Specific targeting pig HSP90AA1 gene knockout sgRNA and application thereof

Abstract

The invention belongs to the technical field of gene knockout, and particularly relates to sgRNA for specifically targeting pig H SP90AA1 gene knockout and application of the sgRNA. According to the present invention, the nucleotide sequence of the sgRNA is specifically designed, such that the sgRNA can be efficiently combined with the Cas9 protein so as to achieve the precise knockout of the HSP90AA1 gene in the swine ST cell, and the expression of the HSP90AA1 gene is inhibited;

Description

Technical Field

[0001] The present invention belongs to the technical field of gene knockout, and in particular relates to an sgRNA specifically targeting porcine HSP90AA1 gene knockout and an application thereof. Background Art

[0002] The expression of heat shock protein 90 (HSP90AA1) in cells is closely related to viral infection and host immune response. Many viruses use host cell HSP90AA1 in their life cycle to promote their own replication, spread and evade host immune response. Transmissible gastroenteritis virus (TGEV) is an important porcine coronavirus, and its infection mechanism and interaction with host cytokines have not been fully elucidated. As a molecular chaperone, HSP90AA1 may promote correct protein folding during viral replication by interacting with TGEV proteins. This process may be crucial for the replication, assembly and release of the TGEV genome. In addition, HSP90AA1 also plays an important role in immune regulation, and may affect the response of the host immune system by interacting with antigens related to TGEV infection. This mechanism not only involves the activation of immune cells, but also may affect the ability of TGEV to evade immune surveillance. Existing studies have shown that some viruses can evade host cell immune recognition by regulating HSP90AA1. TGEV may also use a similar mechanism to prevent the display of its antigens on the cell surface through HSP90AA1, thereby alleviating the monitoring of the immune system. This escape mechanism may make TGEV more likely to replicate and spread in host cells. However, the specific role of HSP90AA1 in TGEV infection and its impact on host cell inflammatory response are still unclear, which provides an important research direction for in-depth study of the TGEV infection mechanism and the development of new prevention and control strategies.

[0003] Given the potentially important role of HSP90AA1 in the viral infection process, it has become a key target for studying the TGEV infection mechanism and host inflammatory response and has attracted much attention. By intervening in the function of HSP90AA1, especially through gene knockout technology, it may be possible to reveal the key regulatory mechanisms in the TGEV infection process and provide new research tools and ideas for a deeper understanding of virus-host interactions. This provides an innovative research approach for using the porcine ST cell model to explore the relationship between TGEV infection and HSP90AA1. Summary of the invention

[0004] The present invention provides a porcine ST cell line with HSP90AA1 gene knockout, which specifically knocks out the HSP90AA1 gene through CRISPR / Cas9 technology. The present invention adopts an optimized sgRNA sequence to ensure that it can efficiently bind to the Cas9 protein to form an effective gene editing tool. Through molecular biology and cell engineering technology, a porcine ST cell line with HSP90AA1 gene knockout was successfully constructed. The cell line was verified to confirm that the HSP90AA1 gene was effectively knocked out and the protein expression level was significantly reduced. In addition, the present invention also provides an application method of the cell line in TGEV infection research, which can not only provide an important tool for the study of the pathological mechanism of porcine transmissible gastroenteritis by comparing the expression difference of inflammatory factors between the HSP90AA1 gene knockout cell line and the wild-type cell line after TGEV infection, but also lays the foundation for the development of potential antiviral and anti-inflammatory treatment strategies. The establishment of this cell model provides a new perspective for in-depth study of the regulatory role of HSP90AA1 in the inflammatory response induced by TGEV infection, and is expected to promote the innovative development of TGEV infection mechanism research and related prevention and control strategies.

[0005] The present invention provides a specifically designed sgRNA, whose nucleotide sequence matches a specific region of the porcine HSP90AA1 gene. The design of the sgRNA is optimized to ensure efficient binding with the Cas9 protein to form an effective gene editing tool. Through molecular biological techniques, the sgRNA can be synthesized and purified for subsequent gene knockout experiments.

[0006] The sgRNA comprises sgRNA1 and / or sgRNA2;

[0007] The sense strand of the DNA sequence of the sgRNA1 is SEQ ID NO: 1, and the DNA sequence of its corresponding complementary strand is SEQ ID NO: 2; the sense strand of the DNA sequence of the sgRNA2 is SEQ ID NO: 3, and the DNA sequence of its corresponding complementary strand is SEQ ID NO: 4.

