Medicago sativa U6 promoter capable of improving gene editing efficiency and application of medicago sativa U6 promoter

Abstract

The invention belongs to the technical field of gene editing, and particularly relates to a medicago sativa U6 promoter for improving gene editing efficiency and application of the medicago sativa U6 promoter. The promoter is an MsU6-3 with a sequence as shown in SEQ ID NO.2, an MsU6-20 with a sequence as shown in SEQ ID NO.3, or an MsU6-38 with a sequence as shown in SEQ ID NO.4. The invention also discloses a preparation method of the promoter. According to the invention, an endogenous U6 promoter of medicago sativa flowers is found through genetic analysis, then a CRISPR / Cas9 gene editing carrier carrying MsU6-3 or MsU6-20 or MsU6-38 is designed, and hairy root transformation plants and a sequencing technology are utilized to verify that the gene editing efficiency of the promoters MsU6-3, MsU6-20 and MsU6-38 provided by the invention can reach 100%; the promoter provided by the invention is of great significance for accelerating gene function research and molecular breeding technology of alfalfa in the future.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene editing, and in particular relates to an alfalfa U6 promoter for improving gene editing efficiency and an application thereof. Background Art

[0002] Alfalfa is a very important autotetraploid forage crop. It plays an important role in my country's animal husbandry production and provides high-quality protein and essential nutrients for the global animal husbandry industry. Currently, the selection and breeding of alfalfa varieties mainly focuses on traditional methods such as hybridization and selection. The breeding speed of fine varieties is slow and the number is small, which is difficult to meet the market demand for alfalfa. Therefore, it is urgent to provide new alfalfa variety improvement strategies to obtain fine varieties with high yield, good quality and strong stress resistance.

[0003] In recent years, CRISPR / Cas9 gene editing technology has brought revolutionary changes to plant biology and crop breeding. Since alfalfa is a homologous tetraploid plant with a complex genetic background, it is difficult to efficiently obtain homozygous mutants, which poses a huge challenge to gene editing. Currently, most of the CRISPR / Cas9 gene editing vectors reported on alfalfa have low homozygous mutation efficiency, which restricts the progress of gene function research and biological breeding of alfalfa using CRISPR / Cas9 technology.

[0004] The U6 promoter is a type II promoter that can bind to eukaryotic RNA polymerase III and transcribe U6 RNA. The U6 promoter is often used to transcribe gRNA in CRISPR / Cas9 gene editing vectors and is a key element in the vector. The U6 promoter is species-specific. In gene editing, using the plant endogenous U6 transformation species itself or the U6 promoter of a close species can achieve higher promoter efficiency. Optimization of the U6 promoter can effectively regulate the expression of gRNA, thereby significantly affecting the gene editing efficiency, specificity and applicability of the CRISPR / Cas9 system in different organisms or tissues. An efficient U6 promoter can greatly improve the success rate and editing efficiency of gene editing. However, the promoter commonly used in the CRISPR / Cas9 gene editing vectors currently developed for alfalfa is the Arabidopsis U6 promoter, which has a limited gene editing efficiency of only about 60%. Summary of the invention

[0005] In view of the technical problems existing in the above-mentioned prior art, the present invention provides a U6 promoter of alfalfa for improving the gene editing efficiency, wherein the promoter is MsU6-3 of the sequence shown in SEQ ID NO.2, MsU6-20 of the sequence shown in SEQ ID NO.3, or MsU6-38 of the sequence shown in SEQ ID NO.4. The gene editing efficiency of the promoters MsU6-3, MsU6-20 and MsU6-38 provided by the present invention can reach 100%, and can be used to prepare gene editing vectors, and has wide application potential in aspects such as alfalfa variety improvement.

[0006] The first aspect of the present invention provides a U6 promoter of alfalfa for improving gene editing efficiency, wherein the U6 promoter of alfalfa for improving gene editing efficiency is MsU6-3 or MsU6-20 or MsU6-38; the nucleotide sequence of the MsU6-3 is shown in SEQ ID NO.2; the nucleotide sequence of the MsU6-20 is shown in SEQ ID NO.3; the nucleotide sequence of the MsU6-38 is shown in SEQ ID NO.4.

[0007] A second aspect of the present invention provides an application of the above-mentioned alfalfa U6 promoter for improving gene editing efficiency in improving the gene editing efficiency of the CRISPR / Cas9 system.

