Kit for detecting listeria monocytogenes and non-diagnostic purpose detection method

Abstract

The invention relates to the technical field of microbiological detection, in particular to a kit for detecting listeria monocytogenes and a non-diagnostic purpose detection method. According to the invention, the aptamer is coupled to the magnetic bead and is used for capturing the listeria monocytogenes. After incubation at room temperature for 1 hour, the captured listeria monocytogenes are directly used for DNA extraction. An RPA-Cas12a-LFA reaction is carried out at 37 DEG C for 30 min, and the reaction result is presented through color development of C and T lines of the test strip. In a complex food sample environment, Listeria monocytogenes can be detected from a labeled sample within 2 hours by combining aptamer functionalized magnetic bead enrichment treatment, and the minimum detected bacterial concentration is 1.35 CFU / mL. 16 food samples are detected, the result shows that the accuracy of the method reaches 100% and is consistent with that of qPCR detection, and the method is suitable for rapid screening and on-site detection of the listeria monocytogenes in the food.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial detection, and in particular to a kit for detecting Listeria monocytogenes and a detection method for non-diagnostic purposes. Background Art

[0002] Listeria monocytogenes is a common foodborne psychrophilic bacteria and a zoonotic pathogen. Infection can cause the highly dangerous listeriosis, with symptoms including sepsis, meningitis, and often accompanied by diarrhea, vomiting and fever. The bacteria is widely present in food processing, distribution and retail environments, and its psychrophilic growth characteristics further increase the difficulty of management and monitoring. Therefore, a rapid, sensitive and easy-to-use on-site detection technology is urgently needed to ensure food safety and public health.

[0003] In addition, in order to further improve the sensitivity and specificity of bacterial detection in complex food samples, and to separate, concentrate and purify target bacteria from food samples, aptamer-based systems have been reported as a reliable method for capturing target pathogens. Aptamers are artificially synthesized oligonucleotides that bind to a wide range of targets through their three-dimensional structure and intermolecular hydrogen bonds. Compared with traditional antibodies, aptamers have high selectivity, stability, multi-target binding and easy synthesis capabilities. Based on the above characteristics, aptamers have been widely used in the field of biological detection and diagnosis. For Listeria monocytogenes, several nucleic acid aptamers with high binding specificity have been identified, such as LLO-3 targeting listeriolysin O, NPC-aptamer targeting Listeria monocytogenes invasive protein endotoxin A, and four aptamers LM6-2, LM6-116, LM12-6, and LM12-13 targeting the surface of Listeria monocytogenes. Enrichment technology based on these aptamers provides a new solution for the separation and detection of target pathogens in complex samples. Therefore, it is necessary to provide efficient and sensitive Listeria monocytogenes detection. Summary of the invention

[0004] In order to solve the above problems, the present invention provides a kit for detecting Listeria monocytogenes and a detection method for non-diagnostic purposes. The present invention has the advantages of high sensitivity, strong specificity, and simple operation. It provides a low-cost and efficient on-site detection solution for the field of food safety, and at the same time shows the potential to be expanded to the detection of other pathogens.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides an aptamer combination for capturing Listeria monocytogenes, including a LMCA2 aptamer, a LMCA26 aptamer and an A15 aptamer;

[0007] The nucleotide sequence of the LMCA2 aptamer is shown in SEQ ID No. 1;

[0008] The nucleotide sequence of the LMCA26 aptamer is shown in SEQ ID No. 2;

[0009] The nucleotide sequence of the A15 aptamer is shown in SEQ ID No.3.

[0010] The present invention also provides a kit for detecting Listeria monocytogenes, comprising aptamer-functionalized magnetic beads, RPA solution, CRISPR / Cas12a solution and Cas12a chromatography test strips;

[0011] The aptamer-functionalized magnetic beads are loaded with the aptamer combination described in the above technical solution;

[0012] The system of the RPA solution is: 2.95 μL of buffer, 1.12 μL of DEPC water, 0.24 μL of 10 μM upstream and downstream primers, 0.25 μL of 280 mM magnesium acetate, and 1 / 10 tube of RPA enzyme;

[0013] The system of the CRISPR / Cas12a solution is: 5 μL of 12a buffer, 2 μL of 1 μM LbCas12a protein, 2 μL of 1 μM crRNA, 1 μL of 100 nM dual-labeled probe, and 15 μL of DEPC water.

[0014] Preferably, the method for preparing the aptamer functionalized magnetic beads comprises the following steps: denaturing and cooling the aptamer solution to obtain a reaction solution;

[0015] The reaction solution is mixed with streptavidin immunomagnetic beads and incubated to obtain aptamer functionalized magnetic beads.

[0016] Preferably, the nucleotide sequence of the upstream primer in the RPA solution is shown as SEQ ID No.4, and the nucleotide sequence of the downstream primer is shown as SEQ ID No.5.

[0017] Preferably, the nucleotide sequence of crRNA in the CRISPR / Cas12a solution is shown in SEQ ID No.6.

[0018] Preferably, the nucleotide sequence of the dual-labeled probe in the CRISPR / Cas12a solution is 5'-Bio-TCCCCCCT-FAM-3'.

