SiRNA (small interfering Ribonucleic Acid) for resisting new coronavirus SARS-CoV-2s2m and application thereof

Abstract

The invention discloses a siRNA (small interfering Ribonucleic Acid) capable of resisting a new coronavirus SARS-CoV-2s2m and application of the siRNA. The siRNA is designed according to an s2m element of an SARS-CoV-2 virus, and is optimized according to a secondary structure prediction result of the s2m element, and finally three groups of candidate siRNA sequences with virus inhibition activity are obtained. Cell transfection and virus infection experiments prove that the siRNA prepared by the invention can obviously reduce the virus titer in cells, can effectively inhibit the activity of viruses, and has the application prospect of developing novel anti-coronavirus drugs.

Description

Technical Field

[0001] The present invention relates to a siRNA, and in particular to an anti-new coronavirus SARS-CoV-2 s2m siRNA and an application thereof. Background Art

[0002] The genomes of coronaviruses contain multiple structurally conserved elements in the 5' and 3' untranslated regions (UTRs), which are thought to play a role in viral gRNA and sgRNA replication. These elements include three stem loops (SL1, SL2, and SL3) in the 5'UTR, as well as the bulged stem loop (BSL), pseudoknot (PK) stem loop, and hypervariable region (HVR) in the 3'UTR. The terminal portion of the HVR region contains a highly conserved 41-nucleotide stem loop II motif (s2m). It has been previously shown that this element is conserved not only in the coronavirus family, but also in the distantly related Astroviridae, Caliciviridae, and Picornaviridae positive-stranded viruses. Although the exact function of the s2m element has not yet been elucidated, some researchers believe that it has a selective advantage in treatment, given that it exists in multiple virus families and is highly conserved. Based on the complex tertiary structure of s2m, researchers speculate that the functions of this element include inhibiting the synthesis of host proteins and promoting viral transcription. Overall, the broad conservation of S2M elements across multiple viral families highlights the potential importance of this motif in viral detection and therapeutic drug targeting.

[0003] S2M is a promising target for potential antiviral drugs, where the likelihood of evolving mutations leading to drug resistance would be reduced. Since the S2M element is present in all positive sense transcripts (genomic and subgenomic) produced by the virus, drugs targeting S2M would also have the advantage of acting against the majority of viral RNA present within the cell. To test the possibility of targeting the S2M element for potential nucleic acid-based therapeutics, we designed a panel of small interfering oligonucleotides (siRNAs). These oligonucleotides have demonstrated therapeutic potential against viruses and have been in active development for more than a decade.

[0004] RNA has become an important tool in the fight against emerging infectious diseases, and it is also used to respond to the COVID-19 pandemic. RNA interference (RNAi) is a powerful strategy for targeted gene inhibition and has been applied to gene function exploration and antiviral therapy. The mechanism of siRNA antiviral therapy involves the targeted degradation of mRNA, which is the most critical for viral survival and reproduction. Through RNAi technology, siRNAs that target and bind to viral mRNA are designed. These antiviral siRNAs guide the Argonaute proteins in the RNA-induced silencing complex (RISC) to recognize and bind to viral mRNA, thereby degrading homologous viral RNA.

[0005] siRNA technology can silence almost any gene, which means that all genes necessary for viral replication can be targeted to inhibit viral replication and infection. It is worth noting that after the virus mutates, siRNA therapy can be used to quickly resist emerging viral infections, and efficient gene design and delivery technology improves the effectiveness of siRNA therapy. Summary of the invention

[0006] The purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and provide an siRNA against the new coronavirus SARS-CoV-2s2m.

[0007] Another object of the present invention is to provide the application of the above-mentioned siRNA against the new coronavirus SARS-CoV-2 s2m.

[0008] The purpose of the present invention is achieved through the following technical solutions:

[0009] An siRNA against SARS-CoV-2 s2m, which is at least one of the following:

[0010] s2m-1, the nucleotide sequence of its antisense strand is:

[0011] ACCCUCGAUCGUACUCCGCG,

[0012] The nucleotide sequence of the sense strand is:

[0013] CGCGGAGUACGAUCGAGGGU;

[0014] s2m-2, the nucleotide sequence of its antisense strand is:

[0015] UCGUACUCCGCGUGGCCUCG,

[0016] The nucleotide sequence of the sense strand is:

[0017] CGAGGCCACGCGGAGUACGA;

[0018] s2m-3, the nucleotide sequence of its antisense strand is:

[0019] CUCCGCGUGGCCUCGGUGAA,

[0020] The nucleotide sequence of the sense strand is:

[0021] UUCACCGAGGCCACGCGGAG;

[0022] Or analogs of s2m-1, s2m-2, and s2m-3 obtained by base insertion, deletion, or substitution that still have the function of targeting the SARS-CoV-2 s2m element sequence.

