SgRNA specifically targeting pig hsp90aa1 gene knockout and application thereof

Abstract

The application belongs to the technical field of gene knockout, and particularly relates to sgRNA for specifically targeting pig HSP90AA1 gene knockout and application thereof. The nucleotide sequence of the sgRNA is specifically designed, can be efficiently combined with a Cas9 protein, realizes precise knockout of the HSP90AA1 gene in pig ST cells, and inhibits expression of the HSP90AA1 gene.

Description

Technical Field

[0001] This invention belongs to the field of gene knockout technology, specifically relating to an sgRNA that specifically targets the knockout of the porcine HSP90AA1 gene and its application. Background Technology

[0002] Intracellular expression of heat shock protein 90 (HSP90AA1) is closely related to viral infection and host immune responses. Many viruses utilize host cell HSP90AA1 during their life cycle to promote their own replication, spread, and evade host immune responses. Transmissible gastroenteritis virus (TGEV), an important porcine coronavirus, has an infection mechanism whose interaction with host cytokines is not fully elucidated. HSP90AA1, as a molecular chaperone, may promote proper protein folding during viral replication by interacting with TGEV proteins. This process may be crucial for the replication, assembly, and release of the TGEV genome. Furthermore, HSP90AA1 also plays an important role in immune regulation, potentially influencing the host immune system's response through interactions with antigens associated with TGEV infection. This mechanism involves not only the activation of immune cells but may also affect TGEV's ability to evade immune surveillance. Existing research indicates that some viruses can evade host cell immune recognition by regulating HSP90AA1. TGEV may also utilize a similar mechanism, using HSP90AA1 to prevent the display of its antigens on the cell surface, thereby mitigating immune system surveillance. This evasion mechanism may make TGEV more likely to replicate and spread within host cells. However, the specific role of HSP90AA1 in the TGEV infection process and its impact on the host cell inflammatory response remain unclear, which provides an important research direction for further study of the TGEV infection mechanism and the development of new prevention and control strategies.

[0003] Given the potentially crucial role of HSP90AA1 in viral infection, it has become a key target for studying the mechanisms of TGEV infection and host inflammatory responses, attracting significant attention. Interfering with HSP90AA1 function, particularly through gene knockout technology, may reveal key regulatory mechanisms in TGEV infection, providing new research tools and approaches for a deeper understanding of virus-host interactions. This offers an innovative research approach for exploring the relationship between TGEV infection and HSP90AA1 using a porcine ST cell model. Summary of the Invention

[0004] This invention provides a porcine ST cell line with HSP90AA1 gene knockout, which specifically knocks out the HSP90AA1 gene using CRISPR / Cas9 technology. The invention employs an optimized sgRNA sequence to ensure efficient binding to the Cas9 protein, forming an effective gene editing tool. Through molecular biology and cell engineering techniques, the porcine ST cell line with HSP90AA1 gene knockout was successfully constructed. Validation of this cell line confirmed that the HSP90AA1 gene was effectively knocked out, and the protein expression level was significantly reduced. Furthermore, this invention provides a method for applying this cell line in TGEV infection research. By comparing the differences in inflammatory factor expression between the HSP90AA1 gene knockout cell line and wild-type cell lines after TGEV infection, this not only provides an important tool for studying the pathological mechanisms of porcine transmissible gastroenteritis but also lays the foundation for developing potential antiviral and anti-inflammatory treatment strategies. The establishment of this cell model provides a new perspective for in-depth research on the regulatory role of HSP90AA1 in the inflammatory response induced by TGEV infection, and is expected to promote the innovative development of TGEV infection mechanism research and related prevention and control strategies.

[0005] This invention provides a specifically designed sgRNA whose nucleotide sequence matches a specific region of the porcine HSP90AA1 gene. The sgRNA is optimized to ensure efficient binding to the Cas9 protein, forming an effective gene-editing tool. Using molecular biology techniques, this sgRNA can be synthesized and purified for subsequent gene knockout experiments.

[0006] The sgRNA includes sgRNA1 and / or sgRNA2;

[0007] The positive strand of the DNA sequence of sgRNA1 is shown in SEQ ID NO: 1, and the DNA sequence of its complementary strand is shown in SEQ ID NO: 2; the positive strand of the DNA sequence of sgRNA2 is shown in SEQ ID NO: 3, and the DNA sequence of its complementary strand is shown in SEQ ID NO: 4.