[0008] The present invention achieves efficient and accurate knockout of the HSP90AA1 gene by introducing synthetic sgRNA into porcine ST cells and combining it with Cas9 protein. The process is strictly experimentally designed and optimized to ensure that the knockout effect is stable and reliable. The knockout effect of the HSP90AA1 gene in porcine ST cells was verified by qPCR and Western blot methods, and the significant reduction in mRNA and protein levels was confirmed. In addition, the present invention also establishes a complete set of experimental procedures for evaluating the effect of HSP90AA1 gene knockout on the TGEV infection process. By comparing the viral replication levels and inflammatory factor expression of wild-type and gene knockout cell lines after TGEV infection, the role of HSP90AA1 in the host response induced by TGEV infection was deeply studied, providing new research tools and methods for revealing the mechanism of TGEV infection.

[0009] The present invention provides a pair of sgRNA sequences for knocking out the pig HSP90AA1 gene, targeting the second exon region of the HSP90AA1 gene, with target sequences of AGACCGGACCCTCACGATAG and CTTGGTACGATCGCCAAGTC, and having high targeting efficiency and knockout efficiency. The knockout is performed based on the CRISPR / Cas9 system, the sgRNA sequence includes sg RNA1 and sgRNA2, and the expression of the HSP90AA1 gene is inhibited after the knockout; the sense strand of the DNA sequence of the sgRNA1 is such as SEQ ID NO: 1, and the DNA sequence of its corresponding complementary strand is such as SEQ ID NO: 2; the sense strand of the DNA sequence of the sgRNA2 is such as SEQ ID NO: 3, and the DNA sequence of its corresponding complementary strand is such as SEQ ID NO: 4.

[0010] The present invention also provides a biomaterial, which comprises the above-mentioned two sgRNAs for specifically targeting and knocking out the pig HSP90AA1 gene, and the biomaterial is a vector or a transgenic cell.

[0011] The present invention also provides a knockout vector, which can inhibit the expression of the pig HSP90AA1 gene, and is obtained by connecting the double-stranded DNA of the above-mentioned sgRNA1 and sgRNA2 to a vector. The vector is a PX459 vector. The preparation method of the knockout vector of the CRISPR / Cas9 system comprises: synthesizing the positive strand of the DNA sequence of the sgRNA1 such as SEQ ID NO: 1, and the DNA sequence of its corresponding complementary strand such as SEQ ID NO: 2; the positive strand of the DNA sequence of the sgRNA2 such as SEQ ID NO: 3, and the DNA sequence of its corresponding complementary strand such as SEQ ID NO: 4, and then annealing the single-stranded DNA sequence to synthesize double-stranded DNA, and connecting it to the BbsI restriction site of the PX459 vector backbone to form a complete targeting plasmid.

[0012] The present invention also provides the use of the above sgRNA sequence in preparing a cell line in which the expression of the HSP90AA1 gene is inhibited; the cell line is a porcine ST cell line. The porcine ST cell line is constructed by introducing a CRISPR / Cas9 gene knockout vector containing the sgRNA specifically targeting the porcine HSP90AA1 gene into the cell to knock out the HSP90AA1 gene. The introduction of the CRISPR / Cas9 gene knockout vector into the cell can be achieved by conventional biological methods such as electrotransfection.

[0013] The present invention uses a pair of sgRNAs that can specifically recognize the porcine HSP90AA1 gene as a prerequisite, and uses CRISPR / Cas9 technology to successfully knock out the HSP90AA1 gene in the porcine ST cell line. It has also been verified through experiments that the HSP90AA1 gene knockout cell line of the present invention can inhibit the proliferation of porcine diarrhea virus in cells to a certain extent, which is of great significance for the research of anti-porcine virus drugs and the screening of antiviral targets. The knockout method of the HSP90AA1 gene provided by the present invention is highly practical and provides an effective method and basis for the functional research and application of the HSP90AA1 gene.

[0014] The beneficial effects of the present invention are:

[0015] The nucleotide sequence-specific design of the sgRNA of the present invention can efficiently bind to the Cas9 protein, achieve precise knockout of the HSP90AA1 gene in pig ST cells, and inhibit the expression of the HSP90AA1 gene.