[0023] The siRNA can target the s2m element of the SARS-CoV-2 virus, thereby inhibiting the replication of the SARS-CoV-2 virus.

[0024] The use of the siRNA in inhibiting the expression of SARS-CoV-2 virus.

[0025] The use of the siRNA in the preparation of SARS-CoV-2 virus inhibitors.

[0026] The target of the above-mentioned inhibitor is the s2m element.

[0027] The use of the siRNA in the preparation of a drug for treating infection caused by the SARS-CoV-2 virus.

[0028] A drug for treating infection caused by SARS-CoV-2 virus, comprising the above-mentioned siRNA.

[0029] The medicine also includes pharmaceutically acceptable excipients.

[0030] The above-mentioned SARS-CoV-2 virus is the original strain of SARS-CoV-2.

[0031] Compared with the prior art, the present invention has the following advantages and effects:

[0032] The present invention provides an anti-COVID-19 s2m siRNA, which is designed based on the s2m element of SARS-CoV-2 and optimized based on its secondary structure prediction results, and finally three groups of siRNAs with the activity of inhibiting viral expression are obtained. Cell transfection and virus infection experiments have proved that the siRNA prepared by the present invention can significantly reduce the viral titer in cells, can effectively inhibit the expression of viruses, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is the conservative structure diagram of the 3'-UTR region of the SARS-CoV-2 genome;

[0034] Figure 2 It is the secondary structure prediction map of s2m by RNA structure v6.3;

[0035] Figure 3 RNA structure v6.3 was used to design s2m-siRNAs sequences;

[0036] Figure 4 This is a graph showing the inhibitory effect of siRNA on SARS-CoV-2 viral load in Example 2. DETAILED DESCRIPTION

[0037] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0038] If no specific experimental conditions are specified in the following embodiments, conventional experimental conditions or experimental conditions recommended by the reagent company are generally followed. The materials and reagents used, unless otherwise specified, are all reagents and materials obtained from commercial sources.

[0039] Cells and reagents:

[0040] HEK293T-ACE2 cells and the original strain of SARS-CoV-2 were kindly donated by Li Chang, Institute of Military Veterinary, Academy of Military Medical Sciences, Academy of Military Sciences. The experiments related to real viruses were completed at the Institute of Military Veterinary, Academy of Military Medical Sciences, Academy of Military Sciences.

[0041] DMEM medium, fetal bovine serum, and Opiti-MEM medium were purchased from GIBCO (USA); Purchased from Mirus Bio (USA); viral RNA extraction kit purchased from TIANGEN (Germany); 2xSYBR Green qPCR Master Mix purchased from Nanjing Novozymes Biotech Co., Ltd. (China).

[0042] Example 1

[0043] 1.1 Prediction of secondary structure of s2m

[0044] Designing effective siRNA requires accurate mimicking of the secondary structure of the target sequence. The sequence of the s2m element differs by only two bases between SARS-CoV and SARS-CoV-2, but its secondary structure is significantly different ( Figure 1 ), in order to accurately simulate the structure of the corresponding sequence, this example selects the complete sequence of s2m, which is located in the 3' untranslated region of the SARS-CoV-2 genome. The sequence consists of 41 nucleotides, specifically: TTCACCGAGGCCACGCGGAGUACGAUCGAGGGUACAGTGAA. The secondary structure of the given sequence was predicted using RNA structure v6.3, and the prediction results are as follows Figure 2 shown.

[0045] 1.2 Design of s2m-siRNAs

[0046] We used RNA structure v6.3 to predict the secondary structure of the sequence and design siRNA. As shown in the figure, in the Oligowalk function interface, the Gibbs free energy of binding between the siRNA sequence and the target sequence was predicted ( Figure 3 ). According to the minimum Gibbs free energy principle, the binding of a rationally designed siRNA sequence to a target sequence will tend to make the system free energy lower under thermodynamic equilibrium conditions. Therefore, the predicted sequences were ranked from low to high by total Gibbs free energy, and the top 3 siRNA sequences were selected as candidate sequences.

