Application of Aeu8-dsRNA in prevention and control of elephant trunk bean root-knot nematode

Abstract

The invention discloses application of Aeu8-dsRNA in prevention and control of elephant trunk bean root-knot nematode, and belongs to the technical field of biology. The gene Aeu8 capable of remarkably killing the malloidogyne zeylanica is obtained by screening through an in-vitro dsRNA synthesis technology by taking the malloidogyne zeylanica as an experimental material, the dsRNA and a nano-carrier SPc are compounded according to a specific proportion by adopting a dsRNA and nano-material compounding technology to prepare the biological pesticide nano-preparation, and a potted plant root-irrigation experiment finds that the gene Aeu8 can be used for remarkably killing the malloidogyne zeylanica and the nano-carrier SPc can be used for killing the malloidogyne zeylanica. Compared with single use of the dsRNA, the purpose of preventing and controlling the elephant trunk bean root-knot nematode is remarkably improved. According to the invention, a new target gene is provided for screening of pesticide for preventing and controlling the elephant trunk bean root-knot nematode, a new biological pesticide nano preparation combination is provided for preventing and controlling the elephant trunk bean root-knot nematode, and a new method is provided for effectively preventing and controlling the elephant trunk bean root-knot nematode.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to application of Aeu8-dsRNA in preventing and controlling root-knot nematodes of elephant ear beans. Background Art

[0002] Plant-parasitic nematodes (PPN) are the second most important crop disease after fungi, causing a 10% to 25% loss in global crop yields and an economic loss of about $173 billion each year. Among them, root-knot nematodes (Meloidogyne spp.) have become the second largest category of crop diseases. They can parasitize more than 5,500 plant species, including food crops, terrestrial vegetables, fruit trees, ornamental plants, and grasses. They are one of the important pathogenic nematodes that seriously harm crop production, causing up to $70 billion in losses to global agricultural production each year and reducing vegetable production by more than 30%. They have the characteristics of wide geographical distribution, large genetic variation between species and within species, and a wide host range, and are listed as the first of the world's top ten most important plant parasitic nematodes. In particular, the elephant bean root-knot nematode (Meloidogyne enterolobii) has a strong pathogenicity. Compared with other root-knot nematodes such as southern root-knot nematode (M. incognita) and northern root-knot nematode (M. hapla), it has a short generation cycle, strong reproductive capacity, and no overwintering phenomenon. The initial inoculation density is only 50 nematodes per 500 cm. -3 It can infect host plants at any time. It has a wide host range and can overcome known disease-resistant genes such as Mi, N, and RK, causing devastating damage to crops. It was listed in the A2 list of the European Plant Protection Organization (EPPO) in 2010 and is now recommended as a quarantine species.

[0003] RNA biopesticides are emerging technologies that use the principle of RNA interference (RNAi) to induce the degradation of mRNA of growth, development or behavior-related genes by introducing dsRNA targeting key host genes, thereby specifically blocking the expression of target genes. Biopesticides based on RNAi technology have the advantages of high specificity, safety to non-target organisms, easy degradation in the environment, and difficulty in developing drug resistance, making them recognized as green control products for plant diseases and insect pests. They have shown great application prospects in crop quality improvement, disease and pest control, and screening and identification of new pesticide targets. In the study of plant nematode RNAi, the functions of dozens of genes such as southern root-knot nematodes, elephant ear bean root-knot nematodes, and pseudo-gramineous root-knot nematodes have been successfully studied using the immersion method and plant-mediated method. It was found that the pathogenicity and parasitic ability of root-knot nematodes were significantly reduced after RNAi, indicating that the RNAi metabolic pathway is widely present in root-knot nematodes and plays a key role. Iqbal et al. used the immersion method to silence 20 key genes in the RNAi pathway of southern root-knot nematodes. The results showed that after silencing 18 of the genes, the nematodes showed varying degrees of paralysis, abnormal behavior or abnormal movement. This shows that it is feasible to develop new root-knot nematode control technologies with efficient RNAi lethal target genes as the object. Although many studies have shown that RNA biopesticides have great application prospects, their stability has seriously affected their commercial applications. How to effectively deliver exogenous dsRNA into plant nematodes is one of the key difficulties that need to be solved.