[0008] This invention achieves efficient and precise knockout of the HSP90AA1 gene by introducing synthesized sgRNA into porcine ST cells and binding to the Cas9 protein. The process underwent rigorous experimental design and optimization to ensure stable and reliable knockout results. The knockout effect of the HSP90AA1 gene in porcine ST cells was verified using qPCR and Western blot methods, confirming a significant reduction in both mRNA and protein levels. Furthermore, this invention established a complete experimental protocol for evaluating the impact of HSP90AA1 gene knockout on the TGEV infection process. By comparing viral replication levels and inflammatory factor expression in wild-type and knockout cell lines after TGEV infection, the role of HSP90AA1 in the host response induced by TGEV infection was investigated in depth, providing new research tools and methods for elucidating the mechanism of TGEV infection.

[0009] This invention provides a pair of sgRNA sequences for knocking out the porcine HSP90AA1 gene, targeting the second exon region of the HSP90AA1 gene. The target sequences are AGACCGGACCCTCACGATAG and CTTGGTACGATCGCCAAGTC, exhibiting high targeting and knockout efficiency. The knockout is performed using a CRISPR / Cas9 system. The sgRNA sequences include sgRNA1 and sgRNA2. After knockout, HSP90AA1 gene expression is suppressed. The positive strand of the DNA sequence of sgRNA1 is shown in SEQ ID NO: 1, and its complementary strand is shown in SEQ ID NO: 2. The positive strand of the DNA sequence of sgRNA2 is shown in SEQ ID NO: 3, and its complementary strand is shown in SEQ ID NO: 4.

[0010] The present invention also provides a biological material comprising the two sgRNAs specifically targeting and knocking out the porcine HSP90AA1 gene as described above, wherein the biological material is a vector or a transgenic cell.

[0011] This invention also provides a knockout vector that can suppress the expression of the porcine HSP90AA1 gene, obtained by ligating the double-stranded DNA of the aforementioned sgRNA1 and sgRNA2 to a vector. The vector is a PX459 vector. The method for preparing the knockout vector of the CRISPR / Cas9 system includes: synthesizing the positive strand of the DNA sequence of sgRNA1 (e.g., SEQ ID NO: 1) and the DNA sequence of its corresponding complementary strand (e.g., SEQ ID NO: 2); the positive strand of the DNA sequence of sgRNA2 (e.g., SEQ ID NO: 3) and the DNA sequence of its corresponding complementary strand (e.g., SEQ ID NO: 4); annealing the single-stranded DNA sequence to synthesize double-stranded DNA; and then ligating it to the BbsI restriction site of the PX459 vector backbone to form a complete targeting plasmid.

[0012] This invention also provides the application of the above-mentioned sgRNA sequence in the preparation of a cell line with suppressed HSP90AA1 gene expression; the cell line is the porcine ST cell line. The method for constructing the porcine ST cell line is as follows: a CRISPR / Cas9 gene knockout vector containing the sgRNA specifically targeting the porcine HSP90AA1 gene is introduced into the cells to knock out the HSP90AA1 gene. The introduction of the CRISPR / Cas9 gene knockout vector into the cells can be achieved through conventional biological methods such as electroporation.

[0013] This invention utilizes a pair of sgRNAs that specifically recognize the porcine HSP90AA1 gene and employs CRISPR / Cas9 technology to successfully knock out the HSP90AA1 gene in porcine ST cell lines. Experimental verification has shown that the HSP90AA1 gene knockout cell lines of this invention can inhibit the proliferation of porcine diarrhea virus in cells to a certain extent, which is of great significance for the research of antiviral drugs against porcine viruses and the screening of antiviral targets. The HSP90AA1 gene knockout method provided by this invention has strong practicality and provides an effective method and foundation for the functional study and application of the HSP90AA1 gene.

[0014] The beneficial effects of this invention are:

[0015] The nucleotide sequence-specific design of the sgRNA of this invention enables it to bind efficiently to the Cas9 protein, thereby achieving precise knockout of the HSP90AA1 gene in porcine ST cells and inhibiting the expression of the HSP90AA1 gene.

