Leaf vegetable silencing system based on RNA virus induction and construction method and application thereof

Abstract

The invention provides a leaf vegetable silencing system based on RNA virus induction and a construction method and application thereof, and belongs to the technical field of plant genetic engineering. According to the invention, pTRV2-BrPDS, pTRV2-BjuPDS-g and pTRV2-BrPDS-c silencing expression vectors are constructed, the silencing expression vectors are introduced into leaves of brassica juncea and brassica juncea, and a VIGS technology is successfully applied to silence endogenous PDS genes, so that brassica juncea and brassica juncea plants generate albino phenotypes of different degrees, technical support is provided for research on gene functions of brassica juncea and brassica juncea, and the application has a wide application prospect. The speed of research on functional genes of the brassica juncea and the brassica juncea can be

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a leafy vegetable silencing system based on RNA virus induction, and a construction method and application thereof. Background Art

[0002] Virus-induced gene silencing (VIGS) is a method for rapidly verifying plant gene function. VIGS can specifically bind to and degrade the mRNA produced by transcription, causing silencing of the target gene. Analysis of the silenced individuals can determine the function of the gene. VIGS generally causes gene silencing at the whole plant level. This method does not require stable genetic transformation of the plant and does not change the genomic DNA sequence, but can produce phenotypic characteristics similar to mutants. It is a rapid and effective method for analyzing gene function.

[0003] Shanghai green (Brassica rapa subsp.chinensis), also known as Chinese cabbage, belongs to the genus Brassica of the Cruciferae family. It is rich in ascorbic acid, glucosinolates, sulforaphane and other nutrients, and has high nutritional value. Mustard (Brassicajuncea (L.) Czern.) belongs to the genus Brassica of the Cruciferae family. It is rich in vitamins and has the effects of benefiting the lungs and removing phlegm, reducing swelling and dispersing nodules. At present, there is no report on silencing the endogenous PDS gene of Shanghai green and mustard by VIGS system. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide a VIGS silencing system for leafy vegetables based on RNA virus induction, introduce the silencing system into the leaves of Shanghai green and mustard, and silence the endogenous PDS gene using VIGS technology.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] A VIGS silencing system for leafy vegetables based on RNA virus induction comprises a vector pTRV1 and a recombinant vector pTRV2 containing a target gene fragment, wherein the target gene fragment comprises any one of BrPDS, BjuPDS-g and BjuPDS-c.

[0007] Preferably, the nucleotide sequence of the target gene fragment BrPDS is shown as SEQ ID NO.1, the nucleotide sequence of the target gene fragment BjuPDS-g is shown as SEQ ID NO.2, and the nucleotide sequence of the target gene fragment BjuPDS-c is shown as SEQ ID NO.3.

[0008] Preferably, the cloning method of the BrPDS fragment includes: extracting total RNA from Shanghai bluebell, reverse transcribing to obtain the first chain of cDNA, using this chain as a template, and using the nucleotide sequences shown in SEQ ID No.10 and SEQ ID No.11 as primers to amplify and obtain the BrPDS fragment with homology arms; the cloning method of the BjuPDS-g fragment includes: extracting total RNA from spore mustard, reverse transcribing to obtain the first chain of cDNA, using this chain as a template, using the nucleotide sequences shown in SEQ ID No.12 and SEQ ID No.13 as primers, and amplifying and obtain the BjuPDS-g fragment with homology arms; the cloning method of the BjuPDS-c fragment includes: extracting total RNA from spore mustard, reverse transcribing to obtain the first chain of cDNA, using this chain as a template, and using the nucleotide sequences shown in SEQ ID No.14 and SEQ ID No.15 as primers to amplify and obtain the BjuPDS-c fragment with homology arms.

[0009] Another object of the present invention is to provide an application of the leafy vegetable VIGS silencing system in silencing the PDS gene of leafy vegetables, transforming the recombinant vector pTRV2 containing the target gene fragment into Escherichia coli DH5α competent cells to prepare a recombinant plasmid, transforming the recombinant plasmid and the vector pTRV1 into Agrobacterium tumefaciens GV3101 competent cells respectively to obtain a bacterial solution containing the vector pTRV1 and a bacterial solution containing the recombinant vector pTRV2, mixing the bacterial solution containing the vector pTRV1 and the bacterial solution containing the recombinant vector pTRV2 to obtain an infection solution, and injecting the infection solution into the leaves of leafy vegetables.

[0010] Preferably, the leafy vegetables are bok choy, mustard greens and cabbage mustards.