[0004] Star polycation (SPc) constructed by China Agricultural University is a plant-based pesticide adjuvant that can significantly improve the physicochemical properties of the agent, enhance the pest control effects of matrine, d-limonene, and pyrethrin, and increase the duration of the drug. Studies have shown that nanocarriers can be used to deliver biological pesticides such as dsRNA, enhance the ability of dsRNA to penetrate the body wall of pests and improve the efficiency of RNAi, and can be made into spray-type pesticides that are convenient for field operations, showing broad application prospects in the field of pest control. dsRNA compounded with nanomaterials improves the gene silencing effect of traditional dsRNA, can more effectively regulate the growth and development process of pests, and lays a solid foundation for the establishment of safe, green, and highly targeted pest control technology. Summary of the invention

[0005] The purpose of the present invention is to provide an application of Aeu8-dsRNA in the prevention and control of elephant ear bean root knot nematodes to solve the problems existing in the above-mentioned prior art. The composite nano preparation prepared by compounding the Aeu8 gene dsRNA of the elephant ear bean root knot nematode with the nanocarrier SPc can significantly improve the effect of preventing and controlling the elephant ear bean root knot nematodes.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides an Aeu8 gene of the root-knot nematode of the elephant ear bean. The nucleotide sequence of the Aeu8 gene is shown in SEQ ID NO.1.

[0008] The present invention also provides a protein encoded by the Aeu8 gene.

[0009] The present invention also provides the dsRNA of the Aeu8 gene, and the nucleotide sequence of the dsRNA is shown in SEQ ID NO.2.

[0010] The present invention also provides an application of the dsRNA or a composite nano preparation constructed by combining the dsRNA with a nanocarrier SPc in preventing and treating root-knot nematodes of elephant ear beans.

[0011] Optionally, the application is to directly kill the elephant ear bean root-knot nematode by feeding the dsRNA into the body of the elephant ear bean root-knot nematode, or inhibit the reproduction or disease of the elephant ear bean root-knot nematode, so as to achieve the purpose of preventing and controlling the elephant ear bean root-knot nematode.

[0012] The nanocarrier Spc is a star-shaped cationic polymer, and its chemical structure is:

[0013] , n is an integer from 1 to 100.

[0014] The preparation method of the nanocarrier Spc is prepared according to the reference “A Facile-Synthesized Star Polycation Constructed as a Highly Efficient Gene Vector in Pest Management”.

[0015] Optionally, in the composite nanoformulation, the mass ratio of the dsRNA to the nanocarrier SPc is 1:1.

[0016] The present invention also provides a biological pesticide for preventing and controlling root-knot nematodes of elephant ear beans, which contains the dsRNA or a composite nano-preparation constructed by combining the dsRNA with a nano-carrier SPc, wherein the mass ratio of the dsRNA to the nano-carrier SPc in the composite nano-preparation is 1:1.

[0017] The present invention also provides a method for controlling the root-knot nematode of elephant ear bean, comprising the following steps: using the dsRNA or the composite nanoformulation constructed by the dsRNA combined with the nanocarrier SPc to control the root-knot nematode of elephant ear bean by (1) soaking the root-knot nematode of elephant ear bean or (2) irrigating the roots of plants infected with the root-knot nematode of elephant ear bean;

[0018] Wherein, the mass ratio of dsRNA to nanocarrier SPc in the composite nanoformulation is 1:1.