[0019] The present invention also provides a method for detecting Listeria monocytogenes for non-diagnostic and non-therapeutic purposes, comprising the following steps:

[0020] 1) Pre-treating the sample to obtain a sample to be tested;

[0021] 2) mixing the sample to be tested obtained in step 1) with a solution containing the aptamer-functionalized magnetic beads in the kit described in the above technical solution, and incubating to obtain a complex;

[0022] 3) extracting the DNA of the complex obtained in step 2), mixing the DNA with the RPA solution in the kit described in the above technical solution, and reacting the mixture to obtain a reactant;

[0023] 4) mixing the reactant obtained in step 3) with the CRISPR / Cas12a solution in the kit described in the above technical solution and continuing the reaction to obtain a continued reactant;

[0024] 5) mixing the continued reaction product obtained in step 4) with a sample loading buffer to obtain a mixed solution;

[0025] 6) placing the test strip in the kit described in the above technical solution into the mixed solution described in step 5), and detecting whether the sample contains Listeria monocytogenes based on the color development of the T line and the C line on the test strip.

[0026] Preferably, the pretreatment method in step 1) comprises: adding 9 mL of sterile water to 1 g of sample for homogenization and grinding, and taking the supernatant;

[0027] In the step 2), the volume ratio of the sample to be tested to the solution containing aptamer-functionalized magnetic beads is 1:0.05; the concentration of aptamer-functionalized magnetic beads in the solution is 10 mg / mL; the incubation time is 40 minutes, and the temperature is 20-30° C.

[0028] Preferably, in step 3), the volume ratio of DNA to RPA solution is 0.2:4.8; the reaction temperature is 37° C. and the reaction time is 15 min;

[0029] In the step 4), the volume ratio of the CRISPR / Cas12a solution to the RPA solution is 5:1; the temperature of the continued reaction is 37° C. and the time is 15 min.

[0030] Preferably, in step 5), the volume ratio of the sample loading buffer to the CRISPR / Cas12a solution is 4:5;

[0031] In step 6), the test strip is placed in the mixed solution for 2 minutes.

[0032] Beneficial effects of the present invention:

[0033] The present invention has developed a method (LM-Cas12a-LFA) for efficient and accurate detection of Listeria monocytogenes using aptamer-functionalized magnetic beads, RPA isothermal amplification, and CRISPR / Cas12a technology. The method couples the aptamer to the magnetic beads for capturing Listeria monocytogenes. After incubation at room temperature for 1 hour, the captured Listeria monocytogenes is directly used for DNA extraction. Subsequently, the RPA-Cas12a-LFA reaction is carried out at 37°C for 30 minutes, and the reaction results are presented by the C and T lines of the test strip. This method can complete the extraction of the bacterial genome to the reading of the test results within 60 minutes, with a sensitivity of 1×10 -10 ng / μL. In a complex food sample environment, combined with aptamer-functionalized magnetic beads enrichment treatment, Listeria monocytogenes can be detected from spiked samples within 2 h, and the lowest bacterial concentration detected is 1.35×10 0 CFU / mL. The results of testing 16 food samples showed that the method was 100% accurate, consistent with qPCR detection, and suitable for rapid screening and on-site detection of Listeria monocytogenes in food. In summary, the LM-Cas12a-LFA method is efficient, sensitive and convenient, providing a reliable tool for food safety monitoring of Listeria monocytogenes. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0035] Figure 1 Schematic diagram of aptamer functionalized magnetic beads enrichment;

[0036] Figure 2 This is the schematic diagram of the RPA-Cas12a-LFA reaction;

[0037] Figure 3 is the capture efficiency of aptamer functionalized magnetic beads (%). Note: A is the capture efficiency of different aptamers and mixed aptamers at a bacterial concentration of 1.35×10 1 CFU / mL capture efficiency determination, B is the capture efficiency determination of mixed aptamers for target bacteria at different concentrations;

[0038] Figure 4 This is a diagram for verifying the principle of RPA-Cas12a-LFA reaction;

[0039] Figure 5 The results of RPA-Cas12a-LFA reaction condition optimization are shown in Figure 1. A is probe concentration optimization 1: probe concentration 10 μM 2: probe concentration 1 μM 3: probe concentration 100 nM; B is reaction time optimization 1: reaction time 10 min 2: reaction time 15 min 3: reaction time 20 min 4: reaction time 30 min;

[0040] Figure 6 For the specific determination of LM-Cas12a-LFA method, Note: 1: Listeria monocytogenes 2: Klebsiella pneumoniae 3: Shigella flexneri 4: Yersinia enterocolitica 5: DEPC water;

[0041] Figure 7 The sensitivity and spiked sample determination of LM-Cas12a-LFA method. Note: A is the sensitivity determination 1: the genome concentration is 1×10 -8 ng / μL 2: Genome concentration is 1×10 -9 ng / μL 3: Genome concentration is 1×10 -10 ng / μL4: genome concentration is 1×10 -11 ng / μL 5: Water B is spiked sample 1: Bacterial concentration is 1.35×10 5 CFU / mL 2: Bacterial concentration is 1.35×10 3 CFU / mL 3: Bacterial concentration is 1.35×10 1 CFU / mL 4: Bacterial concentration is 1.35×10 0 CFU / mL 5: Bacterial concentration is 1.35×10 -1 CFU / mL;

[0042] Figure 8 The qPCR method and LM-Cas12a-LFA method were used to determine Listeria monocytogenes in actual samples. Note: A is for qPCR detection and B is for LM-Cas12a-LFA detection. DETAILED DESCRIPTION

[0043] The present invention provides an aptamer combination for capturing Listeria monocytogenes, including a LMCA2 aptamer, a LMCA26 aptamer and an A15 aptamer;

[0044] The nucleotide sequence of the LMCA2 aptamer is shown in SEQ ID No. 1;

[0045] The nucleotide sequence of the LMCA26 aptamer is shown in SEQ ID No. 2;

[0046] The nucleotide sequence of the A15 aptamer is shown in SEQ ID No.3.