[0011] Preferably, when the infection fluid contains the recombinant vector pTRV2 connected to the BrPDS fragment, it is injected into the leaves of Shanghai green; when the infection fluid contains the recombinant vector pTRV2 connected to the BjuPDS-g fragment, it is injected into the leaves of Sporangium juncea; when the infection fluid contains the recombinant vector pTRV2 connected to the BjuPDS-c fragment, it is injected into the leaves of Bulbous mustard.

[0012] Preferably, when injected into the leaves of Shanghai green, the infection solution OD 600 =0.3~1.0; when injected into the leaves of mustard, the infection solution OD 600 =0.5~0.8; when injected into the leaves of mustard, the infection solution OD 600 =0.5~1.0.

[0013] Preferably, the bacterial solution containing the vector pTRV1 and the bacterial solution containing the recombinant vector pTRV2 are mixed at a volume ratio of 1:1.

[0014] Preferably, the leafy vegetables are at the 6 true leaf stage.

[0015] Another object of the present invention is to provide a kit for detecting the PDS gene of leafy vegetables, the kit comprising: a primer set for detecting the BrPDS gene of Shanghai green, the nucleotide sequence of the primer set is shown in SEQ ID No.20 and SEQ IDNo.21; a primer set for detecting the BjuPDS-g gene of Brussels sprouts, the nucleotide sequence of the primer set is shown in SEQ ID No.24 and SEQ ID No.25; a primer set for detecting the BjuPDS-c gene of Brussels sprouts, the nucleotide sequence of the primer set is shown in SEQ IDNo.26 and SEQ ID No.27.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The invention provides a VIGS silencing system for leafy vegetables induced by RNA viruses. By constructing pTRV2-BrPDS, pTRV2-BjuPDS-g and pTRV2-BrPDS-c silencing expression vectors, the silencing expression vectors are introduced into leaves of Shanghai green and mustard, and the VIGS technology is successfully used to silence the endogenous PDS gene, resulting in different degrees of albino phenotypes in Shanghai green and mustard plants. This provides technical support for studying the gene functions of Shanghai green and mustard, and helps to speed up the research on the functional genes of Shanghai green and mustard. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is a TRV-based VIGS vector structure, in which Replicase: RNA-dependent RNA polymerase; 16KDa: 16kDa cysteine-rich protein; MP: mobile protein; CP: coat protein; LB and RB: T-DNA left and right borders; Rz: self-cleaving nuclease; MCS: multiple cloning site;

[0019] Figure 2 It is the amino acid sequence alignment of different PDS proteins;

[0020] Figure 3 The effect of inoculation with different concentrations of Agrobacterium on the albino phenotype of plants, where A is the BrPDS gene silencing rate of Shanghai green, B is the BjuPDS-g gene silencing rate of Sporangial mustard, and C is the BjuPDS-c gene silencing rate of Heading mustard;

[0021] Figure 4 The BrPDS silenced plants showed albino phenotype, among which the inoculation concentration of A was OD 600 =0.3; B inoculation concentration OD 600 =0.5; C inoculation concentration OD 600 =0.8; D inoculation concentration OD 600=1.0; in each figure, the left side is the control group, the right side is the experimental group, the upper row is the upper surface of the leaf, and the lower row is the lower surface of the leaf; scale = 1 cm;

[0022] Figure 5 The endogenous PDS gene of Brassica juncea was down-regulated, resulting in the whitening of plant leaves. The inoculation concentration of A spore mustard was OD 600 =0.3; B spore mustard inoculation concentration OD 600 =0.5; C spore mustard inoculation concentration OD 600 =0.8; D spore mustard inoculation concentration OD 600 =1.0; E: inoculation concentration of mustard 600 =0.3; F mustard inoculation concentration OD 600 =0.5; G seed concentration OD600 = 0.8; H mustard seed inoculation concentration OD 600 =1.0; in each figure, the upper part is the control group, the lower part is the experimental group, the rightmost leaf is the injected leaf, the leftmost leaf is the new leaf, and the middle leaf is the uninjected leaf; scale bar = 1 cm;

[0023] Figure 6 The downregulation of endogenous PDS gene in Brassica juncea leads to albino inflorescence. A shows albino inflorescence of Brassica juncea treated with different infection solution concentrations, and B shows albino inflorescence of Brassica juncea treated with different infection solution concentrations. In each figure, the left side is the control group and the right side is the experimental group. Scale bar = 1 mm.