[0016] Through the technology of the present invention, researchers can gain in-depth understanding of the function of HSP90AA1 in porcine ST cells, its role in cell stress and viral replication, and potential antiviral therapeutic targets.

[0017] The present invention not only provides an efficient and feasible gene editing tool, but also provides a new direction for the progress of pig gene editing, biomedical research and other fields. By knocking out the HSP90AA1 gene in pig ST cells, it is expected to provide important support for the research on pig growth, immune response and disease resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 A schematic diagram of HSP90AA1 sgRNA is shown.

[0019] Figure 2 A schematic diagram of the HSP90AA1 targeting vector is shown.

[0020] Figure 3 The knockout efficiency of sgRNA1 is shown.

[0021] Figure 4 The knockout efficiency of sgRNA2 is shown.

[0022] Figure 5 The knockout efficiency of sgRNA3 is shown.

[0023] Figure 6 The knockout efficiency of sgRNA4 is shown.

[0024] Figure 7 The knockout efficiency of sgRNA5 is shown.

[0025] Figure 8 The knockout efficiency of sgRNA6 is shown.

[0026] Fig. 9 The knockout efficiency of sgRNA7 is shown.

[0027] Fig.10 The knockout efficiency of sgRNA8 is shown.

[0028] Fig.11 The knockout efficiency of sgRNA9 is shown.

[0029] Fig.12 The knockout efficiency of sgRNA10 is shown.

[0030] Fig.13 Shown is the HSP90AA1 targeting vector 1 sequencing comparison.

[0031] Fig.14 The HSP90AA1 targeting vector 2 sequencing comparison is shown.

[0032] Fig.15 Sequencing of HSP90AA1 monoclonal positive cells is shown.

[0033] Fig.16 The relative expression level of HSP90AA1 mRNA is shown.

[0034] Fig.17 The expression level of HSP90AA1 protein is shown.

[0035] Fig.18 The relative expression levels of IL-1β, IL-6 and TNF-α mRNA are shown. DETAILED DESCRIPTION

[0036] definition

[0037] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly used in the field to which the present invention belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0038] As used herein, the term "about" refers to a range of ±20% of the value that follows. In some embodiments, the term "about" refers to a range of ±10% of the value that follows. In some embodiments, the term "about" refers to a range of ±5% of the value that follows.

[0039] The present invention is further described in detail below through specific examples.

[0040] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0041] The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturer. The materials and reagents used in the examples are commercially available unless otherwise specified. The manufacturers of the reagents used are indicated, and similar products from other manufacturers are substitutes.

[0042] Example 1

[0043] In this embodiment, an sgRNA that specifically targets and edits the pig HSP90AA1 gene or a CRISPR / Cas9 gene knockout vector comprising the sgRNA is provided for knocking out the HSP90AA1 gene.

[0044] The CRISPR / Cas9 gene knockout vector is a vector connected with the sgRNA specifically targeting the HSP90AA1 gene, and the sgRNA positive chain is shown in SEQ ID NO.1 and SEQ ID NO.3.

[0045] The biological material of the present invention includes the above-mentioned sgRNA for specifically targeting and knocking out the HSP90AA1 gene, and the biological material is a vector or a transgenic cell.

[0046] The method for constructing a cell line for knocking out the HSP90AA1 gene of the present invention comprises knocking out the HSP90AA1 gene of the cell line using a CRISPR / Cas9 system, wherein the CRISPR / Cas9 system uses an sgRNA with a nucleotide sequence as shown in SEQ ID NO.1. The CRISPR / Cas9 gene knockout vector can be introduced into cells by conventional biological methods such as electrotransfection. For specific technical principles, see Figure 1 and Figure 2 .

[0047] Example 2

[0048] 1. The present invention downloads the nucleotide sequence of the porcine HSP90AA1 gene (NW_018084979.1) from the NCBI database, and uses the analysis of the HSP90AA1 gene sequence to select its exons as targets to design sgRNAs. According to the CRISPR / Cas9 target design principle, the 20bp sequence upstream of the protospacer adjacent motif (PAM) is selected as the sgRNA binding site. Ten sgRNAs as shown in Table 1 below were designed, and sgRNAs were used for gene editing. DNA was extracted from the edited cells and PCR amplified and sequenced (the method is the same as the method in points 2 to 4 of this embodiment). The overall editing efficiency of these sgRNAs was compared (https: / / tide.nki.nl / ).