[0047] The candidate sequences are as follows:

[0048] s2m-1:

[0049] Antisense strand 5'-ACCCUCGAUCGUACUCCGCG-3',

[0050] Sense strand 5'-CGCGGAGUACGAUCGAGGGU-3',

[0051] Total free energy = -33 kJ / mol.

[0052] s2m-2:

[0053] Antisense strand 5'-UCGUACUCCGCGUGGCCUCG-3',

[0054] Sense strand 5'-CGAGGCCACGCGGAGUACGA-3',

[0055] Total free energy = -32.7 kJ / mol.

[0056] s2m-3:

[0057] Antisense strand 5'-CUCCGCGUGGCCUCGGUGAA-3',

[0058] Sense strand 5'-UUCACCGAGGCCACGCGGAG-3',

[0059] Total free energy = -31.2 kJ / mol.

[0060] Example 2

[0061] 2.1 Synthesis of siRNA sequences

[0062] According to the method of Example 1, three siRNA sequences with potential targeting s2m domain were screened and a pair of random sequences NC were designed for comparison. They were commissioned to be synthesized by Sangon Biotech (Shanghai) Co., Ltd., and their sequences are shown in Table 1.

[0063] Table 1s2m-siRNAs sequences

[0064]

[0065] 2.2 Cell transfection

[0066] Prepare HEK293T-ACE2 cells in the logarithmic growth phase, use double antibody, 10% FBSDMEM medium to prepare 5×10 5 The suspension of cells was plated in a 12-well plate. The culture plate was placed at 37°C, 5% CO2, and transfection was performed when the cells grew to about 70%;

[0067] (1) HEK293T-ACE2 cells were divided into siRNA (s2m-1, s2m-2, and s2m-3) and NC groups. The NC group was cells transfected with random sequences. The final concentration of siRNA and NC groups was set to 100 nM. Transfection, the transfection steps are as follows:

[0068] Combined with 3 μL / well of transfection reagent, add 100 μL / well of Opti-MEM and let stand at room temperature for 15-20 minutes to prepare transfection complex. Set up 3 wells of cells for each nucleic acid drug.

[0069] The transfection complex was added dropwise into each well of the 12-well plate. After 6 hours, the culture medium was replaced with 2% FBSDMEM culture medium and culture was continued for 36 hours.

[0070] (2) Before transfection, remove the original culture medium in the 12-well plate and add 800 μL of DMEM culture medium without serum and double antibody for starvation treatment;

[0071] (3) Preparation Mixed liquid.

[0072] a. Dilute transfection reagent Before use, the transfection reagent was gently shaken, and then 3 μL was taken and diluted with 100 μL of serum-free optimized medium (Opti-MEM), mixed gently, and incubated at room temperature for 5 min;

[0073] b. Dilute siRNA: Take 5 μL of siRNA (20 μM), dilute with 250 μL of serum-free optimized culture medium (Opti-MEM), and mix gently to make the final concentration of siRNA 100 nM;

[0074] c. After incubation for 5 minutes, the diluted transfection reagent was gently mixed with the above (b) and incubated at room temperature for 20 minutes;

[0075] (4) Add the above mixed solution to the cell culture plate containing cells and culture medium, and shake gently to mix;

[0076] (5) After culturing at 37°C for 4-6 hours, remove the culture medium containing the transfection reagent mixture in the wells and replace with 2% FBSDMEM medium for another 36 hours.

[0077] 2.3 SARS-CoV-2 infection of cells

[0078] The original strain of SARS-CoV-2 was used to infect the cells treated with siRNA transfection in 2.2. The virus solution was mixed with 2% FBSDMEM medium at an MOI of 0.01 to replace the medium in the 12-well plate cells and incubated at 37°C for 12 h.

[0079] 2.4 qPCR detection of viral load

[0080] 100 μL of cell supernatant was collected at 48, 72 and 96 h after infection, and viral RNA was extracted using Tiangen Bio's viral RNA extraction kit.

[0081] Follow the instructions of Tiangen Bio's viral RNA extraction kit. The specific process is as follows:

[0082] (1) Prepare 560 μL of lysis buffer containing carrier RNA per sample and use it immediately;

[0083] (2) Pipette 100 μL of the supernatant of infected cells into the lysis buffer and mix thoroughly. Let stand at room temperature for 10 min. Add 560 μL of anhydrous ethanol and mix thoroughly.