[0024] Figure 7 The downregulation of endogenous PDS gene in Brassica juncea leads to the albino phenomenon of plant corolla, where A shows albino phenotype of the corolla of Brassica juncea treated with different concentrations of Agrobacterium; B shows albino phenotype of the corolla of Brassica juncea treated with different concentrations of Agrobacterium; in each figure, the left side is the control group and the right side is the experimental group; scale bar = 1 mm;

[0025] Figure 8 The TRV1 and TRV2 RNAs were injected into leaves, where A is Shanghai Qing; B is Sporangial mustard; C is Caducous mustard;

[0026] Fig. 9 is the expression level of endogenous PDS gene, among which A is Shanghai green; B is spore mustard; C is head mustard. DETAILED DESCRIPTION

[0027] The invention provides a PDS silencing system for leafy vegetables based on RNA virus induction, comprising a vector pTRV1 and a recombinant vector pTRV2 containing a target gene fragment, wherein the target gene fragment comprises any one of BrPDS, BjuPDS-g and BjuPDS-c.

[0028] In the present invention, the nucleotide sequence of the target gene fragment BrPDS is shown in SEQ ID NO.1:

[0029] ACCTGATCGCGTGACTGATGAAGTGTTTATAGCCATGTCAAAGGCACTTAACTTTATAAACCCGAACGAACTGTCAATGCAATGCATTTTGATAGCTTTGAACCGGTTTCTTCAGGAGAAACATGGTTCAAAGATGGCCTTCTTAGATGGTAATCCT CCGGAGAGGCTATGCATGCCGATTGTTGAACATATTCGATCGCTAGGTGGCGAAGTACGACTCAATTCAAGGATAAGGAAGATTGAACTGGAGGATGATGGTACGGTTAAGAATTTCTTACTCACTGATGGAACCACTATCCAAGGAGACGCT(SEQ ID NO.1).

[0030] The nucleotide sequence of the open reading frame of the gene BrPDS is shown in SEQ ID NO.30:

[0031]

[0032] In the present invention, the nucleotide sequence of the target gene fragment BjuPDS-g is shown in SEQ ID NO.2:

[0033] ACCTGATCGCGTGACTGATGAGGTGTTTATTGCTATGTCAAAGGCGCTAAACTTTATAAACCCGGACGAACTGTCGATGCAATGCATATTGATAGCTTTGAATCGGTTTCTTCAGGAGAAACATGGATCGAAGATGGCGTTCTTAGATGGTAATCCA CCGGAGAGGCTTTGTATGCCAATAGTGGAACATATTAGATCACTAGGTGGGGAGGTAAGACTTAACTCAAGGATAAGGAAGATTGAGCTCGAGAATGATGGTACCGTTAAGAATTTCTTACTCACTGATGGCACCACTATCCAAGGAGACGCT(SEQ ID NO.2).

[0034] The open reading frame nucleotide sequence of the gene BjuPDS-g is shown in SEQ ID NO.31:

[0035]

[0036] In the present invention, the nucleotide sequence of the target gene fragment BjuPDS-c is shown in SEQ ID NO.3:

[0037] ACCTGATCGCGTGACTGATGAGGTGTTTATAGCCATGTCAAAGGCGCTTAACTTTATAAACCCCGACGAACTCTCAATGCAATGCATTTTGATAGCTTTGAACCGGTTTCTTCAGAGAAACATGGGTTCCAAGATGGGCTTCTTAGATGGTAATCCC CCGGAGAGGCTATGCATGCCGATTGTTGAACATATTCGATCACTATGTGGTGAAGTACGACTCAATTCAAGGATAAGGAAGATTGAGCTGGAGGATGATGGTACGGTTAAGAATTTCTTACTCACTGATGGAACCACTATCCAAGGAGACGCT(SEQ ID NO.3).

[0038] The open reading frame nucleotide sequence of the gene BjuPDS-c is shown in SEQ ID NO.32:

[0039]

[0040] TRV is a double-stranded positive-sense RNA virus, consisting of two RNA molecules, RNA1 and RNA2, both of which are derived from the genomic RNA and subgenomic RNA of TRV. The RNA1 molecule encodes 134KDa and 194KDa replicase, 29KDa mobile protein and 16KDa cysteine-rich protein, and its replication and movement are independent of RNA2. The RNA2 molecule encodes the capsid protein and two non-structural proteins ( Figure 1 ). In the VIGS vector of Ti plasmid constructed based on TRV virus, the cDNAs of RNA1 and RNA2 in T-DNA are transcribed by the 35S promoter of Cauliflower Mosaic Virus (CaMV) and the terminator of nopaline synthase (NOS) gene to terminate the transcription. The multiple cloning site (MCS) is located in the middle of the cDNA of TRV RNA2 and can be used to clone the DNA fragment of the target gene that needs to be silenced.