[0008] A third aspect of the present invention provides an application of the above-mentioned alfalfa U6 promoter for improving gene editing efficiency in alfalfa trait improvement.

[0009] A fourth aspect of the present invention provides an application of the above-mentioned alfalfa U6 promoter for improving gene editing efficiency in alfalfa gene function research.

[0010] A fifth aspect of the present invention provides an application of the above-mentioned alfalfa U6 promoter for improving gene editing efficiency in alfalfa molecular breeding technology.

[0011] The sixth aspect of the present invention provides a gene editing vector, which carries the above-mentioned alfalfa U6 promoter MsU6-3 or MsU6-20 or MsU6-38 for improving gene editing efficiency.

[0012] A seventh aspect of the present invention provides a method for constructing the gene editing vector described above, the method comprising the following steps: The nucleotide sequence of the alfalfa U6 promoter MsU6-3 or MsU6-20 or MsU6-38 for improving gene editing efficiency described above is sequentially connected with the sgRNA and gRNA scaffold nucleotide sequences of the gene to be edited to obtain a recombinant fragment; The recombinant fragment is connected to the expression vector to obtain the gene editing vector.

[0013] Furthermore, the gene to be edited is FTa1 , FTa1 The nucleotide sequence of the gene is shown in SEQ ID NO.5.

[0014] Furthermore, the FTa1 The sgRNAs of the gene are sgRNA1 and sgRNA2; the nucleotide sequence of the sgRNA1 is shown in SEQ ID NO.6; the nucleotide sequence of the sgRNA2 is shown in SEQ ID NO.7; SEQ ID NO.6: 5'-AATCAACCCAGAGTGAGTGT-3'; SEQ ID NO.7: 5'-AGGTTGGTGACTGATATTCC-3'.

[0015] Furthermore, the FTa1 The nucleotide sequence of the gRNA scaffold of the gene is shown in SEQ ID NO.9.

[0016] SEQ ID NO.9: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCA ACTTGAAAAAGTGGCACCGAGTCGGTGC.

[0017] Furthermore, the expression vector is pRGEB31.

[0018] An eighth aspect of the present invention provides an application of the gene editing vector described above in improving the efficiency of alfalfa gene editing.

[0019] A ninth aspect of the present invention provides an application of the gene editing vector described above in improving the genetic transformation efficiency of alfalfa.

[0020] In summary, compared with the prior art, the present invention has the following advantages and effects: The present invention clones three endogenous U6 promoters of alfalfa from the alfalfa genome for the first time, which are promoter MsU6-3 of the sequence shown in SEQID NO.2, promoter MsU6-20 of the sequence shown in SEQ ID NO.3 or promoter MsU6-38 of the sequence shown in SEQ ID NO.4. Gene editing vectors carrying the three promoters are constructed respectively, and the gene editing efficiency of the promoters MsU6-3, MsU6-20 or MsU6-38 is detected by combining an alfalfa hairy root transformation method and high-throughput sequencing. It is found that the gene editing efficiency of MsU6-3, MsU6-20 and MsU6-38 can all reach 100%. The alfalfa U6 promoter with improved gene editing efficiency provided by the present invention can be used in the fields of alfalfa trait improvement, alfalfa molecular breeding or alfalfa gene function research.

[0021] The present invention also provides a gene editing vector and a method for preparing the gene editing vector. The gene editing vector carries the nucleotide sequence of SEQ ID NO.2 or SEQ ID NO.3 or SEQ ID NO.4. The gene editing vector can improve the efficiency of alfalfa gene editing, solves the problem of low homozygous mutation efficiency of the CRISPR / Cas9 gene editing vector of alfalfa, and establishes a new alfalfa gene editing strategy. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the evolutionary tree of the MsU6 promoter.

[0023] Figure 2 This is a flow chart for transformation of alfalfa hairy roots; Figure 2 Figure A is a seed germination diagram. Figure 2 Figure B shows the first root cutting infection. Figure 2 Figure C shows the first root cutting and culturing for 8 days. Figure 2 Figure D is the second root cutting diagram. Figure 2 Figure E shows the cultured 7 days after the second root cutting; Figure 2 Figure B Figure 2 Figure C Figure 2 The D graph and Figure 2 The samples in Figure E are from the same batch of seedlings at different growth stages; the seeds in the upper and lower rows are multiple replicates of a batch of seedlings. DETAILED DESCRIPTION

[0024] In order to enable those skilled in the art to better understand and implement the technical solution of the present invention, the present invention is further described below in conjunction with specific embodiments and drawings.