[0019] The present invention discloses the following technical effects:

[0020] The present invention uses the elephant ear bean root knot nematode as an experimental material, screens and obtains the gene Aeu8 that can significantly kill the elephant ear bean root knot nematode through in vitro synthesis of dsRNA technology, and adopts the dsRNA and nano material compounding technology to compound dsRNA and nano carrier SPc according to a specific ratio to prepare a biological pesticide nano preparation, and finds through a potted root irrigation experiment that it significantly improves the purpose of preventing and controlling the elephant ear bean root knot nematode compared with using dsRNA alone. The present invention provides a new target gene for screening drugs for preventing and controlling the elephant ear bean root knot nematode, provides a new combination of biological pesticide nano preparations for preventing and controlling the elephant ear bean root knot nematode, and provides a new method for effectively preventing and controlling the elephant ear bean root knot nematode. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0022] Figure 1 The electrophoresis results of dsRNA synthesis in vitro; M: DNA marker DL2000; 1: egfp gene; 2: Smg2 gene; 3: Aeu8 gene; 4: ego1 gene; 5: 2242 gene;

[0023] Figure 2 is the relative lethality of 1 mg / mL dsRNA of different genes;

[0024] Figure 3 is the relative lethality after Aeu8 dsRNA and nanomaterial SPC are combined;

[0025] Figure 4 The results of amplification of the L4440-Aeu8 gene fragment; M: DNA marker DL2000; 1: Aeu8 gene;

[0026] Figure 5 is the expression of Aeu8 gene dsRNA; M: DNA marker DL2000; 1: Aeu8 gene dsRNA;

[0027] Figure 6 The acid fuchsin staining of tomato roots after 10 days;

[0028] Figure 7 The statistical results of the number of nematodes in tomato roots with different treatments after 10 days;

[0029] Figure 8 This is the indigo dyeing of tomato roots after 45 days;

[0030] Fig. 9 This is the statistical result of tomato root disease index after 45 days. DETAILED DESCRIPTION

[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0032] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0033] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0034] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0035] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0036] Example 1

[0037] 1. Materials and methods

[0038] 1.1 Test nematodes and plant materials

[0039] Nematode materials: Meloidogyne enterolobii was bred in a laboratory greenhouse. Mature eggs were collected and placed in sterile water. After hatching in an incubator at 28°C, the second-instar larvae were collected for inoculation.

[0040] Test plant materials: Select the Maofen 802 tomato variety as the potted experimental material. First, place the tomato seeds in a culture dish, cover with moist kitchen paper towels, and place in a dark place at 25℃ for germination. After 5 days, move the germinated seedlings to sterilized sand, which is placed in a disposable plastic cup. The tomato pots are cultured in a greenhouse at a temperature of 25 ± 2℃; relative humidity of 65± 5%; the culture photoperiod of light (L): dark (D) is 16 h: 8 h. After about a month, wait for the tomato to grow four true leaves for the root irrigation experiment.

[0041] 1.2 Strains and plasmids

[0042] Viral vector: L4440 vector was donated by China Agricultural University.

[0043] Strains: Escherichia coli (E. coli) HT115 (DE3) was donated by China Agricultural University; Escherichia coli (E. coli) DH5α strain was preserved in this laboratory.

[0044] 1.3 Preparation of relevant solutions

[0045] LB (Luria-Bertani) medium: yeast extract 5 g / L, tryptone 10 g / L, NaCl 10 g / L;

[0046] 150 mM NaCl: NaCl 8.77 g / L.

[0047] 1.4 Highly efficient RNAi target screening and validation

[0048] 1.4.1 dsRNA synthetic template amplification

[0049] 1.4.1.1 Primer design

[0050] The genomes of higher animals, plants and root-knot nematodes were compared and analyzed by Blast to obtain genes specific to root-knot nematodes. These genes were then compared and analyzed with the RNAi interference phenotype database of Caenorhabditis elegans (C. elegans) to obtain genes with high RNAi effects and lethal phenotypes. The above genes were subsequently screened to obtain efficient RNAi target genes for the root-knot nematode.

[0051] Based on the potential lethal gene sequence of the root-knot nematode of Elephant ear bean obtained above, specific primers containing siRNA fragments were designed using Primer Premier 5.0 software and siDirect version 2.0 website, and T7 promoter sequences (indicated by underscores) were added in front of the specific primers. At the same time, the exogenous gene green fluorescent protein eGFP was used as a control to design primers eGFP-T7-F and eGFP-T7-R. Some primer sequences are shown in Table 1.