[0041] In the present invention, the cloning method of the BrPDS fragment comprises: extracting the total RNA of Shanghai Qing, reverse transcribing to obtain the first chain of cDNA, taking the chain as a template, and using the nucleotide sequences shown in SEQ ID No.4 and SEQ ID No.5 as primers to amplify and obtain the BrPDS coding sequence (SEQ ID NO.30), based on the BrPDS coding sequence as a template, designing the nucleotide sequences shown in SEQ ID No.10 and SEQ ID No.11 as primers, and using the first chain of cDNA as a template to amplify and obtain the BrPDS fragment with homology arms; the cloning method of the BjuPDS-g fragment comprises: extracting the total RNA of spore mustard, reverse transcribing to obtain the first chain of cDNA, taking the chain as a template, and using the nucleotide sequences shown in SEQ ID No.6 and SEQ ID No.7 as primers to amplify and obtain the BjuPDS-g coding sequence (SEQID NO.31), based on the BjuPDS-g coding sequence as a template, designing the nucleotide sequences shown in SEQ ID No.12 and SEQ ID The nucleotide sequence shown in No.13 is used as a primer, and the first chain of cDNA is used as a template to amplify the BjuPDS-g fragment with homology arms; the cloning method of the BjuPDS-c fragment includes: extracting total RNA from B. mustard, reverse transcribing to obtain the first chain of cDNA, using this chain as a template, and using the nucleotide sequences shown in SEQ ID No.8 and SEQ ID No.9 as primers to amplify the BjuPDS-c coding sequence (SEQ ID NO.32), based on the BjuPDS-c coding sequence as a template, designing the nucleotide sequences shown in SEQ ID No.14 and SEQ ID No.15 as primers, and using the first chain of cDNA as a template to amplify the BjuPDS-c fragment with homology arms.

[0042] In the present invention, the construction of the pTRV2-BrPDS recombinant plasmid includes: connecting the BrPDS fragments with the source arms to the linear pTRV2 vector by the Gibson Assembly technology, transforming the competent cells of Escherichia coli DH5α, applying to the LB screening medium, and culturing in the dark. Perform colony PCR, obtain positive clones, send for sequencing, and obtain the successfully constructed pTRV2-BrPDS recombinant vector; the construction of the pTRV2-BjuPDS-g recombinant plasmid includes: connecting the BjuPDS-g fragments with the source arms to the linear pTRV2 vector by the Gibson Assembly technology, transforming the competent cells of Escherichia coli DH5α, applying to the LB screening medium, and culturing in the dark. Colony PCR was performed to obtain positive clones, which were sent for sequencing to obtain the successfully constructed pTRV2-BjuPDS-g recombinant vector; the construction of the pTRV2-BjuPDS-c recombinant plasmid included: the BjuPDS-c fragments with source arms were connected to the linear pTRV2 vector by Gibson Assembly technology, transformed into Escherichia coli DH5α competent cells, spread on LB screening medium, and cultured in the dark. Colony PCR was performed to obtain positive clones, which were sent for sequencing to obtain the successfully constructed pTRV2-BjuPDS-c recombinant vector.

[0043] Another object of the present invention is to provide an application of the leafy vegetable VIGS silencing system in silencing the PDS gene of leafy vegetables, and the pTRV2-BrPDS, pTRV2-BjuPDS-g and pTRV2-BrPDS-c recombinant plasmids and the vector pTRV1 are respectively transformed into Agrobacterium tumefaciens GV3101 competent cells to obtain a bacterial solution containing the vector pTRV1 and a bacterial solution containing the pTRV2-BrPDS, pTRV2-BjuPDS-g and pTRV2-BrPDS-c recombinant plasmids, and the bacterial solution containing the vector pTRV1 and the bacterial solution containing the recombinant vector pTRV2 are mixed in a volume ratio of 1:1 to obtain an infection solution, and the infection solution is injected into the leaves of leafy vegetables.

[0044] In the application of the present invention, the recombinant plasmid pTRV2 and the vector pTRV1 are respectively transformed into Agrobacterium tumefaciens GV3101 competent cells, and the positive GV3101 strain is preferably streaked into an LB solid medium containing antibiotics, wherein the antibiotics are composed of 0.05 mg / mL Kan (kanamycin), 0.05 mg / mL Gent (gentamicin) and 0.05 mg / mL Rif (rifampicin); a monoclonal strain is selected, inoculated into an LB liquid selection medium, and cultured to OD 600 =0.8; take OD 600 = 0.8 was inoculated into LB liquid selection medium at a volume ratio of 1:150 and cultured until OD 600=2.0, collect the cells after centrifugation; wash the cells and resuspend them in the infiltration solution to OD 600 =2.0, after culturing for 4 hours, the bacterial solution containing the vector pTRV1 and the bacterial solution containing the recombinant vector pTRV2 were diluted with the infiltration solution, and then the diluted bacterial solution containing the vector pTRV1 and the bacterial solution containing the recombinant vector pTRV2 were mixed in a volume ratio of 1:1 to obtain the infection solution. In the present invention, the components of the infiltration solution are MES, acetosyringone and sodium chloride, and the working concentration of MES in the infiltration solution is 10mM, the working concentration of acetosyringone is 20μM, and the working concentration of sodium chloride is 10mM.