[0025] In the description of the present invention, unless otherwise specified, all reagents used are commercially available and all methods used are conventional techniques in the art.

[0026] The biological materials involved in the embodiments are: Zhongmu No. 1 was purchased from a store on China Grass Network; Agrobacterium rhizogenes Ar.1193 competent cells were purchased from Shanghai Weidi Biotechnology Co., Ltd.; the present invention marks the alfalfa U6 promoter as MsU6; the alfalfa U6 promoter obtained by the present invention is represented by MsU6-X, where X is an Arabic numeral, and X is used to distinguish alfalfa U6 promoters with different nucleotide sequences.

[0027] Since alfalfa is an autotetraploid plant with a complex genetic background, it is difficult to efficiently obtain homozygous mutants, which brings great challenges to alfalfa gene editing. Most of the CRISPR / Cas9 gene editing vectors reported so far have low homozygous mutation efficiency, which restricts the use of CRISPR / Cas9 technology in alfalfa for gene function research and biological breeding. In addition, the promoter commonly used in the CRISPR / Cas9 gene editing vectors currently developed for alfalfa is the Arabidopsis U6 promoter, which has a limited gene editing efficiency of only about 60%.

[0028] The present invention provides an alfalfa U6 promoter for improving gene editing efficiency and its application. The alfalfa U6 promoter for improving gene editing efficiency is MsU6-3 or MsU6-20 or MsU6-38; the nucleotide sequence of MsU6-3 is shown in SEQ ID NO.2; the nucleotide sequence of MsU6-20 is shown in SEQ ID NO.3; the nucleotide sequence of MsU6-38 is shown in SEQ ID NO.4. MsU6-3 or MsU6-20 or MsU6-38 can be used to construct a gene editing vector for improving the efficiency of alfalfa gene editing or the efficiency of alfalfa gene genetic transformation; the promoter or gene editing vector provided by the present invention has a wide range of application potentials in alfalfa variety improvement and the like.

[0029] Example 1: Acquisition of promoter The conservative sequence of Arabidopsis thaliana U6 snRNA is shown in SEQ ID NO.1. The nucleotide sequence shown in SEQ ID NO.1 is used to search and compare in the Xinjiang large-leaf alfalfa genome database at the website address https: / / phytozome.jgi.doe.gov to obtain the candidate alfalfa U6 promoter; SEQ ID NO.1: gtcccttcggggacatccgataaaattggaacgatacagagaagattagcatggcccctgcgcaaggatgacacgcataaatcgagaaatggtccaaatttt.

[0030] Since the genome data of alfalfa is complicated and the amount of calculation is huge, conventional genome BLAST cannot be performed on general web pages. Conventional screening by software reading is limited by the huge genome file and cannot be compared. Therefore, the present invention combines code setting instructions without manual waiting and operation, thereby extracting sequences containing promoters. The specific method for obtaining promoters is as follows: S1. Enter vim script.py in Terminal under Linux system, press Enter to start editing the script: blastn-query cp_TRL_nucleotide sequence shown in SEQ ID NO.1 to be compared-subject cp_genome file name-out out_output file name-evalue 1e-5-outfmt6, enter pythonscript.py in Terminal and press Enter to start running the script, execute the code in the script, and obtain the position information of the comparison result; S2. According to the position information of the alignment result, extract the information using the extraction sequence information code, where the extraction sequence information code is: extractseq-sequence genome.fa-regionXXX-XXXX-outseq new.fa; wherein XXX-XXXX represents the start sequence and the end sequence in the alignment result; according to the position information of the alignment result, calculate the position information of 2000bp upstream and 2000bp downstream of the promoter sequence alignment result, extract the sequence according to the extraction information code, and obtain the RNA sequence containing MsU6; S3. Find the MsU6 promoter sequence in different RNA sequences containing MsU6, and then shorten the 5' end of the MsU6 promoter sequence by 300 bp for the construction of the gRNA promoter vector.

[0031] like Figure 1 As shown, the present invention obtained 44 MsU6 promoters from the alfalfa genome database, and constructed an evolutionary tree of the MsU6 promoter through bioinformatics analysis. The promoters were further divided into 17 groups according to the evolutionary tree, and the specific information is shown in Table 1.

