Dsrna of an insect neuropeptide ecdysis triggering hormone (eth) gene and preparation method and application thereof

By synthesizing the dsRNA of the insect neuropeptide molting-triggering hormone ETH gene and interfering with the gene expression of the nightshade ladybird, the environmental pollution and pesticide resistance problems of chemical pesticide control of the nightshade ladybird were solved, and efficient pest control effects were achieved at low concentrations.

CN119876145BActive Publication Date: 2025-10-10HENAN AGRICULTURAL UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510086481.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-20
Publication Date
2025-10-10
Estimated Expiration
2045-01-20

AI Technical Summary

Technical Problem

Existing chemical pesticides have problems such as increased pest resistance, environmental pollution and damage to non-target organisms when used to control the nightshade ladybird, and there is a lack of effective environmentally friendly control measures.

Method used

The dsRNA of the insect neuropeptide molting trigger hormone ETH gene was synthesized by PCR amplification and in vitro transcription, and then fed to the nightshade Coccinella twentiespotted to interfere with its gene expression, resulting in deformity and death of the pest.

Benefits of technology

It significantly reduces the survival rate and feeding ability of the nightshade beetle at low concentrations, providing a safe and efficient pest control method and reducing environmental pollution.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119876145B_ABST
    Figure CN119876145B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biology and relates to the prevention and treatment of Epilachna vigintioctopunctata, in particular to a dsRNA of an insect neuropeptide ecdysis-triggering hormone ETH gene and a preparation method and application thereof. The neuropeptide ETH gene of Epilachna vigintioctopunctata is screened through transcriptome sequencing; a fragment of the gene sequence with SEQ ID No. 2 is selected to synthesize dsRNA (dsETH). After 3-day-old larvae of Epilachna vigintioctopunctata are fed with dsETH (concentration >= 1 ng / μL), more than 70% of the Epilachna vigintioctopunctata are deformed and cannot feed on the 7th day, more than 70% of the Epilachna vigintioctopunctata die on the 10th day, and the deformation rates of 5, 10, 25 and 100 ng / μL are 85%, 90%, 95% and 100% respectively. The application provides a new prevention and treatment target for the prevention and treatment of Epilachna vigintioctopunctata based on RNA interference.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to the prevention and treatment of Coccinella twentiespotted. Background Art

[0002] As agricultural production continues to expand, annual losses from pest damage are increasing. While chemical pesticides have become the preferred method for pest control due to their high efficiency, low cost, and ease of use, their long-term reliance on chemical pesticides has led to a series of serious problems, including but not limited to pesticide residues, increased pest resistance, increased environmental pollution, threats to food safety, and damage to natural enemies. To address these challenges, dsRNA pesticides based on RNA interference (RNAi) technology are gaining widespread attention. When dsRNA is ingested by insects, it is broken down into short RNA strands of approximately 21 nucleotides. These short RNA strands precisely bind to and degrade the mRNA transcribed from target genes, thereby silencing the target genes. dsRNA is not only easily degraded in the environment and leaves no residue, making it highly environmentally friendly, but also exhibits high insecticide specificity. To date, dsRNA targeting a variety of genes critical to insect physiology has been used for pest control. Silencing these genes is lethal to pests while remaining extremely safe to non-target organisms. Therefore, the development and application of dsRNA pesticides has the potential to significantly reduce the use of chemical pesticides and mitigate their negative environmental impacts.

[0003] Coccinella twentiespotata ( Henosepilachna vigintioctopunctata ) is a key pest on Solanaceae and Cucurbitaceae vegetables and Solanum nigrum. It is widely distributed throughout the country and causes serious damage. In northern regions, the pest has two generations a year, while in the Yangtze River Basin and its south, it can have three to five generations a year. At present, chemical control is still the main means of controlling this pest. Although there have been research attempts on biological control, its actual application is still relatively limited. Chemical control not only easily leads to pesticide resistance in pests, but may also affect the growth and development of beneficial organisms such as natural enemies and pollinating insects, and damage the ecological environment. In view of this, the research and development of environmentally friendly control methods for the nightshade ladybird is particularly urgent and important. dsRNA is prone to degradation during use. Application Publication No. CN112410345A discloses the control of Coccinella twentiescens (E. twentiescens) by dsRNA targeting the FTZ-F1 gene. This control was achieved by feeding 100 ng / μL of dsRNA to the insects. Given the varying mechanisms of action of different dsRNAs and their varying lethality to pests, it is necessary to screen for more target genes to optimize control effectiveness. To further explore dsRNA targeting genes that can achieve control effects at low concentrations, our research team conducted in-depth research. Summary of the Invention