[0045] In the present invention, the bacterial solution containing the vector pTRV1 and the bacterial solution containing the recombinant vector pTRV2 were diluted to the same OD 600 The infection solution was obtained by mixing equal volumes of the infection solution. The OD 600 The value is the same as the OD after dilution of the above bacterial solution 600 The value is the same, such as diluting the bacterial solution containing the vector pTRV1 to OD 600 The value was 0.3, and the bacterial solution containing the recombinant vector pTRV2 was diluted to OD 600 The value was 0.3, and then the diluted bacterial solution containing the vector pTRV1 and the bacterial solution containing the recombinant vector pTRV2 were mixed at a volume ratio of 1:1 to obtain an infection solution. The OD 600 The value is 0.3.

[0046] In the present invention, the leafy vegetables are Shanghai green, spore mustard and head mustard; the infection solution is injected into the leaves when the leafy vegetables are in the 6 true leaf stage; when the infection solution contains the recombinant vector pTRV2 connected to the BrPDS fragment, it is injected into the Shanghai green leaves, and preferably the infection solution OD 600 =0.3~1.0; when the infection solution contains the recombinant vector pTRV2 connected to the BjuPDS-g fragment, it is injected into the leaves of the mustard spores, and the infection solution OD 600 =0.5~0.8; when the infection solution contains the recombinant vector pTRV2 connected to the BjuPDS-c fragment, it is injected into the leaves of the mustard, and the infection solution OD 600 =0.5~1.0.

[0047] It is difficult to construct the genetic transformation system of Shanghai green and mustard, and it is difficult to obtain transgenic plants, resulting in slow progress in studying the gene functions of Shanghai green and mustard using conventional transgenic technology. The present invention constructs pTRV2-BrPDS, pTRV2-BjuPDS-g and pTRV2-BrPDS-c silencing expression vectors, and introduces the silencing expression vectors into Shanghai green and mustard leaves, thereby providing technical support for studying the gene functions of Shanghai green and mustard.

[0048] The present invention also provides a kit for detecting the PDS gene of leafy vegetables, the kit comprising: a primer set for detecting the BrPDS gene of Shanghai green, the nucleotide sequence of the primer set is shown in SEQ ID No.20 and SEQ ID No.21; a primer set for detecting the BjuPDS-g gene of Brussels sprouts, the nucleotide sequence of the primer set is shown in SEQ ID No.24 and SEQ ID No.25; a primer set for detecting the BjuPDS-c gene of Brussels sprouts, the nucleotide sequence of the primer set is shown in SEQ ID No.26 and SEQ ID No.27.

[0049] After the silencing expression vector is introduced into the leaves of Shanghai green and mustard, quantitative qRT-PCR analysis can be performed using the primer set in the kit of the present invention to determine whether the endogenous PDS gene in the infected plant is silenced.

[0050] In the specific embodiment of the present invention, the vectors are pTRV1 and pTRV2 (purchased from the Arabidopsis Biological Resource Center, ABRC); the strains are Escherichia coli DH5α and Agrobacterium tumefaciens GV3101 (purchased from Chengdu Anpudi Biotechnology Co., Ltd.); the polysaccharide and polyphenol plant total RNA extraction kit (RNAprep PurePlantKit, purchased from TIANGEN). PrimeScripttm II1st StrandcDNA Synthesis Kit (purchased from Takara), Nco I and Sac I (purchased from Fermentas); Table 1 shows the primers used in the present invention (synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.).

[0051] Table 1 Primer information

[0052]

[0053] Note: The lowercase sequences refer to homology arms.

[0054] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0055] Example 1

[0056] 1. Amplification of the coding sequence of the target gene fragment

[0057] Total RNA from Brassica rapa subsp.chinensis was extracted using RNAprep Pure Plant Kit, and the total RNA concentration was determined. The first-strand cDNA was generated by reverse transcription according to the PrimeScripttm II 1st Strand cDNA Synthesis Kit method. It was used as a template and BrPDS-F and BrPDS-R were used as upstream and downstream primers for PCR reaction to amplify the BrPDS coding sequence. The reaction procedure was: 94℃10min; 94℃15sec, 55℃15sec, 72℃15sec, 35 cycles; 72℃10min.