[0032] Table 1 Consistency grouping of promoter evolutionary tree

[0033] Note: The underlined promoter is the candidate MsU6 promoter of the present invention. Because a single promoter cannot be sequenced, the “ / ” in the corresponding column of the consistency indicates that there is no data.

[0034] The nucleotide sequence of MsU6-3 is shown in SEQ ID NO.2, the nucleotide sequence of MsU6-20 is shown in SEQ ID NO.3, and the nucleotide sequence of MsU6-38 is shown in SEQ ID NO.4.

[0035] SEQ ID NO.2: CTAGTCTAAACACAAATTGCAATGCTCTACGTTGCTTTCATGGGTTTCAACTTTGAGGCTAATAATGTAAAAGAGAGGTTATATATCTAATTCTGTGAAGGGCACTATACAACACAATATAGTTGATGATTTATAAACTTTTGTATTAC TTTTACTTTAAAGTGACAACGAAAGGAGGGAAGAGGGTTCATTTCATGTTGGTAAGTAAGTGCGTTGTTTTAGTTTTGTAAATAGTCCCACATCGCTTAAATGAAAGAAATATACAGTGTTTATATAACGCTAGCGCCAGTGAATGGCTTG.

[0036] SEQ ID NO.3: CAGCAAAAATCAGGTTGGACTACCATAAGCAGCACCGCATATTACACTTAATGGGGTAAACTAGAACGAGCCACATCACCTCATTGGTTTGAGTACTGTGAGGGAGAGGGAGGAACTTCTTCACTACTCAACTCAACTCACTGAGAGTGA GAGTAAGATGCATGCACCTACCTCGGTTGCTTTCGCTGATTCCGGTGAATGTTGAGAAATAAATGTTATGTTTGCTTGCTATTAGTCCCACATCGCTTACATATTCTTAAGTTCTCATGTTTATATAATCTAGACGAACAACAGGGCTTG.

[0037] SEQ ID NO.4: GAACTAGTCCAAACCCAACAAGTTGCAATGCTCTATACGTAGATTTCATAGGTTTCAACTTTGAGGAAAGATTCCTAATAATGTAAAATGAGAGCTGAGGTATCTAATTGTGTGAAGGGCACTAGACAACACAATACAGTTGATGATTTC AAAACTTTTGTATTACTTAAAGTGACAACGAAGGGAGGGAAGAGGGTTCATTTCATGTTGGTAGTAAGTGCGTTGTTTTAGTTGTGAAAATAGTCCTACATTGAAACAAACATGGAATGTTTATATTACGCTAGCGCACTTCAACTAATG.

[0038] Example 2: Construction of gene editing vector S1. From the 17 groups of promoters in Table 1, candidate MsU6 promoters MsU6-1, MsU6-2, MsU6-3, MsU6-4, MsU6-5, MsU6-6, MsU6-11, MsU6-18, MsU6-20, MsU6-21, MsU6-22, MsU6-25, MsU6-27, MsU6-33, MsU6-35 and MsU6-38 were selected for experiment.

[0039] S2, Alfalfa FTa1 The gene can regulate the flowering of alfalfa. Mutation of this gene can delay the flowering period of alfalfa. FTa1 The nucleotide sequence of the gene is shown in SEQ ID NO.5; the nucleotide sequence of the MsU6 promoter selected in step S1 is respectively FTa1 The nucleotide sequence of the sgRNA of the gene and the nucleotide sequence of the gRNA scaffold are sequentially connected, specifically: the nucleotide sequence of the promoter selected in step S1 is sequentially combined with the nucleotide sequences of tRNA, sgRNA1, gRNA scaffold, tRNA, sgRNA2, and gRNA scaffold to synthesize fragments, and the synthetic fragment connected to the Arabidopsis thaliana AtU6 promoter is used as a control test. The synthetic fragment is synthesized by Nanjing GenScript Co., Ltd.; the nucleotide sequence of sgRNA1 is shown in SEQ ID NO.6, the nucleotide sequence of sgRNA2 is shown in SEQ ID NO.7, the nucleotide sequence of tRNA is shown in SEQ ID NO.8, and the nucleotide sequence of gRNAscaffold is shown in SEQ ID NO.9.

[0040] SEQ ID NO.5:

[0041] SEQ ID NO. 6: 5'-AATCAACCCAGAGTGAGTGT-3'.

[0042] SEQ ID NO.7: 5'-AGGTTGGTGACTGATATTCC-3'.

