbered 150-A is located, and a positive voltage is applied to the electrode where the DNA numbered 150-B is located. Reverse transcription quantitative PCR shows that the DNA numbered 150-A is successfully transcribed, while the DNA numbered 150-B is not transcribed; Figure 4 c. A positive voltage is applied to the electrode where the DNA numbered 150-A is located, and a negative voltage is applied to the electrode where the DNA numbered 150-B is located. Reverse transcription quantitative PCR shows that the DNA numbered 150-A is not transcribed, while the DNA numbered 150-B is successfully transcribed; Figure 4 d. Positive voltage was applied to both electrodes at the same time, and reverse transcription quantitative PCR showed that neither was transcribed into RNA. The present invention successfully achieves electrical addressing transcription of RNA.

[0064] Then, yes Figure 4 b and Figure 4 The individually addressed synthetic samples in c were subjected to Sanger sequencing, and the results were as follows Figure 5 and Figure 6 , can all be sequenced individually, further demonstrating that the present invention successfully achieves electrically addressable transcription of RNA.

Claims

1. A method for synthesizing RNA by controlling a DNA microarray using voltage addressing, characterized in that: The following steps are involved: (1) Processing the electrode microarray chip: modifying the arm molecules on the electrode by chemical or electrochemical methods; the arm molecules include diazonium salt molecules, silane coupling agents or avidin; (2) Synthesize or immobilize DNA molecules on electrodes through chemical bonds; (3) Controlling the conformational changes of DNA through voltage addressing, thereby achieving selective in vitro transcription and synthesis of RNA.

2. The method according to claim 1, characterized in that The structure of the DNA molecule in step (2) includes a stem-loop structure or a linear structure.

3. According to claim 2, it is characterized in that: The stem-loop structure comprises a target sequence, a promoter sequence, a complementary sequence, and Ploy T / A.

4. According to claim 2, it is characterized in that: The linear structure comprises a target sequence, a promoter complementary sequence, and Ploy T / A.

5. According to claims 3 and 4, it is characterized in that: The method also includes modifying the Ploy T / A position with a functional group, wherein the functional group includes a thiol group, an amino group, a carboxyl group, an aldehyde group, o-aminophenol or biotin.

6. The method according to claim 1, characterized in that The material of the electrode in step (1) includes gold, platinum, silver, carbon, titanium, metal oxide or metal nitride.

7. The method according to claim 1, characterized in that The surface of the electrode in step (1) is modified with the arm molecule by chemical or electrochemical methods, wherein the chemical modification includes monolayer self-assembly and covalent bond binding; and the electrochemical method includes cyclic voltammetry or chronoamperometry.

8. The method according to claim 1, characterized in that: The voltage-addressed control includes electrical switching or electrical assisted hybridization.

9. The method according to claim 1, characterized in that: The in vitro transcription in step (3) includes T3 promoter transcription, T7 promoter transcription or Sp6 promoter transcription.

Images