[0058] Total RNA from the cultivated mustard cultivar Brassica juncea var. gemmifera Lee & Lin was extracted using RNAprep Pure Plant Kit, and the total RNA concentration was determined. According to the PrimeScripttm II 1st StrandcDNA Synthesis Kit method, reverse transcription was performed to generate the first strand of cDNA, which was used as a template and BjuPDS-gF and BjuPDS-gR as upstream and downstream primers for PCR reaction to amplify the BjuPDS-g coding sequence. The reaction procedure was: 94°C for 10 min; 94°C for 15 sec, 55°C for 15 sec, 72°C for 15 sec, 35 cycles; 72°C for 10 min.

[0059] Total RNA from the cultivated mustard cultivar Brassica juncea var. capitata Hort was extracted using RNAprep Pure Plant Kit, and the total RNA concentration was determined. The first strand of cDNA was generated by reverse transcription according to the PrimeScripttm II 1st Strand cDNA Synthesis Kit method. It was used as a template, and BjuPDS-cF and BjuPDS-cR were used as upstream and downstream primers for PCR reaction to amplify the BjuPDS-c coding sequence. The reaction procedure was: 94℃10min; 94℃15sec, 55℃15sec, 72℃15sec, 35 cycles; 72℃10min.

[0060] 2. Construction of recombinant pTRV2 vector containing target gene fragment

[0061] 1) Using Shanghai blue cDNA as template and BrPDS-F1 and BrPDS-R1 as primers, amplify the BrPDS fragment with homology arms, and recover the target band after electrophoresis; the reaction program is: 94℃10min; 94℃15sec, 56℃10sec, 72℃15sec, 40 cycles; 72℃10min.

[0062] Using B. juncea cDNA as a template and BjuPDS-g-F1 and BjuPDS-g-R1 as primers, the BjuPDS-g fragment with homology arms was amplified, and the target band was recovered after electrophoresis; the reaction procedure was: 94℃10min; 94℃15sec, 56℃10sec, 72℃15sec, 40 cycles; 72℃10min.

[0063] Using B. juncea cDNA as template and BjuPDS-c-F1 and BjuPDS-c-R1 as primers, the BjuPDS-c fragment with homology arms was amplified and the target band was recovered after electrophoresis; the reaction procedure was: 94℃10min; 94℃15sec, 56℃10sec, 72℃15sec, 40 cycles; 72℃10min.

[0064] 2) Double digest the pTRV2 vector with EcoRⅠ and BamHⅠ, and purify the digestion product.

[0065] 3) The BrPDS, BjuPDS-g and BjuPDS-c fragments were respectively connected to the pTRV2 vector using Gibson Assembly technology.

[0066] 4) The ligation product was transformed into E. coli DH5α competent cells, spread on LB solid selection medium, and cultured inverted. A single clone strain was picked and inoculated into LB liquid medium containing 0.05 mg / mL Kan for expansion culture.

[0067] 5) Detection is performed by bacterial liquid PCR and sequencing of positive clones.

[0068] 6) The sequence was analyzed and the correct recombinant plasmid was used to transform Agrobacterium tumefaciens GV3101 competent cells. After PCR identification of the bacterial solution, glycerol was added to the positive clones and stored at -80°C.

[0069] 3. Virus-induced gene silencing

[0070] 3.1 The GV3101 strain containing pTRV1, pTRV2, pTRV2-BrPDS, pTRV2-BjuPDS-g and pTRV2-BjuPDS-c plasmid vectors stored at -80°C was streaked onto LB solid selection medium containing antibiotics (0.05 mg / mL Kan, 0.05 mg / mL Gent and 0.05 mg / mL Rif) and cultured in the dark at 30°C for 24 h.

[0071] 3.2 Pick out the monoclonal strains and inoculate them into LB liquid selection medium respectively, and culture them at 200r / m and 30℃ until OD 600 =0.8.

[0072] 3.3 Take 2 mL of the above bacterial solution and add it to 300 mL of LB liquid selection medium. Cultivate at 200 rpm and 30°C until OD 600 =2.0.

[0073] 3.4 Centrifuge the above bacterial solution at 5000r / m for 10min, discard the supernatant, collect the bacterial cells and wash them with sterile water.

[0074] 3.5 Resuspend the above bacteria in infiltration buffer (10mM MES, 20μM acetosyringone and 10mM sodium chloride) to OD 600 = 2.0, and after culturing at 28°C for 4 h, the bacterial solution containing the vector pTRV1 was diluted to OD 600 The bacterial solution containing the recombinant vector pTRV2 was diluted to OD 600 The values ​​of the diluted bacterial solution were 0.3, 0.5, 0.8 and 1.0 respectively.