[0043] SEQ ID NO.8: AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTA CAGACCCGGGTTCGATTCCCGGCTGGTGCA.

[0044] SEQ ID NO.9: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCA ACTTGAAAAAGTGGCACCGAGTCGGTGC.

[0045] S3, respectively, the synthetic fragments obtained in step S2 are EcoR Ⅰ- EcoR The restriction site was connected to the expression vector pRGEB31 to obtain CRISPR / Cas9 gene editing vectors connected to different alfalfa promoters: MsU6-1-pRGEB31, MsU6-2-pRGEB31, MsU6-3-pRGEB31, MsU6-4-pRGEB31, MsU6-5-pRGEB31, MsU6-6-pRGEB31, MsU6-11-p At the same time, the synthetic fragment connected to the Arabidopsis thaliana AtU6 promoter was connected to the expression vector pRGEB31 to obtain the gene editing vector AtU6-pRGEB31.

[0046] Example 3: Detection of promoter editing efficiency 1. Hairy root genetic transformation The CRISPR / Cas9 gene editing vector connected to different alfalfa promoters and the gene editing vector AtU6-pRGEB31 constructed in Example 2 were respectively transferred into alfalfa using alfalfa hairy root genetic transformation technology to detect the gene editing efficiency of the promoter. The specific steps are as follows.

[0047] S1. Preparation of explants: Cultivate Zhongmu No. 1 seeds until they germinate, use sterile alfalfa seedlings that have germinated for two days as plant materials, and cut off 3 mm of the root tip with a scalpel.

[0048] S2. Preparation of Agrobacterium rhizogenes culture liquid: MsU6-1-pRGEB31, MsU6-2-pRGEB31, MsU6-3-pRGEB31, MsU6-4-pRGEB31, MsU6-5-pRGEB31, MsU6-6-pRGEB31, MsU6-11-pRGEB31, MsU6-18-pRGEB31, MsU6-20-pRGEB31, MsU6-21-pRGEB31, MsU6-22-pRGEB31, MsU6-25-pRGEB31, MsU6-27-pRGEB31, MsU6-3 3-pRGEB31, MsU6-35-pRGEB31, MsU6-38-pRGEB31 and AtU6-pRGEB31 were transferred into Agrobacterium rhizogenes Ar.1193 competent cells suitable for alfalfa hairy root transformation, amplified and cultured, and evenly spread on TY solid medium and cultured for 1 day, which can be used for seedling incision infection after the first root cutting; the preparation method of TY solid medium is as follows: weigh 5g of tryptone, 3g of yeast extract, and 15g of agar powder, dilute to 1L with water, and sterilize at 121℃ for 20min, then add 10mL of sterile 1M calcium chloride aqueous solution, mix and obtain TY solid medium.

[0049] S3, infection and co-cultivation: the explant obtained in step S1 is placed in the solid culture medium prepared in step S2, and the bacterial solution is dipped in a 1 / 4 MS culture medium without antibiotics and cultured at 24°C for 3 days, and then the explant is transferred to a 1 / 4 MS culture medium containing 2 mg / mL glufosinate ammonium and cultured until hairy roots grow; S4. Isolation and subculture of hairy roots: After 8 days, the agar on the hairy roots was thoroughly washed off under running water, and the roots were cut for the second time. The hairy roots cut from the explants were transferred to 1 / 4 MS medium containing 2 mg / mL glufosinate for subculture to obtain hairy root plants. Figure 2 shown.

[0050] 2. Verification of hairy root transformed plants Extracting the root DNA of the obtained hairy roots, using the DNA as a template, and designing amplification primers with sequences shown in SEQ ID NO.10 and SEQ ID NO.11; SEQ ID NO.10: 5'-TGGACAATGAGGAAAACGAGGAC-3'; SEQ ID NO. 11: 5'-TCTGGGTGGTCTGGTTCTCTCTG-3'.

[0051] The hairy root DNA was amplified using amplification primers, and the amplified product was subjected to high-throughput sequencing to obtain sequencing results.

[0052] 3. Sequencing results and analysis According to the amplification results and sequencing results of step 2, the gene editing efficiency of the promoter and the type of plant mutation were analyzed. Plant samples with obvious amplified bands were defined as positive seedlings, and plants with sgRNA1 and / or sgRNA2 mutations were defined as mutant plants after sequencing.