[0047] SEQ ID No.1:

[0048] ATACCAGCTTATTCAATTCCAAAAGCGCACCCATATATGTTCTATGTCCCCCACCTCGAGATTGCACTTACTATCT;

[0049] SEQ ID No.2:

[0050] ATACCAGCTTATTCAATTCGATGGGGATTACTTATCATGAGAAACCAGCAGCATTTGAGATTGCACTTACTATCT;

[0051] SEQ ID No.3:

[0052] GGGAGCTCAGAATAAACGCTCAATACTATCGCGGAGACAGCGGGAGGCACCGGGGA-TTCGACATGAGGCCCGGATC.

[0053] The present invention provides a kit for detecting Listeria monocytogenes, including aptamer functionalized magnetic beads, RPA solution, CRISPR / Cas12a solution and Cas12a chromatography test strips; the aptamer functionalized magnetic beads are loaded with the aptamer combination described in the above technical scheme; the system of the RPA solution is: buffer 2.95μL, DEPC water 1.12μL, 10μM upstream and downstream primers 0.24μL each, 280mM magnesium acetate 0.25μL and RPA enzyme 1 / 10 tube; the system of the CRISPR / Cas12a solution is: 12abuffer 5μL, 1μM LbCas12a protein 2μL, 1μM crRNA 2μL, 100nM double-labeled probe 1μL and DEPC water 15μL. The present invention does not specifically limit the source of the Cas12a chromatography test strips, and conventional commercially available products can be used, such as JY0301 of tiosbio. The present invention has no special limitation on the amount of each component in the kit, and the amount can be based on conventional kits.

[0054] In the present invention, the preparation method of the aptamer functionalized magnetic beads preferably comprises the following steps: denaturing and cooling the aptamer solution to obtain a reaction solution; the concentrations of the LMCA2 aptamer, LMCA26 aptamer and A15 aptamer in the aptamer solution are all 10 nM; mixing and incubating the reaction solution with streptavidin immunomagnetic beads to obtain aptamer functionalized magnetic beads. In the present invention, the denaturation temperature is 95°C and the time is 5 minutes, and the present invention preferably cools on ice for 5 minutes.

[0055] In the present invention, the nucleotide sequence of the upstream primer in the RPA solution is shown as SEQ ID No.4, and the nucleotide sequence of the downstream primer is shown as SEQ ID No.5, which are specifically as follows:

[0056] SEQ ID No.4:

[0057] CCTAACATATCCAGGTGCTCTCG;

[0058] SEQ ID No.5:

[0059] TCTTTCCACTAATGTATTTACTGCGT.

[0060] In the present invention, the nucleotide sequence of crRNA in the CRISPR / Cas12a solution is shown in SEQ ID No. 6, specifically as follows:

[0061] UAAUUUCUACUAAGUGUAGAUCCAGGAAUGACUAAUCAAGA.

[0062] In the present invention, the nucleotide sequence of the dual-labeled probe in the CRISPR / Cas12a solution is as follows:

[0063] 5′-Bio-TCCCCCCT-FAM-3′.

[0064] The present invention provides a method for detecting Listeria monocytogenes for non-diagnostic and non-therapeutic purposes, comprising the following steps:

[0065] 1) Pre-treating the sample to obtain a sample to be tested;

[0066] 2) mixing the sample to be tested obtained in step 1) with a solution containing the aptamer-functionalized magnetic beads in the kit described in the above technical solution, and incubating to obtain a complex;

[0067] 3) extracting the DNA of the complex obtained in step 2), mixing the DNA with the RPA solution in the kit described in the above technical solution, and reacting the mixture to obtain a reactant;

[0068] 4) mixing the reactant obtained in step 3) with the CRISPR / Cas12a solution in the kit described in the above technical solution and continuing the reaction to obtain a continued reactant;

[0069] 5) mixing the continued reaction product obtained in step 4) with a sample loading buffer to obtain a mixed solution;

[0070] 6) placing the test strip in the kit described in the above technical solution into the mixed solution described in step 5), and detecting whether the sample contains Listeria monocytogenes based on the color development of the T line and the C line on the test strip.

[0071] The present invention pre-treats the sample to obtain a sample to be tested. The present invention has no special limitation on the source of the sample. In the present invention, the pre-treatment method preferably comprises: adding 9 mL of sterile water to 1 g of the sample for homogenization and grinding, and taking the supernatant.

[0072] The present invention mixes the obtained sample to be tested with a solution containing the aptamer-functionalized magnetic beads in the kit described in the above technical solution, and obtains a complex after incubation. In the present invention, the volume ratio of the sample to be tested to the solution containing the aptamer-functionalized magnetic beads is preferably 1:0.05. In the present invention, the concentration of the aptamer-functionalized magnetic beads in the solution is preferably 10 mg / mL. In the present invention, the incubation time is preferably 40 minutes, and the temperature is preferably 20 to 30°C.