[0052] Table 1 Primers used for dsRNA template synthesis

[0053]

[0054] Note: (The underlined base sequence is T7 promoter).

[0055] 1.4.1.2 PCR amplification and product purification

[0056] Using the cDNA of the root-knot nematode of the bean ear and the pcambia35s-gfp plasmid as templates, the synthetic templates of the dsRNA of the root-knot nematode of the bean ear and the GFP gene were amplified respectively. The specific reaction system is shown in Table 2 below:

[0057] Table 2 Reaction system

[0058]

[0059] The PCR reaction program was: 98°C for 5 min; 98°C for 10 sec, 64 / 60°C for 5 sec, 72°C for 30 sec, 35 cycles; 72°C for 10 min; 4°C hold.

[0060] The amplified products were purified using a PCR product purification kit (Beijing Tiangen Biochemical Co., Ltd.). The specific steps were referred to the kit instructions. The concentration of the purified products was detected using NanoDrop 2000 and stored at -20°C.

[0061] 1.4.1.3 In vitro reverse transcription synthesis and purification of dsRNA

[0062] The DNA purified in 1.4.1.2 above was used as a template and in vitro transcription was performed using T7 RNAi Transcription Kit (Vazyme). The specific steps are as follows:

[0063] Table 3 In vitro transcription system

[0064]

[0065] After mixing the reactants, place them in a PCR instrument and incubate at 37°C for 16 h. After taking out the products, add 30 µL of DEPC water and 2 µL of DNase I and react at 37°C for 15 min to remove DNA.

[0066] Purify the above synthesized dsRNA, the specific steps are as follows:

[0067] (1) 80 µL of product was added with 200 µL ddH2O, followed by 200 µL phenol:chloroform:isoamyl alcohol (25:4:1), vortexed for 15 sec, and centrifuged at 12,000 rpm / 10 min;

[0068] (2) Take the supernatant into a new centrifuge tube and add 20 µL 3M NaAC (PH=5.2) and 400 µL EtOH;

[0069] (3) Centrifuge at 12,000 rpm / 1 min at 4°C and place at -20°C for precipitation for at least 2 h;

[0070] (4) Centrifuge at 12,000 rpm / 10 min at 4°C, discard the supernatant, add 1 ml of 75% ethanol, wash the precipitate twice at 4°C, and discard the supernatant;

[0071] (5) Leave the precipitate to dry at room temperature and add 30 µL ddH2O to dissolve it;

[0072] (6) Detect the concentration of the purified product and take 2 µL of the product to detect the quality of the dsRNA by 1.0% agarose gel electrophoresis.

[0073] 1.4.2 In vitro RNAi

[0074] Freshly hatched second-instar larvae of the root-knot nematode of the elephant ear bean were collected, washed twice with DEPC water, and then washed twice with 1×PBS buffer and placed in the solution. The reaction solution is shown in Table 4 below:

[0075] Table 4 Reaction solution

[0076]

[0077] The treatment was carried out at 28°C, 100 rpm in the dark for 24 hours, with 200 nematodes in each treatment. eGFP dsRNA was used as a negative control, and the mortality rate was calculated after 24 hours. Genes with a mortality rate of more than 70% for the second-instar larvae of the target bean root-knot nematode at a concentration of 1 mg / mL dsRNA were screened.

[0078] 1.5 Construction of RNAi-Aeu8 interference vector

[0079] The highly efficient RNAi target gene Aeu8 of the root-knot nematode of the elephant ear bean was obtained by in vitro RNAi screening with a lethal phenotype. According to the Aeu8 gene sequence, a pair of specific primers were designed, and the two ends of the primers contained Xba I and Xho I restriction sites (as shown in Table 5), and the target fragments were amplified respectively. Then, the PCR amplification products were detected by 1% agarose gel electrophoresis, and the fragments were recovered. The target fragment and the vector plasmid were subjected to restriction digestion reaction respectively, and they were constructed into the L4440 vector.