[0004] The application provides dsRNA of an insect neuropeptide ecdysis triggering hormone ETH gene and a preparation method and application thereof, and provides a new control target and application method for green control of pests.

[0005] The technical scheme of the application is implemented as follows:

[0006] The dsRNA of the insect neuropeptide ecdysis triggering hormone ETH gene comprises a nucleotide sequence as shown in SEQ ID No. 2 and a nucleotide sequence reverse complementary to the nucleotide sequence.

[0007] The nucleotide sequence as shown in SEQ ID No. 2 is obtained by PCR amplification of SEQ ID No. 2 according to an upstream primer SEQ ID No. 5 and a downstream primer SEQ ID No. 6 designed according to SEQ ID No. 1, and contains a T7 promoter and has a fragment length of 324 bp, and is used for synthesizing dsRNA.

[0008] The preparation method of the dsRNA of the insect neuropeptide ecdysis triggering hormone ETH gene comprises the following steps: designing an upstream primer and a downstream primer according to the insect neuropeptide ecdysis triggering hormone ETH gene, taking cDNA of Epilachna viguetti as a template, obtaining a DNA fragment through PCR, and synthesizing dsRNA through in vitro transcription of the DNA.

[0009] The nucleotide sequence of the insect neuropeptide ecdysis triggering hormone ETH gene is shown in SEQ ID No. 1, the sequence is obtained through transcription sequencing, and is searched and compared with published genomic data of the Epilachna viguetti, and further an open reading frame sequence with a length of 468 bp is obtained through PCR cloning.

[0010] The upstream primer sequence is shown in SEQ ID No. 3, and the downstream primer sequence is shown in SEQ ID No. 4.

[0011] A recombinant vector containing the gene.

[0012] An engineering bacterium containing the gene.

[0013] The dsRNA of the insect neuropeptide ecdysis triggering hormone ETH gene or the gene or the recombinant vector or the engineering bacterium is applied to preparation of a reagent for controlling the Epilachna viguetti, a reagent for reducing survival rate of the Epilachna viguetti or a reagent for inhibiting expression of the insect neuropeptide ecdysis triggering hormone ETH gene of the Epilachna viguetti.

[0014] The application step is that the Epilachna viguetti is fed with a leaf sprayed with a liquid containing the dsRNA.

[0015] An insecticide for controlling Coccinella twentiespotted, comprising the above-mentioned dsRNA.

[0016] The minimum effective concentration of dsRNA in the above-mentioned insecticide is 1 ng / μL; the preferred concentration is 1-100 ng / μL.

[0017] A method for preventing and controlling Coccinella twentiespinata comprises the following steps: feeding Coccinella twentiespinata larvae with feed containing the above-mentioned dsRNA.

[0018] The concentration of the dsRNA in the feed is 1-100 ng / μL.

[0019] Since the ETH gene of the eggplant Coccinella tsugaepunctata of the present application has a high homology with that of the potato Coccinella tsugaepunctata, the interference sequence can be used to interfere with and control the gene in these two Coccinella tsugaepunctata.

[0020] Furthermore, the Coccinella twentiespotted is a larva of Coccinella twentiespotted that is less than 3 days old; the concentration of dsRNA is 1-100 ng / μL; and the dsRNA includes dsRNA synthesized by the above-mentioned gene, the above-mentioned recombinant vector, or the above-mentioned engineered bacteria.