[0073] The DNA of the complex obtained by the present invention is extracted, and the DNA is mixed with the RPA solution in the kit described in the above technical solution, and reacted to obtain a reactant. In the present invention, the volume ratio of the DNA to the RPA solution is preferably 0.2:4.8. In the present invention, the temperature of the reaction is preferably 37°C, and the time is preferably 15min.

[0074] The present invention further reacts the obtained reactant after mixing with the CRISPR / Cas12a solution in the kit described in the above technical solution to obtain a continued reactant. In the present invention, the volume ratio of the CRISPR / Cas12a solution to the RPA solution is preferably 5:1. In the present invention, the temperature of the continued reaction is preferably 37°C and the time is preferably 15min.

[0075] The present invention mixes the obtained continued reaction product with the loading buffer to obtain a mixed solution. In the present invention, the volume ratio of the loading buffer to the CRISPR / Cas12a solution is preferably 4:5. In the present invention, the solvent of the loading buffer is water, containing 6% BSA and 0.4% tween-2 by mass percentage.

[0076] The present invention places the test strip in the kit described in the above technical solution into the mixed solution, and detects whether the sample contains Listeria monocytogenes according to the color development of the T line and the C line on the test strip. In the present invention, the time for the test strip to be placed in the mixed solution is preferably 2 minutes.

[0077] In order to further illustrate the present invention, the present invention is described in detail below in conjunction with embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0078] Example 1

[0079] 1. Materials and Methods

[0080] 1.1 Materials

[0081] Primers and adapters were synthesized by Comate Bioscience (Jilin, China), and biotinylated at the 5' end of the adapter. LbCas12a protein, ssDNA reporter gene, and crRNA were purchased from Bio-lifes ci (Guangzhou, China). NEBuffer 3.1 was purchased from New England Biolabs (New England, USA). TwistAmp Basic Kit was purchased from TwistDx (Hertfordshire, AL, UK). 2×M5Hi per Realtime PCR Super Mix was purchased from Mei5bio (Beijing, China). Streptavidin (SAV) MagBeads were purchased from Yeasen Biotechnology (Shanghai, China).

[0082] 1.2 Bacterial culture

[0083] The present invention uses Listeria monocytogenes standard strain ATCC19115 and three other strains (Klebsiella pneumoniae, Shigella fulvei, Yersinia enterocolitica), all of which are purchased conventionally and stored in the laboratory. All strains are inoculated in LB medium, shaken at 37°C and 150r / min overnight.

[0084] 1.3 Primer design and aptamer screening

[0085] The primers used in the present invention are derived from the design and verification of the previous research of this research group, and their specificity and reliability have been proved in relevant experiments. Three nucleic acid aptamers (LMCA2, LMCA26 and A15) with high binding affinity to Listeria monocytogenes were selected through literature screening, and the capture efficiency of these aptamers alone and the mixture of the three aptamers was measured.

[0086] Table 1 Primer, crRNA and aptamer sequence information

[0087]

[0088]

[0089] 1.4 Preparation of aptamer-functionalized magnetic beads

[0090] Take 50 μL of each of the three 10 nM aptamers. When the three aptamers are mixed at the same time, the total volume is 150 μL, and the concentration of each aptamer is 3.33 nM. Denature at 95 ° C for 5 minutes, cool on ice for 5 minutes, and mix with 1 mg Streptavidin (SAV) MagBeads streptavidin (SAV) immunomagnetic beads that have been washed three times and the supernatant removed after the reaction. Incubate at room temperature for 40 minutes by rotating and mixing, and then place the EP tube on a magnetic rack. After carefully removing the supernatant, the obtained aptamer functionalized magnetic beads are washed three times in 1× TBS, and each time they are concentrated with a magnetic rack and the supernatant is removed. After the final wash, the aptamer functionalized magnetic beads are resuspended in 100 μL of TES binding solution (magnetic bead concentration is 10 mg / mL) and stored at room temperature. The interaction between biotin and streptavidin is very stable under non-denaturing conditions. Therefore, the prepared aptamer functionalized magnetic beads do not need to be studied for shelf life and can be directly used in subsequent experiments.

[0091] 1.5 Determination of capture efficiency of aptamer-functionalized magnetic beads and extraction of bacterial genome

[0092] After the freshly cultured Listeria monocytogenes was gradiently diluted, 50 μL of aptamer-functionalized magnetic beads were mixed with 1 mL of Listeria monocytogenes bacterial suspension for incubation, and incubated with gentle rotation at room temperature for 40 min. Then, the successfully captured Listeria monocytogenes was magnetically enriched using a magnetic rack, and the unbound bacterial supernatant was removed. The supernatant was removed by washing three times with TBS, and finally the magnetic bead-aptamer-Listeria monocytogenes complex was resuspended in 200 μL of PBS. The principle is as follows: Figure 1 .

[0093] To determine the capture efficiency, all 200 μL of the magnetic bead-aptamer-Listeria monocytogenes complex was spread on a solid LB plate for counting and cultured for 24 h. At the same time, 1 mL of Listeria monocytogenes without enrichment was used as a control group for counting. The capture rate was calculated by dividing the total CFU of the capture group by the total CFU of the control group and multiplying it by 100%. The experiment was repeated three times, and the results were presented as the mean.