[0080] Table 5 Primer information of Aeu8 gene fragment

[0081]

[0082] Note: The underlined bold italics are the restriction enzyme cutting sites.

[0083] Xba I and Xho I enzymes were used for double digestion, and 1% agarose electrophoresis was performed at 37 °C for 2 h to recover the target bands, and the recovered product fragments were stored at -20 °C for later use. The enzyme digestion system is shown in Table 6.

[0084] Table 6 Enzyme digestion system

[0085]

[0086] After the L4440 vector and Aeu8 fragment were recovered by double restriction digestion, the ligation step was carried out according to the instructions of T4 ligase. The ligation reaction system is shown in Table 7 below.

[0087] Table 7 Ligation reaction system

[0088]

[0089] Reaction conditions: 4℃ overnight (more than 8 hours). Then transfer to DH5α, apply LB plate containing ampicillin (AMP), pick single colony, use primer L4440-T7-F / R for colony PCR detection, sequencing analysis, and shake the bacteria to extract plasmid after successful verification.

[0090] 1.6 Preparation of E. coli HT115 (DE3) competent cells

[0091] The E. coli HT115 (DE3) strain used in the laboratory was donated by China Agricultural University. The strain itself has tetracycline resistance. The competent state preparation method refers to the method provided by Dr. Timmons in the United States. The steps are as follows:

[0092] (1) Pick a single colony of Escherichia coli HT115 (DE3), inoculate it into 5 mL of LB liquid medium (containing tetracycline (Tet+), final concentration of 12.5 µg / mL), and culture it at 37°C with shaking overnight.

[0093] (2) The next day, the cells were inoculated into 25 mL of LB liquid medium (Tet+) at a volume ratio of 1:100 and cultured at 37°C with shaking.

[0094] (3) Waiting for OD 600 When the pH value is about 0.4, centrifuge the bacterial solution at 4 °C and 3000 rpm for 10 min.

[0095] (4) Remove the supernatant and add pre-cooled sterile 50 mM CaCl2 equivalent to 1 / 2 volume of the original culture (12.5 mL). Gently pipette up and down to mix and resuspend the precipitate.

[0096] (5) Incubate on ice for 30 min and centrifuge at 3000 rpm at 4°C for 10 min.

[0097] (6) Remove the supernatant and add pre-cooled sterile 50 mM CaCl2 equivalent to 1 / 10 volume (2.5 mL) of the original culture. Then add the corresponding volume of 75% sterile glycerol to make the final concentration 10%. Mix by gently pipetting up and down. Quickly freeze on ice, aliquot (150 µL / tube), and store in a -80 ℃ refrigerator until needed.

[0098] 1.7 Transformation of E. coli HT115 (DE3) competent cells

[0099] The transformation method of E. coli HT115 (DE3) competent cells is slightly different from that of DH5a competent cells. The specific method is as follows:

[0100] (1) Add 1 µL of recombinant interference vector plasmid to 100 µL of competent cells and incubate on ice for 30 min.

[0101] (2) Place the centrifuge tube in a circulating water bath at 42°C for 1 min.

[0102] (3) Quickly transfer the tube to an ice bath for 2 min.

[0103] (4) In a clean bench, add 1 mL of LB liquid culture medium to each tube and incubate in a shaker at 37 °C for 1 h.

[0104] (5) Transfer the LB liquid medium containing the transformed competent cells to a double-antibody LB solid medium plate containing Amp and Tet (final concentration of Amp is 50 µg / mL, and final concentration of Tet is 12.5 µg / mL).

[0105] (6) Place the plate in a clean bench until the bacterial solution on the surface is absorbed, then invert the plate and incubate at 37°C.

[0106] (7) After a single colony grows on the plate, pick a single colony and inoculate it into 5 mL of LB medium (Amp+Tet), culture it overnight, extract the plasmid, and perform enzyme digestion identification. The correctly identified recombinant vector is saved for later use.