[0016] Through the technology of this invention, researchers can gain a deeper understanding of the function of HSP90AA1 in porcine ST cells, its role in cellular stress and viral replication, and its potential antiviral therapeutic targets.

[0017] This invention not only provides an efficient and feasible gene editing tool, but also offers new directions for advancements in pig gene editing, biomedical research, and other fields. Knocking out the HSP90AA1 gene in pig ST cells holds promise for providing important support for research on pig growth, immune responses, and disease resistance. Attached Figure Description

[0018] Figure 1 A schematic diagram of HSP90AA1 sgRNA is shown.

[0019] Figure 2 A schematic diagram of the HSP90AA1 target carrier is shown.

[0020] Figure 3 The knockout efficiency of sgRNA1 is shown.

[0021] Figure 4 The knockout efficiency of sgRNA2 is shown.

[0022] Figure 5 The knockout efficiency of sgRNA3 is shown.

[0023] Figure 6 The knockout efficiency of sgRNA4 is shown.

[0024] Figure 7 The knockout efficiency of sgRNA5 is shown.

[0025] Figure 8 The knockout efficiency of sgRNA6 is shown.

[0026] Figure 9 The knockout efficiency of sgRNA7 is shown.

[0027] Figure 10 The knockout efficiency of sgRNA8 is shown.

[0028] Figure 11 The knockout efficiency of sgRNA9 is shown.

[0029] Figure 12 The knockout efficiency of sgRNA10 is shown.

[0030] Figure 13 The sequencing comparison of HSP90AA1 targeting vector 1 is shown.

[0031] Figure 14 The sequencing comparison of HSP90AA1 targeting vector 2 is shown.

[0032] Figure 15 Sequencing of HSP90AA1 monoclonal positive cells is shown.

[0033] Figure 16 The relative expression levels of HSP90AA1 mRNA are shown.

[0034] Figure 17 The expression level of HSP90AA1 protein is shown.

[0035] Figure 18 The relative expression levels of IL-1β, IL-6, and TNF-α mRNA are shown. Detailed Implementation

[0036] definition

[0037] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly used in the field to which this invention pertains. For the purposes of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural forms, and vice versa.

[0038] As used herein, the term "about" indicates a range of ±20% of the following value. In some embodiments, the term "about" indicates a range of ±10% of the following value. In some embodiments, the term "about" indicates a range of ±5% of the following value.

[0039] The present invention will be further described in detail below through specific embodiments.

[0040] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0041] Unless otherwise specified, experimental methods in the following examples are generally performed under standard conditions or as recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in these examples are commercially available. For reagents whose manufacturers are listed, similar products from other manufacturers are substituted.

[0042] Example 1

[0043] This embodiment provides an sgRNA that specifically targets and edits the porcine HSP90AA1 gene or a CRISPR / Cas9 gene knockout vector containing the sgRNA for knocking out the HSP90AA1 gene.

[0044] The CRISPR / Cas9 gene knockout vector is a vector containing sgRNA that specifically targets the HSP90AA1 gene, and the positive strand of the sgRNA is shown in SEQ ID NO.1 and SEQ ID NO.3.

[0045] The biomaterials of the present invention include the above-mentioned sgRNA that specifically targets and knocks out the HSP90AA1 gene, and the biomaterials are vectors or transgenic cells.

[0046] This invention discloses a method for constructing a cell line with the HSP90AA1 gene knocked out, comprising knocking out the HSP90AA1 gene in the cell line using a CRISPR / Cas9 system, wherein the CRISPR / Cas9 system uses sgRNA with a nucleotide sequence as shown in SEQ ID NO.1. The CRISPR / Cas9 gene knockout vector can be introduced into cells using conventional biological methods such as electroporation. For detailed technical principles, please refer to... Figure 1 and Figure 2 .

[0047] Example 2

[0048] 1. This invention uses the nucleotide sequence of the porcine HSP90AA1 gene (NW_018084979.1) downloaded from the NCBI database. Based on the analysis of the HSP90AA1 gene sequence, sgRNAs were designed with exons as target sites. Following the CRISPR / Cas9 target design principles, the 20bp upstream sequence of the protospacer adjacent motif (PAM) was selected as the sgRNA binding site. Ten sgRNAs were designed as shown in Table 1 below. Gene editing was performed using these sgRNAs. DNA was extracted from the edited cells and subjected to PCR amplification and sequencing (using the same methods as points 2 to 4 in this embodiment). The overall editing efficiency of these sgRNAs was compared (https: / / tide.nki.nl / ).