[0053] (1) Analysis results of gene editing efficiency and plant mutation types of Arabidopsis thaliana AtU6 promoter The gene editing efficiency of Arabidopsis thaliana AtU6 promoter was 69.7%. 23 of the 33 positive seedlings were mutated. The mutation types of the 23 mutant plants included single base mutation, 1bp~6bp base deletion and 1bp base insertion. As shown in Table 2, there were 21 plants with sgRNA1 mutation and 11 plants with sgRNA2 mutation.

[0054] Table 2 Editing efficiency of AtU6 in a single strain

[0055] (2) The editing efficiency results of the 16 selected alfalfa promoters are shown in Table 3.

[0056] Table 3 Editing efficiency of 16 promoters

[0057] According to the results in Table 3, the editing efficiencies of promoters MsU6-3, MsU6-20 and MsU6-38 all reached 100%. The high-throughput sequencing results of promoters MsU6-3, MsU6-20 and MsU6-38 were analyzed as follows.

[0058] The high-throughput sequencing results of MsU6-3 promoter are shown in Table 4. Among the 26 positive seedlings, there were 26 gene mutations, and the mutation efficiency was 100%. Among them, the mutation types included single base mutations, 1bp~6bp base deletions and 1bp base insertions. There were 26 plants with sgRNA1 mutations and 21 plants with sgRNA2 mutations.

[0059] Table 4 Editing efficiency of MsU6-3 in a single strain

[0060] The high-throughput sequencing results of MsU6-20 promoter are shown in Table 5. Among the 21 positive seedlings, the number of gene mutations was 21, and the mutation efficiency was 100%. The mutation types included single base mutations, 1bp~6bp base deletions, and 1bp base insertions. There were 21 plants with sgRNA1 mutations and 17 plants with sgRNA2 mutations.

[0061] Table 5 Editing efficiency of MsU6-20 in a single strain

[0062] The high-throughput sequencing results of MsU6-38 promoter are shown in Table 6. Among the 20 positive seedlings, the number of gene mutations was 20, and the mutation efficiency was 100%. The mutation types included single base mutations, 1bp~6bp base deletions, and 1bp base insertions. There were 19 plants with sgRNA1 mutations and 13 plants with sgRNA2 mutations.

[0063] Table 6 Editing efficiency of MsU6-38 in a single strain

[0064] Although preferred embodiments of the present invention have been described, additional changes and modifications may occur to these embodiments once those skilled in the art are aware of the basic inventive concepts.

[0065] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. An alfalfa U6 promoter for improving gene editing efficiency, characterized in that: The alfalfa U6 promoter for improving gene editing efficiency is MsU6-3 or MsU6-20 or MsU6-38; the nucleotide sequence of the MsU6-3 is shown in SEQ ID NO.2; the nucleotide sequence of the MsU6-20 is shown in SEQ ID NO.3; and the nucleotide sequence of the MsU6-38 is shown in SEQ ID NO.

4.

2. An application of the alfalfa U6 promoter for improving gene editing efficiency as described in claim 1 in improving the gene editing efficiency of the CRISPR / Cas9 system.

3. An application of the alfalfa U6 promoter for improving gene editing efficiency as claimed in claim 1 in improving alfalfa traits.

4. An application of the alfalfa U6 promoter for improving gene editing efficiency as claimed in claim 1 in alfalfa gene function research.

5. An application of the alfalfa U6 promoter for improving gene editing efficiency as claimed in claim 1 in alfalfa molecular breeding technology.

6. A gene editing vector, characterized in that: The gene editing vector carries the alfalfa U6 promoter MsU6-3 or MsU6-20 or MsU6-38 for improving gene editing efficiency as described in claim 1.

7. A method for constructing a gene editing vector according to claim 6, characterized in that: The construction method comprises the following steps: The nucleotide sequence of the alfalfa U6 promoter MsU6-3 or MsU6-20 or MsU6-38 for improving gene editing efficiency is sequentially connected with the sgRNA and gRNA scaffold nucleotide sequences of the gene to be edited to obtain a recombinant fragment; The recombinant fragment is connected to the expression vector to obtain the gene editing vector.

8. The method for constructing a gene editing vector according to claim 7, characterized in that: The expression vector is pRGEB31.

9. Use of the gene editing vector according to claim 6 in improving the efficiency of alfalfa gene editing.

10. Use of the gene editing vector according to claim 6 in improving the genetic transformation efficiency of alfalfa genes.

Images