[0049] The results are as follows Figure 3-12 As shown in Table 1: The top two sgRNAs with the highest targeting efficiency were screened for subsequent use.

[0050] Table 1 sgRNA positive strand and its knockout efficiency

[0051] name sequence Knockout efficiency sgRNA1 AGACCGGACCCTCACGATAG, SEQ ID NO: 5 92.6％ sgRNA2 CTTGGTACGATCGCCAAGTC, SEQ ID NO: 6 72％ sgRNA3 CAGACTTGGCGATCGTACCA, SEQ ID NO: 7 21.8％ sgRNA4 CGGCTTCTACTCTGCGTACC, SEQ ID NO: 8 30％ sgRNA5 ACGATAGTGGACACCGGCAT, SEQ ID NO: 9 50.2％ sgRNA6 GCCGGTGTCCACTATCGTGA, SEQ ID NO: 10 54.5％ sgRNA7 TTGGTACGATCGCCAAGTCT, SEQ ID NO: 11 55.3％ sgRNA8 CTGCTCGTCATCGTTGTGTT, SEQ ID NO: 12 3.5％ sgRNA9 TGTCCACTATCGTGAGGGTC, SEQ ID NO: 13 65.4％ sgRNA10 GGTGCCGATATCTCCATGAT, SEQ ID NO: 14 47.4％

[0052] 2. The targeting vector PX459 (addgene Plasmid #118632) was digested with restriction endonuclease Bbs1 (New England Biolabs #R0539L) to obtain a linearized vector and run on a gel for recovery. After sgRNA was reacted at 95°C for 5 minutes, it was annealed at room temperature to form a hybrid product (wherein, the synthetic primers of the sgRNAs (named sgRNA1 and sgRNA2, respectively) shown in SEQ ID NO: 5 and SEQ ID NO: 6 are shown in Table 2), which was connected with the linearized vector of PX459 (Addgene Plasmid #108294) at 16°C overnight under the action of T4 ligase (Takara Code No. 2011A). The ligation product was transformed into E. coli DH5a competent cells (Takara Code No. 9057), and the monoclonal colony was picked up on an ampicillin resistance plate and cultured in a culture flask containing 4 mL LB medium containing ampicillin resistance. The bacterial solution was sequenced using the U6 promoter as a primer, and the sequence was compared to verify the correctness and the plasmid was extracted for later use (the plasmid map is shown in Figure 2 As shown, they were named PX459-sgRNA1 and PX459-sgRNA2, respectively).

[0053] Table 2 sgRNA information

[0054]

[0055]

[0056] 3. ST cells (CL-0219 from Purnosai Biotech) were inoculated in 6-well plates for culture. When the cell density reached 70% to 80%, the recombinant plasmids (PX459-sgRNA1, PX459-sgRNA2) prepared in step 3 were transfected using Lipofectamine 3000 (Invitrogen L3000001), and ST cells were cultured as negative control groups. After 24 hours of transfection, the culture medium containing 2.0 μg / mL puromycin (Thermo Fisher Scientific A1113802) was replaced for screening. The screening culture medium was subsequently replaced. When the cells in the negative control group died under the screening pressure, the knockout cells were picked into a 96-well plate at 1 / well by limiting dilution method. After 7 days, the monoclonal cells were picked and expanded to 48-well plates.

[0057] 4. The genome of the HSP90AA1 knockout cells (named PX459-sgRNA1 cells and PX459-sgRNA2 cells) was extracted using NP-40 (Sigma Mfcd01779855) lysis buffer, and PCR amplification was performed using HSP90AA1 identification primers (Table 3). The PCR reaction system 50 μL included 5 μL of DNA template, 2 μL of upstream and downstream primers, 1 μg / μL of plasmid transfection concentration, and 2 μg of plasmid. 12× PrimeSTAR Max Premix (Takara Code No. R047A) 25 μL, ddH2O 16 μL.

[0058] The PCR reaction conditions included pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; and extension at 72°C for 5 min. The PCR products were identified by 1.0% agarose gel electrophoresis and sent to Shanghai Biotech Biotechnology Co., Ltd. for Sanger sequencing.