[0049] The results are as follows Figure 3-12 As shown in Table 1, the two sgRNAs with the highest targeting efficiency were selected for subsequent use.

[0050] Table 1. sgRNA positive strand and its knockout efficiency

[0051] name sequence Knockout efficiency sgRNA1 AGACCGGACCCTCACGATAG, SEQ ID NO: 5 92.6％ sgRNA2 CTTGGTACGATCGCCAAGTC, SEQ ID NO: 6 72％ sgRNA3 CAGACTTGGCGATCGTACCA, SEQ ID NO: 7 21.8％ sgRNA4 CGGCTTCTACTCTGCGTACC, SEQ ID NO: 8 30％ sgRNA5 ACGATAGTGGACACCGGCAT, SEQ ID NO: 9 50.2％ sgRNA6 GCCGGTGTCCACTATCGTGA, SEQ ID NO: 10 54.5％ sgRNA7 TTGGTACGATCGCCAAGTCT, SEQ ID NO: 11 55.3％ sgRNA8 CTGCTCGTCATCGTTGTGTT, SEQ ID NO: 12 3.5％ sgRNA9 TGTCCACTATCGTGAGGGTC, SEQ ID NO: 13 65.4％ sgRNA10 GGTGCCGATATCTCCATGAT, SEQ ID NO: 14 47.4％

[0052] 2. The targeting vector PX459 (addgene Plasmid #118632) was digested with restriction endonuclease Bbs1 (New England Biolabs #R0539L) to obtain a linearized vector, which was then recovered via gel electrophoresis. The sgRNA was reacted at 95°C for 5 min and then annealed at room temperature to form hybridization products (the primers for the synthesis of the sgRNAs (named sgRNA1 and sgRNA2, respectively) shown in SEQ ID NO: 5 and SEQ ID NO: 6, are listed in Table 2). These hybridization products were ligated with the linearized PX459 (Addgene Plasmid #108294) vector overnight at 16°C using T4 ligase (Takara Code No. 2011A). The ligation product was transformed into E. coli DH5α competent cells (Takara Code No. 9057), and single colonies were picked from ampicillin-resistant plates and cultured in 4 mL LB medium containing ampicillin. The bacterial culture was sequenced and identified using the U6 promoter as a primer. Sequence alignment was performed to verify the correctness of the sequence, and plasmids were extracted for later use (plasmid map shown). Figure 2 As shown, they were named PX459-sgRNA1 and PX459-sgRNA2, respectively.

[0053] Table 2 sgRNA Information

[0054]

[0055]

[0056] 3. ST cells (Pronosei Biotechnology CL-0219) were seeded in 6-well plates and cultured. When the cell density reached 70% to 80%, the recombinant plasmids (PX459-sgRNA1 and PX459-sgRNA2) prepared in step 3 were transfected with Lipofectamine 3000 (Invitrogen L3000001). ST cells were cultured simultaneously as a negative control group. 24 hours after transfection, the medium was replaced with puromycin (Thermo Fisher Scientific A1113802) for selection. The selection medium was continuously changed. When the negative control group cells died under selection pressure, knockout cells were picked at 1 cell / well using the limiting dilution method and transferred to 96-well plates. After 7 days, single clones were picked and expanded to 48-well plates.

[0057] 4. Extract the genome of the HSP90AA1 gene knockout cells (named PX459-sgRNA1 cells and PX459-sgRNA2 cells, respectively) using NP-40 (Sigma Mfcd01779855) lysis buffer. Perform PCR amplification using HSP90AA1 identification primers (Table 3). The PCR reaction system consists of 50 μL of DNA template, 2 μL each of forward and reverse primers, and a plasmid transfection concentration of 1 μg / μL. The amount of plasmid is 2 μg. 25 μL of 12×PrimeSTAR Max Premix (Takara Code No. R047A) and 16 μL of ddH2O were also added.

[0058] The PCR reaction conditions included 94℃ pre-denaturation for 4 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; and 72℃ extension for 5 min. The PCR products were identified by 1.0% agarose gel electrophoresis and then sent to Shanghai Sangon Biotech Co., Ltd. for Sanger sequencing.