[0021] The present invention has the following beneficial effects:

[0022] 1. The present invention sequenced the transcriptome of the nervous system of the Coccinella truncatula (E. truncatula) and compared it with the genome to obtain the ETH gene. Cloning and sequencing confirmed its gene sequence as SEQ ID No. 1. A fragment of the gene sequence, SEQ ID No. 2, was selected for synthesizing dsRNA. After feeding 3-day-old larvae of Coccinella truncatula with dsETH for 7 days, the vast majority of the larvae developed deformities and were unable to feed. After 10 days, the vast majority died. On the 7th day after feeding Coccinella truncatula with final concentrations of dsETH at 1 ng / μL, 5 ng / μL, and 100 ng / μL, the deformity rates were 70.00%, 85.00%, and 100.00%, respectively (once deformed, the larvae stopped feeding). The mortality rates on the 10th day were 70%, 85.0%, and 100.0%, respectively. This provides a new target for pest control based on RNA interference. Moreover, this application has a good effect when using dsETH at a concentration of 1 ng / μL (the deformity rate and mortality rate reach 70%), and the insecticidal effect is better at concentrations above 5 ng / μL, which is more conducive to application in the field.

[0023] 2. Neuropeptide signaling systems, due to their important physiological functions, hold great potential as targets for pest control. The insect neuropeptide molting-triggering hormone ETH was first identified in the tobacco moth (Manduca sexta) in 1966. Subsequent studies have revealed that ETH is essential for regulating the insect molting process. Reduced or absent ETH expression prevents the insect's new and old cuticles from separating, leading to death. Using dsETH to interfere with the expression of the ETH gene in the nightshade Coccinella truncatula (E. coccinella), molting is hindered, inhibiting feeding and growth, ultimately leading to the insect's death. Compared to traditional insecticides for controlling E. coccinella, dsETH offers advantages such as a low dosage and minimal pollution to the environment and non-target organisms, making it a safe and effective new insecticide. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0025] Figure 1 This is a sequence comparison of the ETH gene of the eggplant coccinella and the potato coccinella; HVP is the eggplant coccinella; HVT is the potato coccinella.

[0026] Figure 2 This is the electrophoresis diagram of dsETH in Example 1 of the present invention.

[0027] Figure 3 This is a graph showing the deformity rates of 3-day-old larvae of Coccinella twentiespottedii in Example 2 of the present invention after being fed dsETH at concentrations of 0.1, 1, 5, 10, 25, and 100 ng / µL.

[0028] Figure 4 This is a graph showing the mortality of 3-day-old larvae of Coccinella twentiespinata in Example 2 of the present invention after being fed with dsETH at concentrations of 0.1, 1, 5, 10, 25, and 100 ng / µL.

[0029] Figure 5 This is a diagram of the deformed phenotype of Coccinella twentiespotted after being treated with dsETH in Example 2 of the present invention.

[0030] Figure 6 This is a diagram showing the death phenotype of Coccinella twentiespotted after being treated with dsETH in Example 2 of the present invention.

[0031] Figure 7The relative expression levels of the ETH gene in 3-day-old Coccinella twentiespinata larvae treated with dsETH in Example 3 of the present invention after 2 and 4 days (*** indicates P <0.001, Independent t-tests, SPSS version 20.0 software). DETAILED DESCRIPTION

[0032] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0033] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available reagents and materials unless otherwise specified.

[0034] Example 1: Obtaining the ETH gene fragment of Coccinella twentiespotted and its dsRNA

[0035] 1. Obtaining the ETH gene fragment from Coccinella twentiespottedii

[0036] 1) Searching for the ETH gene in the genome of Coccinella twentiespinata

[0037] 2) The transcriptome of the nervous system of Coccinella twenties was sequenced and compared with the genome of Coccinella twenties using bioinformatics methods. After homologous sequence analysis and comparison, Figure 1 As shown, the open reading frame of the ETH gene of Coccinella twentiespotted was obtained, the sequence length was 468 bp, and the sequence was shown as SEQ ID No.1.

[0038] 3) Design of primers for the ETH gene in Coccinella twentiespinata

[0039] Based on the obtained ETH gene of Coccinella twentiespinata, primers were designed:

[0040] The upstream primer is SEQ ID No. 3: ATGTGGTTCTCGAATTCTCT;

[0041] The downstream primer is SEQ ID No. 4: TCAAACATAATTTGTGGTTC.