[0094] After enrichment, DNA was extracted by boiling, and the magnetic bead-aptamer-Listeria monocytogenes complex was centrifuged at 12000r / min for 2 minutes, and the supernatant was discarded. The precipitate was washed with 500μL sterile PBS. The complex was then resuspended in DEPC water, boiled for 15 minutes, and immediately frozen at -20°C for 5 minutes. The bacterial solution was then centrifuged at 12,000r / min for 2 minutes. The supernatant was used as a reaction template for the subsequent RPA-Cas12a-LFA reaction.

[0095] 1.6 RPA-Cas12a-LFA one-step assay reaction

[0096] Integrating the RPA reaction with the CRISPR / Cas12a cleavage reaction in the same container can effectively avoid contamination caused by secondary loading and reduce the false positive rate. During the experiment, the RPA system was placed at the bottom of the EP tube, and the Cas12a system was placed on the EP tube cap (Table 2). After reacting at 37 ° C for 15 minutes, the Cas12a system on the EP tube cap was unscrewed and reacted with the amplified DNA template for 15 minutes. After the reaction, 20 μL of loading buffer was added, the test strip was placed in the EP tube, and it was allowed to stand for 2 minutes to ensure that the liquid chromatography was complete.

[0097] Table 2 RPA-Cas12a-LFA one-step reaction components

[0098]

[0099] After the Cas12a system reaction is completed, the biotin and FAM double-labeled single-stranded DNA probe is cut, the FAM-labeled probe binds to the FAM antibody modified with gold nanoparticles, and chromatographs to the T line, where it will bind to the secondary antibody coated on the T line, thereby causing the T line to develop color; if the sample to be detected does not contain the target gene, RPA has no amplified product, Cas12a cannot exert enzyme cleavage activity, the biotin and FAM double-labeled single-stranded DNA probe is intact, and binds to the FAM antibody modified with gold nanoparticles to form a complex, and chromatographs to the C line where it will bind to the coated avidin, causing the C line to develop color; if the amount of the target gene in the sample is insufficient, it is between the two, and both the T / C lines are colored ( Figure 2 ). By the color development, determine whether the sample contains the target bacteria and its content.

[0100] 1.7 Optimization of RPA-Cas12a-LFA reaction system

[0101] The total volume of the RPA reaction system is 5 μL, including 2.95 μL of buffer, 1.12 μL of DEPC water, 0.24 μL of 10 μM upstream and downstream primers, 0.2 μL of genomic template, 1 / 10 tube of freeze-dried enzyme particles (5 μg of freeze-dried powder enzyme per tube), and 0.25 μL of 280 mM magnesium acetate (MgOAc). The total volume of the Cas12a reaction system includes 25 μL, including 5 μL of 12a buffer, 2 μL of 1 μM LbCas12a protein, 2 μL of 1 μM crRNA, 1 μL of 100 nM dual-labeled probe, and 15 μL of DEPC water.

[0102] In order to maximize the efficiency and sensitivity of the detection, the reaction system was optimized. Optimization was performed in terms of probe concentration (10 μM, 1 μM, 100 nM) and Cas12a reaction time (10, 15, 20, and 30 min).

[0103] 1.8 Specificity, sensitivity and concentration determination of spiked samples of LM-Cas12a-LFA detection method

[0104] To evaluate the specificity of the method, three other bacterial strains (i.e., Klebsiella pneumoniae, Shigella flexneri, and Yersinia enterocolitica) were used to evaluate the specificity, with Listeria monocytogenes as the positive group. DNA was extracted after culturing the Listeria monocytogenes strain using aptamer-functionalized magnetic beads enrichment, and DNA was extracted using a DNA extraction kit after culturing the other strains. After extraction, all strains were analyzed using the LM-Cas12a-LFA detection method.

[0105] In order to evaluate the sensitivity of the method, the DNA extracted after enrichment was diluted in series. The Listeria monocytogenes genome template used for sensitivity detection was quantified and diluted in series to prepare genome concentrations of 1×10 -8 ng / μL, 1×10 -9 ng / μL, 1×10 -10 ng / μL, 1×10 -11 ng / μL, water, and the above genome was prepared and analyzed using the LM-Cas12a-LFA detection method.

[0106] In order to better test the effect of LM-Cas12a-LFA in meat food matrix, raw pork was selected for spiking. The colony count of the cultured bacterial solution was performed and the bacterial solution was gradiently diluted to 1.35×10 5 CFU / mL, 1.35×10 3 CFU / mL, 1.35×10 1 CFU / mL, 1.35×10 0 CFU / mL, 1.35×10 -1 CFU / mL. Each 1g of raw pork sample was evenly added to 1mL of diluted bacterial solution of different concentrations for homogenization, and 8mL of physiological saline solution was added respectively. The mixed solution was enriched with aptamer-functionalized magnetic beads, and DNA was extracted. The genome extracted after the above operation was used to evaluate the sensitivity of the LM-Cas12a-LFA method for the determination of spiked samples.

[0107] 1.9 Actual sample determination of LM-Cas12a-LFA detection method

[0108] For actual sample testing, 16 pork samples (collected from commercially available meat samples at different times) stored in the laboratory were processed and first enriched with aptamer-functionalized magnetic beads for Listeria monocytogenes. After DNA was extracted, qPCR and LM-Cas12a-LFA were used for simultaneous analysis. The positive rate and consistency rate of the two methods were analyzed.