[0107] 1.8 Inducible expression of dsRNA

[0108] The correctly identified bacteria were inoculated into 15 mL of LB medium (Amp+Tet), and cultured at 37°C, 220 r / min, and shaken overnight. The overnight cultured bacteria were inoculated into 100 mL of LB liquid medium (Amp+Tet) at a volume ratio of 1:100, and cultured at 37°C, 220 r / min, for about 3 h until the bacterial solution OD reached 0. 600nm was 0.4-0.45; IPTG treated with filtered bacteria was added to make the final concentration 1 mmol / L, and the shaking culture was continued for 4 h; the bacterial liquid was collected for extraction of dsRNA in HT115 (DE3).

[0109] 1.9 Extraction of dsRNA from Escherichia coli HT115 (DE3) by ethanol fixation

[0110] (1) Concentrate 5 mL of induced bacterial solution to 1 mL and incubate in an 80°C water bath for 20 min.

[0111] (2) Centrifuge at 6000 rpm for 5 min at 4°C and discard the supernatant.

[0112] (3) Add 250 μL of 75% anhydrous ethanol (prepared in PBS), mix quickly, and let stand at room temperature for 5 min.

[0113] (4) Centrifuge at 10,000 rpm at 4°C for 5 min and discard the supernatant.

[0114] (5) Resuspend the cells in 50 μL of 150 mM NaCl solution and incubate at room temperature for 1 h.

[0115] (6) Centrifuge at 4°C, 12,000 rpm for 5 min to obtain the supernatant. Detect the target band size by agarose gel electrophoresis. Dilute the solution 5-fold and use Nanodrop 2000 to detect the product concentration.

[0116] Pipette 20 μL of crude dsRNA extract, add 1 U RNase-Free DNase and RNase A Solution with a final concentration of 2 ng / μL, and incubate at 37°C for 10 min to remove double-stranded DNA and single-stranded RNA.

[0117] 1.10 Nematode hatching and plant inoculation methods

[0118] Mature egg masses were picked from the surface of the root knot and placed in a cell filter, which was then placed in sterile water and placed in a 28°C incubator for single egg mass incubation. After 72 h, J2 larvae with higher vitality were collected and made into a 50 / mL nematode suspension, which was then inoculated into the roots of tomato seedlings, with 10 mL of nematode suspension added to each seedling. The inoculated tomatoes were cultured in a greenhouse at 28°C.

[0119] When the tomato seedlings grew four true leaves, dsRNA was inoculated into the roots of the tomato potted plants at a concentration of 0.5 mg / mL, and 10 mL of the above-mentioned nematode suspension was connected at the same time. There were two treatment groups, namely dsRNA and dsRNA / SPc nanoformulation, with the second-instar larvae of the elephant ear bean root-knot nematode alone as the control. Each treatment was inoculated with 500 worms, and the test was repeated three times. After 10 days, the number of third-instar larvae was counted by staining, and the number of root knots was counted after 45 days to observe and calculate the control effect.

[0120] The above dsRNA / SPc nanoformulation is prepared by compounding Aeu8 gene dsRNA and nanomaterial SPc at a mass ratio of dsRNA:SPc=1:1. Structural characteristics of nanocarrier SPc: It is a dendritic macromolecule functionalized with amino functional groups, the structural formula is shown below, and the value of n is 1-100.

[0121] .

[0122] 1.11 Statistics of potted plant control effects

[0123] 45 days after inoculation, the tomato plants in the pots were removed, and the fresh weight of the roots and the number of root knots of the tomato plants were recorded and counted. The disease level was calculated using the Bridge & Page grading standard. The root knot grading standard is as follows:

[0124] Level 0: No root knot;

[0125] Level 1: The root knot content on the root system is less than 1 / 5 and the root knots are not connected to each other;

[0126] Level 2: The root knot content on the root system is between 1 / 5 and 2 / 5, and a small number of root knots are connected to each other;

[0127] Level 3: The root knot content on the root system is 2 / 5~3 / 5, and the number of interconnected root knots is less than 1 / 2;

[0128] Level 4: The root knot content is 3 / 5~4 / 5, and the number of interconnected root knots is more than 1 / 2, and some main and lateral roots become thicker or even deformed;

[0129] Level 5: The root system contains more than 4 / 5 root nodes, which are interconnected and most of the main and lateral roots are deformed.