[0084] (3) The lysate added with anhydrous ethanol was centrifuged twice through a filter column (8000 rpm, 1 min), and the filtrate was discarded;

[0085] (4) Add 500 μL of the prepared GD buffer to the filter column once, centrifuge at 8000 rpm for 1 min, and discard the filtrate;

[0086] (5) Add 500 μL of the prepared PW buffer to the filter column twice, centrifuge at 8000 rpm for 1 min, and discard the filtrate;

[0087] (6) After centrifuging the filter column at 12,000 rpm for 3 min, add 50 μL of RNase-free deionized water to the center of the filter column and centrifuge at 12,000 rpm for 2 min. Collect the filtrate as the viral RNA extract.

[0088] The Novagen one-step probe qRT-PCR reagent was used to perform absolute quantitative detection of the SARS-CoV-2N gene in the extracted viral RNA (Table 3).

[0089] The SARS-CoV-2 N gene fluorescence quantitative PCR primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The sequences are shown in Table 2, and the standard product was the pEASY Blunt plasmid containing the N gene.

[0090] Table 2 SARS-CoV-2N fluorescence quantitative detection sequence

[0091]

[0092] The SARS-CoV-2N gene in the extracted viral RNA was absolutely quantitatively analyzed using the Novagen qRT-PCR kit, and the reaction system used is shown in Table 3.

[0093] Table 3 One-step probe qRT-PCR reaction system

[0094]

[0095] After the prepared reaction system was quickly centrifuged, the detection was performed using a BioRad CFX96 real-time fluorescence quantitative PCR instrument (Table 4).

[0096] Table 4 One-step probe qPCR procedure

[0097]

[0098] 2.5 Data processing and analysis

[0099] Data are presented as mean ± SD of at least three biological replicates, and data analysis was performed using GraphPad Prism 8.0 software (Systat Software, Inc., San Jose, CA, USA). The Student's unpaired two-sample t test was used to analyze the significant differences between the data of different groups, and p values ​​< 0.05 were considered statistically significant.

[0100] 2.6 Results and Discussion

[0101] In order to evaluate whether the siRNAs we designed have anti-SARS-CoV-2 virus effects. NC, s2m-1, s2m-2 and s2m-3 were transfected into HEK293T-ACE2 cells at a final concentration of 100nM, respectively. After 36 hours, they were infected with 0.01MOI SARS-CoV-2, and the viral load of the cell supernatant was detected after 48 to 96 hours. Remdesivir was used as a positive control. The results showed that s2m-2 had a significant inhibition of viral load at 48h, 72h and 96h after infection. s2m-3 had a significant inhibition of viral load after 72h and 96h of infection ( Figure 4 ).

[0102] The present invention designs siRNAs sequences (s2m-1, s2m-2 and s2m-3) targeting the s2m element of the new coronavirus SARS-CoV-2. The real virus experiment verifies that the designed sequences have a significant inhibitory effect on the viral load, among which s2m-2 has the best effect, which can provide an experimental basis for the research and development of new anti-coronavirus drugs.

[0103] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A siRNA against the new coronavirus SARS-CoV-2s2m, characterized in that At least one of the following: s2m-1, the nucleotide sequence of its antisense strand is: ACCCUCGAUCGUACUCCGCG, The nucleotide sequence of the sense strand is: CGCGGAGUACGAUCGAGGGU; s2m-2, the nucleotide sequence of its antisense strand is: UCGUACUCCGCGUGGCCUCG, The nucleotide sequence of the sense strand is: CGAGGCCACGCGGAGUACGA; s2m-3, the nucleotide sequence of its antisense strand is: CUCCGCGUGGCCUCGGUGAA, The nucleotide sequence of the sense strand is: UUCACCGAGGCCACGCGGAG; Or analogs of s2m-1, s2m-2, and s2m-3 obtained by base insertion, deletion, or substitution that still have the function of targeting the SARS-CoV-2 s2m element sequence.

2. Use of the siRNA described in claim 1 in inhibiting the expression of SARS-CoV-2 virus.

3. Use of the siRNA described in claim 1 in the preparation of SARS-CoV-2 virus inhibitors.

4. The use of siRNA according to claim 3 in the preparation of SARS-CoV-2 virus inhibitors, characterized in that: The inhibitor targets the s2m element.

5. Use of the siRNA according to claim 1 in the preparation of a drug for treating infections caused by the SARS-CoV-2 virus.

6. A drug for treating infection caused by SARS-CoV-2 virus, characterized in that: Comprising the siRNA according to claim 1.

7. The drug according to claim 6, characterized in that: Pharmaceutically acceptable excipients are also included.

Images