[0109] 2. Results

[0110] 2.1 Determination of capture efficiency of aptamer-functionalized magnetic beads

[0111] 50 μL of aptamer-functional magnetic beads and 1 mL of 10-fold serial dilutions of Listeria monocytogenes (ranging from 1.35 × 10 4 to 1.35×10 1 CFU / mL). After each dilution, the capture efficiency was calculated by comparing the number of successfully captured L. monocytogenes cells with the number of L. monocytogenes cells in the control group. 1 The capture efficiency of CFU / mL was higher than that of a single aptamer. 4 From 1.35×10 CFU / mL to 1.35×10 CFU / mL, the capture efficiency of the mixed aptamer functional magnetic beads increased with the decrease of bacterial concentration, and the capture rate increased from 53.94% to 85.92%. This phenomenon shows that the mixed aptamer functional magnetic beads are more suitable for enrichment and detection of Listeria monocytogenes under low concentration conditions, especially showing strong enrichment ability in complex food samples. This technology provides a reliable tool for the efficient detection of low-concentration Listeria monocytogenes, and subsequent experiments were carried out with mixed aptamer functional magnetic beads.

[0112] 2.2RPA-Cas12a-LFA one-step assay

[0113] The RPA-Cas12a-LFA system was configured according to Table 2 for one-step determination. In order to verify the feasibility of the system, the RPA-Cas12a-LFA one-step determination was performed using water, low-concentration target genes, and high-concentration target genes as templates.

[0114] First, water was added as a blank control, which failed to activate the trans-cleavage activity of Cas12a / crRNA, the probe was not cut, and the test strip showed C line color; adding the target to verify that the Hly gene has the trans-cleavage activity to activate Cas12a / crRNA, the probe was cut and released a fluorescent signal, and the test strip showed T line color, which proved the feasibility of the CRISPR-Cas12a / crRNA gene recognition system. When the concentration of Listeria monocytogenes is low, the trans-cleavage activity of the CRISPR system is low, the color of the C line of the test strip is weakened, and the T line is shown. Through the color of the C and T lines shown by the concentration change, this method can achieve semi-quantitative detection, and the principle verification is as follows Figure 4 .

[0115] 2.3 Optimization of RPA-Cas12a-LFA reaction system

[0116] In order to maximize the efficiency and sensitivity of the detection, the reaction system was optimized. The optimization was carried out in two aspects: probe concentration (10μM, 1μM, 100nM) and Cas12a reaction time (10, 15, 20 and 30min). Under the optimized conditions, the LM-Cas12a-LFA detection method showed the effect of T line brightness on probe concentration. When the probe concentration was 100nM, the T line reached the most obvious color development ( Figure 5 The Cas12a reaction time reaches a more obvious T line color at 15 minutes, and there is no obvious change when the time is extended to 20 minutes and 30 minutes ( Figure 5 In Figure B), considering that the detection time should be the shortest onset time, the Cas12a reaction time is determined to be 15 minutes.

[0117] The final optimization result was a probe concentration of 100 nM and a reaction time of 15 min. Under the optimized conditions of primer concentration and time, the RPA preamplification and CRISPR / Cas12a detection temperatures were the same, which avoided the temperature change of the adjustment equipment.

[0118] 2.4 Specificity, sensitivity and concentration determination of spiked samples of LM-Cas12a-LFA detection method

[0119] The three non-target strains and the control group (Klebsiella pneumoniae, Shigella flexneri, Yersinia enterocolitica and DEPC water) did not show T-line color. Listeria monocytogenes showed T-line color after detection ( Figure 6 ). This indicates that the LM-Cas12a-LFA method has good specificity for the detection of Listeria monocytogenes.

[0120] The sensitivity of the assay was evaluated using serial dilutions of the genome. -8 ng / μL, 1×10 -9 ng / μL, 1×10 - 10 ng / μL, the three experimental groups using the LM-Cas12a-LFA method all showed obvious color development of the T line, while 1×10 -11 ng / μL, the T line had no obvious color development, and the results showed that the detection limit was 1×10 -10 ng / μL( Figure 7 (A).

[0121] The sensitivity of the spiked sample assay of the LM-Cas12a-LFA assay was evaluated using the genome extracted after enrichment with aptamer-functionalized magnetic beads. 5 CFU / mL, 1.35×10 3 CFU / mL, 1.35×10 1 CFU / mL, 1.35×10 0The four experimental groups corresponding to CFU / mL showed obvious color development using the LM-Cas12a-LFA method. 1 CFU / mL, 1.35×10 0 At the two concentrations of CFU / mL, the C and T lines were colored and light, but at 1.35×10 -1 The T line showed no obvious color at the CFU / mL concentration, which showed obvious differences. The results showed that in the actual sample, the spike detection limit was 1.35×10 0 CFU / mL( Figure 7 (B).

[0122] Semi-quantitative detection can be achieved based on the color development of C and T lines. When C and T lines are colored at the same time, the gene concentration is 10 -10 ~10 -11 ng / μL, bacterial concentration 10 -1 ~10 -3 CFU / mL.