[0075] 3.6 OD 600 The diluted pTRV1 bacterial solution and the diluted pTRV2 bacterial solution with the same OD value were mixed in a volume ratio of 1:1 as the infection solution of the control group. 600 The OD value of the diluted pTRV1 bacterial solution and the diluted pTRV2-BrPDS bacterial solution is the same. 600 The OD value of the diluted pTRV1 bacterial solution and the diluted pTRV2-BjuPDS-g bacterial solution is the same. 600 The diluted pTRV1 bacterial solution and the diluted pTRV2-BjuPDS-c bacterial solution with the same value were used as the infection solution of the experimental group.

[0076] The infection solution of the control group and the infection solution containing pTRV2-BrPDS were injected from the lower surface of the leaves into the leaves of Shanghai Qing seedlings in the 6 true leaf stage using a sterile syringe. Each plant was injected with 3 leaves. The plants were grown under sufficient light conditions and the temperature was 25±2℃.

[0077] The infection solution of the control group and the infection solution containing pTRV2-BjuPDS-g were injected from the lower surface of the leaves into 6 leaves of the Brassica juncea seedlings in the true leaf stage using a sterile syringe. Each plant was injected with 3 leaves. The plants were grown under sufficient light conditions and the temperature was 25±2℃.

[0078] The infection solution of the control group and the infection solution containing pTRV2-BjuPDS-c were injected from the lower surface of the leaves into 6 leaves of the true leaf stage of the mustard seedlings using a sterile syringe. Each plant was injected with 3 leaves. The plants were grown under sufficient light conditions and the temperature was 25±2℃.

[0079] 4 When the plants in the experimental group show phenotypic changes, extract the total RNA from the uninjected leaves of the plants in the treatment group as the material, and use the PrimeScripttm II 1st Strand cDNA Synthesis Kit method to reverse transcribe and generate the first strand of cDNA using random primers as reverse transcription primers; use the primers in Table 1 to detect whether TRV1 RNA and TRV2 RNA are successfully transformed into the treated plants, and at the same time detect whether the endogenous PDS gene in the treated plants is effectively silenced.

[0080] 5. Results

[0081] 5.1 Cloning of PDS gene

[0082] Shanghai green and mustard (Brassica juncea and Brassica juncea) were used as research materials, mRNA was extracted, reverse transcribed to generate cDNA, and endogenous PDS genes were amplified. Specific primers were designed based on the sequence of the endogenous BrPDS gene (BraA04g008530.3.1C) of Shanghai green, and the open reading frame sequence (ORF) of the BrPDS gene was obtained to be 1692bp long, which can encode a 563aa protein. Similarly, using Brassica juncea and Brassica juncea cDNA as templates, the BjuPDS-g gene of Brassica juncea with an ORF of 1698bp encoding a 565aa protein and the BjuPDS-c gene of Brassica juncea with an ORF of 1692bp encoding a 563aa protein were cloned. Amino acid sequence comparison analysis found that the amino acid sequence identities of the PDS proteins of Shanghai green, Brassica juncea and Brassica juncea with those of the AtPDS protein of Arabidopsis thaliana were 93.95%, 92.06% and 92.95% ( Figure 2). Specific primers were designed using BrPDS, BjuPDS-g and BjuPDS-c genes as templates to construct pTRV2-BrPDS, pTRV2-BjuPDS-g and pTRV2-BjuPDS-c vectors.

[0083] 5.2 Effect of different Agrobacterium concentrations on VIGS silencing efficiency

[0084] 16 days after the injection of the infection solution, the plants in the experimental group began to show albino phenotype, and the VIGS silencing rate was calculated by counting the number of plants with albino phenomenon. Figure 3 As shown in the figure, different concentrations of Agrobacterium have a significant effect on the VIGS silencing rate of Shanghai green, spore mustard and ball mustard. 600 =1.0, the silencing ratio of PDS gene in Shanghai Qing was the highest, which was 66.7%. 600 =0.5, the silencing ratio of PDS gene in B. juncea was the highest, at 42.2%, while the OD 600 =0.8, the silencing ratio of PDS gene in Brassica juncea was the highest, 51.1%. All control group plants did not produce albino phenotype.