[0059] Table 3. Primer Sequences

[0060]

[0061] For details, please see [link / details]. Figure 13 and Figure 14 , Figure 13 and Figure 14 The sequencing comparisons are for HSP90AA1 targeting vector 1 (sgRNA1) and HSP90AA1 targeting vector 2 (sgRNA2).

[0062] 5. Total RNA was extracted from the above-mentioned monoclonal positive cell lines (PX459-sgRNA1 cells and PX459-sgRNA2 cells) and reverse transcribed into cDNA. Real-time quantitative PCR analysis was performed using the Taq Pro UniversalSYBR qPCRMaster Mix (Novizan Q712-02) kit. Real-time quantitative PCR forward and reverse primers qPCR-HSP90AA1-F1 and qPCR-HSP90AA1-R1 (Table 3) were designed based on the HSP90AA1 gene mRNA sequence, and PCR was performed separately. Data were exported, and melting curve analysis was conducted to detect the CT value of the HSP90AA1 gene in each sample. A 23 -ΔΔcT The relative expression level of the HSP90AA1 gene was calculated using the method (the primers for the internal reference gene were qPCR-GAPDH-F1 and qPCR-GAPDH-R1 in Table 3), and the expression of HSP90AA1 mRNA in the knockout cell line was analyzed.

[0063] For details, please see [link / details]. Figure 15 and Figure 16 , Figure 15 The sequencing of HSP90AA1 monoclonal positive cells showed that the nucleotide sequence of the porcine HSP90AA1 gene in PX459-sgRNA1 cells was different from that in wild-type pigs (NW_018084979.1), with a deletion at position 360 (T); and the nucleotide sequence of the porcine HSP90AA1 gene in PX459-sgRNA2 cells was different from that in wild-type pigs (NW_018084979.1), with an insertion at position 423 (A). Figure 16 It represents the relative expression level of HSP90AA1 mRNA.

[0064] pass Figure 15 and Figure 16 The results show that HSP90AA1-sgRNA1 and HSP90AA1-sgRNA2 can be used to knock out HSP90AA1 and successfully obtain HSP90AA1 knockout cell lines. The results of RT qPCR experiments show that the obtained HSP90AA1 knockout cell lines hardly express the target gene compared with the control group cells.

[0065] To detect protein expression levels in HSP90AA1 gene knockout cell lines (PX459-sgRNA1 cells and PX459-sgRNA2 cells), wild-type (ST cells) and gene knockout monoclonal positive cell lines (PX459-sgRNA1 cells and PX459-sgRNA2 cells) were first collected. Cells were lysed with RIPA buffer and proteins were extracted. Protein quantification was performed using a BCA kit (Vazyme E112-01). Then, an equal volume of protein sample was mixed with loading buffer and heated for denaturation. A 10% SDS-PAGE gel was prepared, and the sample was loaded for electrophoresis separation. Subsequently, the proteins were transferred to a PVDF membrane. The membrane was blocked with 5% skim milk powder and incubated sequentially with anti-HSP90AA1 primary antibody (MCE HY-148215A) and HRP-labeled anti-rabbit secondary antibody (MCE HY-P8001). Finally, chemiluminescence imaging was performed using ECL substrate (Vazyme E433-01) to verify the effect of HSP90AA1 gene knockout by comparing the difference in HSP90AA1 protein expression levels between wild-type and gene knockout cell lines and normalizing the expression with α-Tubulin as an internal control (MCE HY-P80538).

[0066] The results are as follows Figure 17 As shown: Cell lines with sgRNA1 (sgRNA-HSP90#1) and sgRNA2 (sgRNA-HSP90#2) knockout do not express HSP90AA1 protein.

[0067] HSP90AA1 gene knockout cell lines (PX459-sgRNA1 cells and PX459-sgRNA2 cells) and wild-type cell lines (ST cells) were seeded into 6-well plates, with a cell density of 1 × 10⁶ cells per well. 6 Cells / well. Culture cells until confluence reaches 80-90%. Wash cells twice with serum-free DMEM medium preheated to 37°C before infection to remove residual serum.

[0068] Subsequently, a TGEV virus suspension was prepared at a dose of 0.1 MOI (multiplicity of infection). The prepared virus suspension was added to the cell culture wells, and the culture plate was gently shaken to ensure uniform distribution of the virus suspension. An equal volume of PBS solution was added to the control group cells. The culture plate was incubated at 37°C and 5% CO2 for 1 hour.