[0123] 2.5 Application of LM-Cas12a-LFA in actual sample detection

[0124] For the detection of Listeria monocytogenes, aptamer-functionalized magnetic beads were first used to enrich Listeria monocytogenes. After DNA extraction, qPCR and LM-Cas12a-LFA methods were used to simultaneously analyze 16 meat samples previously stored in the laboratory. The results of qPCR and LM-Cas12a-LFA were compared. The LM-Cas12a-LFA method accurately identified that 4 of the 16 pork samples contained Listeria monocytogenes, which was 100% consistent with the qPCR method.

[0125] 3 Discussions

[0126] Listeria monocytogenes is an important foodborne zoonotic pathogen. Humans are usually infected with listeriosis by eating contaminated food. The elderly, immunocompromised people, pregnant women and newborns are the main susceptible groups, and they are prone to develop serious diseases such as sepsis or meningitis after infection. It is reported that Listeria monocytogenes can survive and grow in different adverse environments such as acidic pH, high salt concentration and refrigerated environment. In recent years, the number of reports of infection with Listeria monocytogenes in China has been on the rise, and the World Health Organization (WHO) has listed it as an important foodborne pathogen after Escherichia coli O157, Salmonella and Shigella.

[0127] The currently reported methods for detecting Listeria monocytogenes mainly include the national standard culture method (GB 4789.30-2016) and the method based on nucleic acid amplification (PCR). At present, the national standard for detecting Listeria monocytogenes in my country still uses the traditional biochemical identification method, which requires the sample to be enriched and screened with selective culture media. The method is not only complicated to operate, but also time-consuming (2 to 3 days) and has low sensitivity. However, it has high accuracy and almost no false positive results, and can be used as a gold standard. In contrast, although the sensitivity and efficiency of various PCR-based methods have been significantly improved, they require expensive instruments and high-level operating technicians, which is not conducive to their use outdoors and in areas with scarce resources and technology.

[0128] In order to overcome the limitations of the above methods, emerging detection technologies have emerged, such as CRISPR / Cas12a technology. CRISPR / Cas12a is an emerging new detection method that is simple, specific, and suitable for on-site detection. This method is based on Cas12a protein and has dual nucleases that can catalyze its own CRISPR RNA (crRNA) maturation, target recognition, and DNA cleavage. In the CRISPR nucleic acid detection method, nucleic acid amplification is a crucial step, among which RPA technology shows great potential in low-resource environments. In our study, the RPA volume was optimized to one-tenth of the original solution, which significantly reduced the detection cost and made it possible for resource-limited areas to adopt this on-site amplification detection system.

[0129] In addition, various detection methods usually need to extend the detection time to achieve a lower detection limit to ensure signal strength and accuracy. In order to achieve more efficient detection of target bacteria, it is urgent to develop a method that can quickly enrich bacteria so that the target sample can reach the detection limit in a short time, thereby supporting the smooth implementation of subsequent detection. In recent years, aptamer-based systems have been widely reported as reliable tools for capturing target pathogens. Studies have screened out a variety of ssDNA aptamers with high binding specificity to Listeria monocytogenes.

[0130] However, due to differences in experimental design (such as screening procedures and the growth stage of target bacteria), these studies often generate candidate aptamers with very different characteristics, but it is precisely because of these differences that the combined use of multiple aptamers has higher detection efficiency and a wider capture spectrum for target cells than a single aptamer. Studies have shown that aptamers with different binding modes tend to have synergistic effects on the recognition of complex target cells. Therefore, a group of combinations of aptamers were used in this study to improve the capture efficiency and capture spectrum, thereby improving the LOD of LM-Cas12a-LFA detection. In this experiment, the capture efficiency of the complex aptamer is generally higher than that of a single aptamer reported in the past. It is speculated that due to the use of multiple aptamers, the complex aptamer can improve the capture rate by binding to multiple targets. As demonstrated in this experiment, Figure 4 It shows that when multiple aptamers are mixed, the capture rate is higher than that of a single aptamer, and as the concentration of target cells decreases, the capture rate of aptamer functional magnetic beads gradually increases. This finding is consistent with previous studies.

[0131] Based on the above research, the experiment used aptamers to construct a LM-Cas12a-LFA chromatography lateral flow test strip method based on aptamer functional magnetic bead enrichment and combined with RPA isothermal amplification. This method is simple, rapid, sensitive, specific, and accurate. By optimizing the RPA system, the experimental cost is further reduced. The whole process of this method does not require large instruments and complex temperature changes. The results can be interpreted by the color development of the C and T lines of the test strip, which is suitable for on-site detection. This method can complete the process from bacterial genome extraction to test result reading within 60 minutes, with a sensitivity of 1×10 -10 ng / μL. In a complex food sample environment, combined with aptamer-functionalized magnetic beads enrichment treatment, Listeria monocytogenes can be detected from spiked samples within 2 h, with a detection limit of 1.35×10 0 CFU / mL. Semi-quantitative detection can be achieved based on the color development of the C and T lines. When the C and T lines develop color at the same time, the gene concentration is 10 -10 ~10 -11 ng / μL, bacterial concentration 10 -1 ~10 -3 CFU / mL.

[0132] In addition, the experiment also evaluated the feasibility of the established method in detecting actual samples. The qPCR method and the established LM-Cas12a-LFA method were used to analyze the actual samples at the same time, and the result consistency rate was 100%, proving that the LM-Cas12a-LFA method has strong reliability in detecting Listeria monocytogenes, and compared with the equipment required for qPCR, it is portable, the procedure is simple, the detection time is short, and the sensitivity is high, which is superior to the traditional qPCR method.