[0042] The primers used in the present invention were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0043] 4) Extract total RNA from Coccinella twentiesema.

[0044] 5) Nervous system tissues from 50 Coccinella truncatula larvae were collected and placed in 200 μL of Trizol (TaKaRa) solution. Total RNA was extracted from the nervous system tissues of Coccinella truncatula according to the instructions of the Trizol kit.

[0045] 6) Reverse transcription and cDNA synthesis

[0046] TaKaRa reverse transcription kit was used to synthesize cDNA of Coccinella twentiespottedii according to the instruction manual.

[0047] 7) Obtaining and sequencing the open reading frame fragment of the ETH gene in Coccinella twentiespottedii

[0048] Using Novozyme MasterMix and designed primers, the obtained cDNA was used as a template to obtain the open reading frame fragment of the ETH gene of Coccinella twentiespotted by PCR reaction, and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The gene open reading frame sequence was obtained by first-generation sequencing.

[0049] 8) Analysis of the open reading frame sequence of the ETH gene in Coccinella twentiespinata

[0050] The obtained open reading frame sequence of the ETH gene of Coccinella twentiespotted was compared with the sequence in the database to confirm the correctness of the sequence. The sequence is shown as SEQ ID No.1.

[0051] 2. In vitro synthesis of dsETH from Coccinella truncatula

[0052] 1) Based on the obtained sequence of the ETH gene of Coccinella twentiespottedii, SEQ ID No. 1, primers for synthesizing the dsETH template were designed from the NCBI website.

[0053] The primer sequences are:

[0054] SEQ ID No.5:

[0055] GATCACTAATACGACTCACTATAGGGAGAAGAAGTGGCGGTAGTAAAGGC;

[0056] SEQ ID No.6:

[0057] GATCACTAATACGACTCACTATAGGGAGAGGTTCGCTTGGAACGACCATA.

[0058] 2) In vitro synthesis of dsRNA from the ETH gene of Coccinella twentiespottedii

[0059] The dsRNA primer was designed, and the cDNA of Epilachna vigintioctopunctata was used as a template to obtain the template for dsRNA synthesis by PCR using the Novozyme MasterMix kit. The template sequence is shown in SEQ ID No. 2. After purification by the PCR product purification kit, the dsRNA synthesis kit was used to synthesize the dsETH of Epilachna vigintioctopunctata in vitro according to the instructions. The electrophoretogram is shown in FIG. 2. Figure 2

[0060] Example 2: Silencing of the ETH gene of Epilachna vigintioctopunctata by dsRNA leads to the death of Epilachna vigintioctopunctata

[0061] 1) Different concentrations of dsETH (0.1, 1, 5, 10, 25, and 100 ng / μL) were prepared, and the dsEGFP control group (Control) at a concentration of 100 ng / μL was used to feed Epilachna vigintioctopunctata to determine the insecticidal efficiency of dsETH on Epilachna vigintioctopunctata.

[0062] 2) A total of 6 groups (Control, 0.1, 1, 5, 10, 25, and 100 ng / μL) were treated, and 40 Epilachna vigintioctopunctata were used for each group. Fresh Solanum nigrum leaves with a diameter of 13 mm were punched using a puncher, and 5 μL of dsETH or dsEGFP solution was applied to the front and back of each leaf and then dried. Three-day-old larvae were selected and placed in a 90-mm-diameter culture dish (10 larvae in each culture dish), and a layer of filter paper was placed at the bottom of the culture dish to keep it moist. After 4 h of starvation, the dsRNA-coated leaves were placed in the culture dish to feed the larvae, and fresh Solanum nigrum leaves were added after the larvae finished eating. The culture dishes were placed in an artificial climate chamber at 26°C, 80% relative humidity, and a light cycle of L:D=14:10 for feeding.