[0069] After incubation, carefully aspirate the virus suspension and gently wash the cell monolayer twice with pre-warmed PBS buffer to remove any unadsorbed virus particles. Finally, add 2 mL of DMEM high-glucose medium containing 2% fetal bovine serum to each well. Lowering the serum concentration reduces cell growth rate and promotes viral replication.

[0070] Infected cells were returned to an incubator at 37°C and 5% CO2 for further culture. Samples were collected after a predetermined 12 hours for subsequent RNA extraction, reverse transcription to cDNA, and gene expression analysis. Specific primers were designed for IL-1β, IL-6, TNF-α, and GAPDH (primer sequences are shown in Table 4), and gene expression levels were analyzed.

[0071] The results are as follows Figure 18 As shown, 12 hours after TGEV infection, the expression levels of inflammatory cytokines IL-1β, IL-6, and TNF-α in both HSP90AA1 gene knockout and wild-type cell lines showed significant changes, but there were significant differences between the two cell lines. In the wild-type cell line, the mRNA expression levels of the three inflammatory cytokines were significantly increased compared to the uninfected control group (P<0.01), with IL-1β increasing approximately 4-fold, IL-6 increasing approximately 4-fold, and TNF-α increasing approximately 3.5-fold. In contrast, the upregulation of inflammatory cytokines in the HSP90AA1 gene knockout cell line was significantly weakened, with the expression levels of IL-1β, IL-6, and TNF-α being approximately 50%, 60%, and 45% lower than those in the wild-type cell line, respectively (all P<0.05). These results indicate that HSP90AA1 gene knockout significantly inhibited the expression of inflammatory cytokines induced 12 hours after TGEV infection, revealing the important regulatory role of HSP90AA1 in the early inflammatory response of TGEV infection.

[0072] Table 4. Primer Sequences

[0073]

[0074] The technical solutions of the present invention are not limited to the specific embodiments described above. Any technical modifications made in accordance with the technical solutions of the present invention fall within the protection scope of the present invention.

Claims

1. A sgRNA for targeted editing of a HSP90AA1 gene, the sgRNA comprising HSP90AA1-sgRNA1 and / or HSP90AA1-sgRNA2, characterized in that: a nucleotide sequence of a sense strand of the HSP90AA1 sgRNA1 is shown in SEQ ID NO. 5; and / or a nucleotide sequence of a sense strand of the HSP90AA1 sgRNA2 is shown in SEQ ID NO.

6. 2.A biological material containing the sgRNA for specific targeted editing of a HSP90AA1 gene according to claim 1, the biological material being a vector or a transgenic cell. 3.An expression vector for a sgRNA for targeted editing of a HSP90AA1 gene, characterized in that: the expression vector comprises a sequence for expressing the sgRNA according to claim 1. 4.A knock-out vector for inhibiting expression of a pig HSP90AA1 gene, the knock-out vector being obtained by linking double-stranded DNA for expressing the sgRNA according to claim 1 to a vector. 5.The knock-out vector according to claim 4, characterized in that: the double-stranded DNA for expressing the HSP90AA1-sgRNA1 is obtained by annealing single-stranded DNA shown in SEQ ID NO: 1 to single-stranded DNA shown in SEQ ID NO: 2; or the double-stranded DNA for expressing the HSP90AA1-sgRNA2 is obtained by annealing single-stranded DNA shown in SEQ ID NO: 3 to single-stranded DNA shown in SEQ ID NO:

4. 6.The knock-out vector according to claim 4 or 5, characterized in that: the vector is a PX459 vector. 7.Use of the sgRNA according to claim 1 in the preparation of a cell line in which expression of a HSP90AA1 gene is inhibited, the cell line being a pig ST cell line. 8.The use according to claim 7, characterized in that: the pig ST cell line is constructed by introducing a CRISPR / Cas9 gene knock-out vector containing the sgRNA into cells to knock out a HSP90AA1 gene. 9.The use according to claim 8, characterized in that: the CRISPR / Cas9 gene knock-out vector is introduced into cells by electroporation. ​ ​ ​ ​ ​ ​ ​ ​

Images