[0133] In summary, the novel Listeria monocytogenes functionalized magnetic bead enrichment technology and detection method LM-Cas12a-LFA constructed in the present invention are expected to become an ideal method for detecting Listeria monocytogenes in food samples.

[0134] 4 Conclusion

[0135] The present invention constructs a functionalized magnetic bead enrichment technology and detection method LM-Cas12a-LFA for Listeria monocytogenes. The method reacts at 37°C for 30 minutes, and the reaction product is colored by the C and T lines of the test strip. The process from bacterial genome extraction to test result reading can be completed within 60 minutes, with a sensitivity of 1×10 -10ng / μL. In a complex food sample environment, combined with aptamer-functionalized magnetic beads enrichment treatment, Listeria monocytogenes can be detected from spiked samples within 2 h, with a detection limit of 1.35×10 0 CFU / mL. Sixteen food samples were tested for Listeria monocytogenes, and the accuracy of LM-Cas12a-LFA was 100% compared with qPCR detection. The results showed that this method can be used for rapid screening and on-site detection of Listeria monocytogenes in food samples.

[0136] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An aptamer combination for capturing Listeria monocytogenes, characterized in that: Including LMCA2 aptamer, LMCA26 aptamer and A15 aptamer; The nucleotide sequence of the LMCA2 aptamer is shown in SEQ ID No. 1; The nucleotide sequence of the LMCA26 aptamer is shown in SEQ ID No. 2; The nucleotide sequence of the A15 aptamer is shown in SEQ ID No.

3.

2. A kit for detecting Listeria monocytogenes, characterized in that: Includes aptamer-functionalized magnetic beads, RPA solution, CRISPR / Cas12a solution, and Cas12a chromatography test strips; The aptamer-functionalized magnetic beads are loaded with the aptamer combination of claim 1; The system of the RPA solution is: 2.95 μL of buffer, 1.12 μL of DEPC water, 0.24 μL of 10 μM upstream and downstream primers, 0.25 μL of 280 mM magnesium acetate, and 1 / 10 tube of RPA enzyme; The system of the CRISPR / Cas12a solution is: 5 μL of 12a buffer, 2 μL of 1 μM LbCas12a protein, 2 μL of 1 μM crRNA, 1 μL of 100 nM dual-labeled probe, and 15 μL of DEPC water.

3. The kit according to claim 2, characterized in that The preparation method of the aptamer functionalized magnetic beads comprises the following steps: denaturing and cooling the aptamer solution to obtain a reaction solution; the concentrations of the LMCA2 aptamer, the LMCA26 aptamer and the A15 aptamer in the aptamer solution are all 10 nM; The reaction solution is mixed with streptavidin immunomagnetic beads and incubated to obtain aptamer functionalized magnetic beads.

4. The kit according to claim 2, characterized in that The nucleotide sequence of the upstream primer in the RPA solution is shown in SEQ ID No.4, and the nucleotide sequence of the downstream primer is shown in SEQ ID No.

5.

5. The kit according to claim 2, characterized in that The nucleotide sequence of crRNA in the CRISPR / Cas12a solution is shown in SEQ ID No.

6.

6. The kit according to claim 2, characterized in that The nucleotide sequence of the dual-labeled probe in the CRISPR / Cas12a solution is 5'-Bio-TCCCCCCT-FAM-3'.

7. A method for detecting Listeria monocytogenes for non-diagnostic and non-therapeutic purposes, characterized in that: The following steps are involved: 1) Pre-treating the sample to obtain a sample to be tested; 2) mixing the sample to be tested obtained in step 1) with a solution containing the aptamer-functionalized magnetic beads in the kit according to claim 2, and incubating to obtain a complex; 3) extracting the DNA of the complex obtained in step 2), mixing and reacting the DNA with the RPA solution in the kit according to claim 2 to obtain a reactant; 4) mixing the reactant obtained in step 3) with the CRISPR / Cas12a solution in the kit according to claim 2 and continuing the reaction to obtain a continued reactant; 5) mixing the continued reaction product obtained in step 4) with a sample loading buffer to obtain a mixed solution; 6) placing the test strip in the kit of claim 2 into the mixed solution of step 5), and detecting whether the sample contains Listeria monocytogenes based on the color development of the T line and the C line on the test strip.

8. The detection method according to claim 7, characterized in that: The pretreatment method of step 1) comprises: adding 9 mL of sterile water to 1 g of sample for homogenization and grinding, and taking the supernatant; In the step 2), the volume ratio of the sample to be tested to the solution containing aptamer-functionalized magnetic beads is 1:0.05; the concentration of aptamer-functionalized magnetic beads in the solution is 10 mg / mL; the incubation time is 40 minutes, and the temperature is 20-30° C.

9. The detection method according to claim 7, characterized in that: In step 3), the volume ratio of DNA to RPA solution is 0.2:4.8; the reaction temperature is 37° C. and the reaction time is 15 min; In the step 4), the volume ratio of the CRISPR / Cas12a solution to the RPA solution is 5:1; the temperature of the continued reaction is 37° C. and the time is 15 min.

10. The detection method according to claim 7, characterized in that: In step 5), the volume ratio of the sample loading buffer to the CRISPR / Cas12a solution is 4:5; In step 6), the test strip is placed in the mixed solution for 2 minutes.

Images