[0130] The protective effect is calculated according to the following formula:

[0131] Disease index = ×100;

[0132] Prevention effect = ×100%.

[0133] 2. Results and Analysis

[0134] 2.1 dsRNA synthesis

[0135] Using the cDNA of R. elegans as a template, PCR amplification was performed using primers with T7 transcriptase recognition sequences to amplify the target fragment of the potential lethal gene of R. elegans. After purification of the amplified fragment, the T7 RNAiTranscription Kit (Vazyme) was used to perform in vitro transcription to synthesize dsRNA (see Figure 1 ), after purification by isopropanol precipitation, the dsRNA concentration measured by microspectrophotometer was between 10 mg / mL and 19 mg / mL, which can be used for subsequent immersion tests of second-instar nematode larvae.

[0136] 2.2 In vitro RNAi

[0137] The lethality of potential lethal genes of the ear bean root-knot nematode was verified by in vitro immersion method, and a lethal gene Aeu8 was screened out, which had a lethality of more than 70% for the second-instar larvae of the ear bean root-knot nematode at a dsRNA concentration of 1 mg / mL (see Figure 2 ).

[0138] After the Aeu8 gene dsRNA and the nanomaterial SPc were compounded at a mass ratio of dsRNA:SPc=1:1, the second-instar larvae of the ear bean root-knot nematode were immersed in vitro again. The results showed that the relative lethality of the dsRNA and nanomaterial SPc compound was 24.21% higher than that of the dsRNA alone (see Figure 3 ).

[0139] 2.3 L4440-Aeu8 vector construction

[0140] The L4440 expression vector used in this experiment has a bidirectional T7 promoter inside. The target gene fragment can be inserted between the bidirectional T7 promoters through the internal restriction sites. Under the induction of IPTG, the two reverse T7 promoters play a role and can form complementary dsRNA molecules. The engineered strain HT115 has Tet resistance and lacks RNase III-like endonucleases in the body, so the dsRNA expressed by L4440 in the bacteria can remain in the form of large fragments.

[0141] According to the Aeu8 sequence information, primers were designed and amplified to obtain the target gene fragment (see Figure 4 ).

[0142] The cloned target fragment was digested with Xba I and Xho I, and then constructed into the L4440 vector to become the L4440-Aeu8 vector. After verification by PCR amplification and DNA sequencing, it was found that the sequence was completely consistent with the target fragment sequence. Then, the verified positive plasmid was transformed into Escherichia coli HT115 (DE3) for induced expression of dsRNA.

[0143] 2.4 dsRNA extraction

[0144] The correct clones were added to LB medium, IPTG (final concentration of about 1 mM) was added for induction, and then the cells were collected. The dsRNA was extracted by ethanol precipitation to detect the expression of dsRNA (see Figure 5 ), electrophoresis revealed a large amount of dsRNA of about 256 bp.

[0145] 2.5 Statistics of the control effect of dsRNA on tomato potted plants after 10 days

[0146] dsRNA was mixed with the suspension of R. elegans at a concentration of 0.5 mg / mL and inoculated into the roots of tomato potted plants. There were two treatment groups, namely dsRNA and dsRNA / SPc nanoformulation. The second-instar larvae of R. elegans were used as the control. Each treatment was inoculated with 500 larvae, and the process was repeated three times. After 10 days, the tomato roots were stained with acid fuchsin. The results are shown in Figure 2. Figure 6 As shown, according to statistics, the number of nematodes in the control group alone was 50% more than that in the dsRNA treatment group alone, and 57.31% more than that in the dsRNA / SPc nanoformulation treatment group (see Figure 7 ).