[0059] Table 3. Primer sequences

[0060]

[0061] For specific results, see Fig.13 and Fig.14 , Fig.13 and Fig.14 They are the sequencing comparison of HSP90AA1 targeting vector 1 (sgRNA1) and the sequencing comparison of HSP90AA1 targeting vector 2 (sgRNA2).

[0062] 5. Total RNA of the above monoclonal positive cells (PX459-sgRNA1 cells, PX459-sgRNA2 cells) was extracted and reverse transcribed into cDNA. Real-time fluorescence quantitative analysis was performed using the Taq Pro UniversalSYBR qPCR Master Mix (Novozyme Q712-02) kit. The real-time fluorescence quantitative PCR forward and reverse primers qPCR-HSP90AA1-F1 and qPCR-HSP90AA1-R1 (Table 3) were designed for the HSP90AA1 gene mRNA sequence. PCR was performed separately, and the data were exported. Melting curve analysis was performed to detect the CT value of the HSP90AA1 gene in each sample. 2 -ΔΔcT The relative expression level of the HSP90AA1 gene was calculated by qPCR (the primers of the internal reference gene were qPCR-GAPDH-F1 and qPCR-GAPDH-R1 in Table 3), and the expression of HSP90AA1 mRNA in the knockout cell line was analyzed.

[0063] For specific results, see Fig.15 and Fig.16 , Fig.15 It is HSP90AA1 monoclonal positive cell sequencing (the nucleotide sequence of the pig HSP90AA1 gene of PX459-sgRNA1 cells is compared with the nucleotide sequence of the wild-type pig HSP90AA1 gene (NW_018084979.1), and the nucleotide (T) is deleted at position 360; the nucleotide sequence of the pig HSP90AA1 gene of PX459-sgRNA2 cells is compared with the nucleotide sequence of the wild-type pig HSP90AA1 gene (NW_018084979.1), and the nucleotide (A) is inserted at position 423); Fig.16 is the relative expression level of HSP90AA1 mRNA.

[0064] pass Fig.15 and Fig.16 , indicating that the use of HSP90AA1-sgRNA1 and HSP90AA1-sgRNA2 can achieve the purpose of knocking out HSP90AA1, and the HSP90AA1 knockout cell line can be successfully obtained. The results of RT qPCR experiments proved that the target gene in the obtained HSP90AA1 knockout cell line was almost not expressed compared with the control group cells.

[0065] To detect the protein expression level of HSP90AA1 knockout cell lines (PX459-sgRNA1 cells, PX459-sgRNA2 cells), wild-type (ST cells) and knockout monoclonal positive cell lines (PX459-sgRNA1 cells, PX459-sgRNA2 cells) were first collected, and the cells were lysed with RIPA buffer and protein was extracted. Protein quantification was performed using a BCA kit (Vazyme E112-01), and then equal amounts of protein samples were mixed with loading buffer and heated for denaturation. A 10% SDS-PAGE gel was prepared, and the samples were loaded for electrophoretic separation, and then the proteins were transferred to a PVDF membrane. The membrane was blocked with 5% skim milk powder, and anti-HSP90AA1 primary antibody (MCE HY-148215A) and HRP-labeled anti-rabbit secondary antibody (MCE HY-P8001) were incubated in sequence. Finally, ECL substrate (Vazyme E433-01) was used for chemiluminescence development, and the difference in HSP90AA1 protein expression levels between wild-type and gene knockout cell lines was compared, and α-Tubulin was used as an internal reference (MCE HY-P80538) for normalization to verify the effect of HSP90AA1 gene knockout.

[0066] The results are as follows Fig.17 As shown: Cell lines knocked out using sgRNA1 (sgRNA-HSP90#1) and sgRNA2 (sgRNA-HSP90#2) do not express HSP90AA1 protein.

[0067] HSP90AA1 gene knockout cell lines (PX459-sgRNA1 cells, PX459-sgRNA2 cells) and wild-type cell lines (ST cells) were seeded into 6-well plates at a cell density of 1×10 6 Cells were cultured until confluence reached 80 to 90%. Before infection, cells were washed twice with serum-free DMEM medium preheated to 37°C to remove residual serum.

[0068] Subsequently, TGEV virus suspension was prepared at a dose of 0.1 MOI (multiplicity of infection). The prepared virus suspension was added to the cell culture wells, and the culture plate was gently shaken to ensure uniform distribution of the virus suspension. An equal amount of PBS solution was added to the cells in the control group. The culture plate was placed in an incubator at 37°C and 5% CO2 and incubated for 1 hour.