[0063] 3) After feeding Epilachna vigintioctopunctata with dsETH, the number of dead Epilachna vigintioctopunctata was counted every day, and the mortality rate was calculated. The results showed that after Epilachna vigintioctopunctata fed on the leaves treated with dsETH at a concentration of Control, 0.1, 1, 5, 10, 25, and 100 ng / μL, the larvae began to show abnormal phenotypes that could not molt on the 3rd day, and the larvae could not eat after showing abnormal phenotypes. The abnormal rates on the 7th day were 25.00%, 70.00%, 85.00%, 90.00%, 95.00%, and 100.00% (P<0.05), respectively, and the mortality rates on the 10th day were 25.00%, 70.00%, 85.00%, 90.00%, 95.00%, and 100.00% (P<0.05), respectively. Figure 3 Figure 4 The molting of Epilachna vigintioctopunctata showing abnormal phenotypes was inhibited (P<0.05), and the larvae could not eat and died (P<0.05). Figure 5 Figure 6 ​​​), which has the effect of controlling pests. The results showed that leaves treated with dsETH at a concentration of more than 1 ng / μL had a good insecticidal effect on Coccinella truncatula.

[0064] Example 3: Detection of ETH gene silencing efficiency in Coccinella truncatula

[0065] Ten 3-day-old Coccinella truncatula larvae of uniform size were placed in a 90 mm diameter Petri dish. Using the leaf smear method, dsETH at a concentration of 10 ng / μL was smeared onto the leaves, with 5 μL applied to both the front and back. After smearing, the larvae were placed in the Petri dish and fed with dsEGFP at the same concentration as the control group, which was fed in the same manner. The larvae were then reared in an artificial climate chamber at 26°C with a photoperiod of 14 L:10 D.

[0066] 2) Total RNA was extracted from C. erinaceus fed dsETH for 2 and 4 days. C. erinaceus fed dsEGFP served as a control. Three biological replicates were performed per group, with each replicate containing at least three C. erinaceus. The extracted total RNA was reverse transcribed into cDNA, and the relative expression of the ETH gene in C. erinaceus was determined by quantitative PCR. RPL13 and RPS18 were used as reference genes to calculate the silencing efficiency of the target gene.

[0067] 3) The results showed that dsETH took effect after 2 days of feeding, significantly reducing the expression of the ETH gene in E. coccinellae compared with the control group. The expression level decreased by 91.56% and 91.71% on 2 days and 4 days, respectively. Figure 7 ).

[0068] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. The use of dsRNA in the preparation of an agent for controlling Coccinella twentiespottedii, characterized in that: The dsRNA includes the nucleotide sequence shown in SEQ ID No. 2 and a reverse complementary nucleotide sequence thereof.

2. Use of dsRNA in the preparation of a reagent for increasing the deformity rate of Coccinella twentiespotted, characterized in that: The dsRNA comprises the nucleotide sequence shown in SEQ ID No. 2 and a reverse complementary nucleotide sequence thereof.

3. An insecticide for controlling Coccinella twentiespinnata, characterized in that: The invention relates to a dsRNA comprising the ETH gene of the neuropeptide molting triggering hormone of Coccinella twentiespinata, wherein the dsRNA comprises the nucleotide sequence shown in SEQ ID No. 2 and a reverse complementary nucleotide sequence thereof.

4. The insecticide for controlling Coccinella twentiespotted according to claim 3, characterized in that: The minimum effective concentration of dsRNA in the insecticide is 1 ng / μL.

5. A method for preventing and controlling Coccinella twentiespotted, characterized in that: The method comprises the following steps: feeding larvae of Coccinella twentiespinnata with feed containing dsRNA, wherein the dsRNA comprises a nucleotide sequence as shown in SEQ ID No. 2 and a reverse complementary nucleotide sequence thereof.

6. The method for controlling Coccinella twentiespottedii according to claim 5, wherein: The concentration of dsRNA in the feed is 1-100 ng / μL, and the feeding time is ≤7 days.

Citation Information

Patent Citations

  • FTZ-F1 gene of henosepilachna vigintioctopunctata and application of FTZ-F1 gene in control for henosepilachna vigintioctopunctata

    CN112410345A