[0147] 2.6 Statistics of the control effect of dsRNA on tomato potted plants after 45 days

[0148] dsRNA was mixed with the suspension of R. elegans at a concentration of 0.5 mg / mL and inoculated into the roots of potted tomatoes. There were two treatment groups, dsRNA and dsRNA / SPc nanoformulation. The second-instar larvae of R. elegans were used as the control. Each treatment was inoculated with 500 larvae, and the process was repeated three times. After 45 days, the root knots of tomatoes were dyed with food indigo (see Figure 8 ), and calculate the root disease index (see Fig. 9 ), and the control effect was calculated. According to the calculation, the control effect of dsRNA alone is 55.55%, and the control effect of dsRNA / SPc nanoformulation can reach 66.67%.

[0149] Aeu8 target gene fragment (SEQ ID NO.1):

[0150] CCGTCGTTAT GAGCCTAAATCTGACTTAGTCGAAATGTTAACAACACAAACACCTTGGGCAGGTATAGAACCATTTGCCATTCATG TCAGAACTATGCCAGAACCGTCATTGCCTAATGGACTTTCTTTGGCATTAATTGAAGCGATTAATTTAATGTTAAA AAGAAAACTTGAGGAAAGGCCAACAGCCCTAGAATTACTTGGAATTAAACATTTTGTAGTTCTGATGAACGATTA GATGTAGTAGAGGAGGCA AAGGAAGGGAGAGGAGTGATTTTGAAAATTGTTAAAATGGAAATGTTTTCTTCTTTAGTAGAAAATGTTCAAAATATATCTGAAAATATGCTTTTCAGGTATTAATATAATACAACCAAAAGAGGAACAAAAAATAGCTAGTCTGGTTTCAAATTT TTACAGACAAATTAGTACTCGTGAGGATATTCAGAATCTTTTGACAAAGTATCAACTCCAACTTTTTCAAATAAAAGAAGTAAATTCAGAAACTATTAGACAAGCAAATATTTGTTCAACTCGAATGGGTAGAGTACAGCAAACTTTAAGGTAA.

[0151] The underlined portion of the above sequence is the Aeu8 gene dsRNA (SEQ ID NO. 2).

[0152] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. An Aeu8 gene of the root-knot nematode of the elephant ear bean, characterized in that: The nucleotide sequence of the Aeu8 gene is shown in SEQ ID NO.

1.

2. The protein encoded by the Aeu8 gene as claimed in claim 1.

3. The dsRNA of the Aeu8 gene according to claim 1, characterized in that The nucleotide sequence of the dsRNA is shown as SEQ ID NO.

2.

4. Use of the dsRNA as claimed in claim 3 or a composite nano-preparation constructed by combining the dsRNA with a nano-carrier SPc in controlling root-knot nematodes of Elephant's ear bean.

5. The use according to claim 4, characterized in that The application is to directly kill the elephant ear bean root knot nematode or inhibit the reproduction or disease of the elephant ear bean root knot nematode by feeding the dsRNA into the body of the elephant ear bean root knot nematode, so as to achieve the purpose of preventing and controlling the elephant ear bean root knot nematode.

6. The use according to claim 4, characterized in that In the composite nanoformulation, the mass ratio of the dsRNA to the nanocarrier SPc is 1:

1.

7. A biological pesticide for controlling root-knot nematodes of elephant ear beans, characterized in that: It contains the dsRNA according to claim 3 or a composite nano-preparation constructed by combining the dsRNA with a nano-carrier SPc, wherein the mass ratio of the dsRNA to the nano-carrier SPc in the composite nano-preparation is 1:

1.

8. A method for preventing and controlling root-knot nematodes of elephant ear beans, characterized in that: The method comprises the following steps: using the dsRNA according to claim 3 or the composite nanoformulation constructed by combining the dsRNA with the nanocarrier SPc to control the elephant ear bean root knot nematodes by (1) immersing the elephant ear bean root knot nematodes or (2) irrigating the roots of plants infected with the elephant ear bean root knot nematodes; Wherein, the mass ratio of dsRNA to nanocarrier SPc in the composite nanoformulation is 1:1.

Images