[0069] After the incubation, carefully remove the virus suspension and gently wash the cell monolayer twice with preheated PBS buffer to remove unadsorbed virus particles. Finally, add 2 mL of DMEM high-glucose medium containing 2% fetal bovine serum to each culture well. Reducing the serum concentration can reduce cell growth rate and facilitate viral replication.

[0070] The infected cells were returned to the incubator at 37°C and 5% CO2 for further culture. Samples were collected after a predetermined 12 h for subsequent RNA extraction, reverse transcription into cDNA, and gene expression analysis. Specific primers were designed for IL-1β, IL-6, TNF-a, and GAPDH (primer sequences are in Table 4) and gene expression was measured.

[0071] The results are as follows Fig.18 As shown in the figure, 12 hours after TGEV infection, the expression levels of inflammatory factors IL-1β, IL-6 and TNF-α in HSP90AA1 knockout cell lines and wild-type cell lines showed significant changes, but there were obvious differences between the two cell lines. In the wild-type cell line, the mRNA expression levels of the three inflammatory factors were significantly increased compared with the uninfected control group (P<0.01), among which IL-1β increased by about 4 times, IL-6 increased by about 4 times, and TNF-α increased by about 3.5 times. In contrast, the upregulation of inflammatory factors in the HSP90AA1 knockout cell line was significantly weakened, and the expression levels of IL-1β, IL-6 and TNF-α were approximately 50%, 60% and 45% lower than those in the wild-type cell line, respectively (all P<0.05). These results indicate that the knockout of the HSP90AA1 gene significantly inhibited the expression of inflammatory factors induced by TGEV infection for 12 hours, revealing the important regulatory role of HSP90AA1 in the early inflammatory response of TGEV infection.

[0072] Table 4. Primer sequences

[0073]

[0074] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A sgRNA for targeted editing of the HSP90AA1 gene, comprising HSP90AA1-sgRNA1 and / or HSP90AA1-sgRNA2, characterized in that: The target sequence of the HSP90AA1 sgRNA1 is shown in SEQ ID NO.5; The target sequence of the HSP90AA1 sgRNA2 is shown in SEQ ID NO.6; Preferably, the nucleotide sequence of the sense strand of the HSP90AA1 sgRNA1 is as shown in SEQ ID NO.5; Preferably, the nucleotide sequence of the positive strand of the HSP90AA1 sgRNA2 is as shown in SEQ ID NO.

6.

2. A biomaterial, comprising the sgRNA for specifically targeting and editing the HSP90AA1 gene according to claim 1, wherein the biomaterial is a vector or a transgenic cell.

3. An expression vector of sgRNA targeting and editing the HSP90AA1 gene, characterized in that: Comprising a sequence encoding the sgRNA of claim 1.

4. A knockout vector capable of inhibiting the expression of porcine HSP90AA1 gene, which is obtained by connecting a double-stranded DNA encoding the sgRNA according to claim 1 to a vector.

5. The knockout vector according to claim 4, characterized in that The double-stranded DNA encoding the HSP90AA1-sgRNA1 is obtained by annealing the single-stranded DNA shown in SEQ ID NO: 1 with the single-stranded DNA shown in SEQ ID NO: 2; or The double-stranded DNA encoding the HSP90AA1-sgRNA2 is obtained by annealing the single-stranded DNA shown in SEQ ID NO: 3 and the single-stranded DNA shown in SEQ ID NO:

4.

6. The knockout vector according to claim 4 or 5, characterized in that The vector is the PX459 vector.

7. Use of the sgRNA according to claim 1 in preparing a cell line in which HSP90AA1 gene expression is inhibited.

8. The use according to claim 7, characterized in that: The cell line is a porcine ST cell line.

9. The use according to claim 7 or 8, characterized in that: The method for constructing the porcine ST cell line comprises: introducing a CRISPR / Cas9 gene knockout vector containing the sgRNA into cells to knock out the HSP90AA1 gene; Preferably, the CRISPR / Cas9 gene knockout vector is introduced into cells by electrotransfection.

10. The cell line according to claim 7 in which HSP90AA1 gene expression is suppressed.

Images