[0085] 5.3 Silencing of BrPDS results in albino phenotype in leaves of Shanghai green

[0086] Based on the VIGS silencing system, the endogenous BrPDS gene of Shanghai Qing was silenced, and the plant showed an albino phenotype ( Figure 4 ). In these Shanghai Qing plants with albino phenotype, the degree of albino phenotype ranged from mild to severe. Compared with the control group, the concentration of the infecting solution OD 600 =0.3 treatment group, the lower epidermis of the leaves showed a white phenotype, while the upper epidermis did not show an obvious white phenotype ( Figure 4 A), the concentration of the infection fluid OD 600 =0.5 and OD 600 =0.8 treatment group, the upper leaf epidermis was slightly bleached, and the lower leaf epidermis was completely bleached ( Figure 4 BC in the infection solution). When the infection solution concentration OD 600 = 1.0, both the upper and lower epidermis of the leaves showed a strong albinism phenotype ( Figure 4 D) The petioles of the Shanghai green plants treated with the infection solution containing pTRV2-BrPDS also turned completely white.

[0087] 5.4 Endogenous PDS silencing in Brassica juncea results in albino phenotype

[0088] The infection solution containing pTRV2-BjuPDS-g and the infection solution containing pTRV2-BjuPDS-c were injected into the leaves of spore mustard and ball mustard, respectively. Plants treated with different concentrations of infection solution showed different degrees of albino phenotype. 600 =0.3, the bleaching degree of injected leaves of Brassica juncea was low, and the uninjected leaves, new leaves and stems did not bleach. 600 =0.5 and OD 600 =0.8, the injected leaves, uninjected leaves, new leaves and stems of S. juncea all showed obvious albino phenotype; 600 =1.0, the injected leaves were wilted, and the uninjected leaves and new leaves showed a weaker albinism phenotype ( Figure 5 in AD).

[0089] When different concentrations of infection solution were used to treat the serrata, the injected leaves showed different degrees of albino phenotype. 600 = 0.8, the albino phenotype was most obvious, while the uninjected leaves and new leaves did not have obvious albino phenotype ( Figure 5 EH in ).

[0090] As the spore mustard and the head mustard continued to grow, the inflorescence, sepals and petals of the treated plants showed albino phenotype compared with the control ( Figure 6-7 ).

[0091] 5.5 Analysis of endogenous PDS gene expression in albino plants

[0092] To confirm that the observed albino phenotype was caused by silencing of the endogenous BrPDS gene after infection with the TRV recombinant virus, semi-quantitative RT-PCR analysis was first performed on all treatment materials. The results showed that TRV1 and TRV2 RNA could be detected in the injected leaves of both the experimental and control groups ( Figure 8 AC in the figure). Secondly, the expression levels of endogenous PDS genes in all materials were analyzed by quantitative qRT-PCR. Compared with the control group, the expression levels of BrPDS, BjuPDS-g and BrPDS-c genes in the injected and uninjected leaves of the experimental group were significantly reduced ( Fig. 9 AC in).

[0093] The above results show that the amount of endogenous PDS gene transcripts in Shanghai green and mustard can be down-regulated by TRV-mediated VIGS technology, resulting in albino phenotypes in Shanghai green and mustard tissues. It also shows that TRV-mediated VIGS technology can be used to quickly verify the functions of Shanghai green and mustard genes.

[0094] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A VIGS silencing system for leafy vegetables based on RNA virus induction, characterized in that: The invention comprises a vector pTRV1 and a recombinant vector pTRV2 containing a target gene fragment, wherein the target gene fragment comprises any one of BrPDS, BjuPDS-g and BjuPDS-c.

2. The leafy vegetable VIGS silencing system according to claim 1, characterized in that: The nucleotide sequence of the target gene fragment BrPDS is shown as SEQ ID NO.1, the nucleotide sequence of the target gene fragment BjuPDS-g is shown as SEQ ID NO.2, and the nucleotide sequence of the target gene fragment BjuPDS-c is shown as SEQ ID NO.

3.

3. The leafy vegetable VIGS silencing system according to claim 1, characterized in that: The cloning method of the BrPDS fragment comprises: extracting the total RNA of Shanghai bluebell, reverse transcribing to obtain the first chain of cDNA, using the first chain as a template, using the nucleotide sequences shown in SEQ ID No.10 and SEQ ID No.11 as primers, and amplifying to obtain the BrPDS fragment with homology arms; The cloning method of the BjuPDS-g fragment comprises: extracting total RNA of B. juncea, reverse transcribing to obtain a first cDNA chain, using the first cDNA chain as a template, using the nucleotide sequences shown in SEQ ID No. 12 and SEQ ID No. 13 as primers, and amplifying to obtain a BjuPDS-g fragment with homology arms; The cloning method of the BjuPDS-c fragment includes: extracting total RNA of Brassica juncea, reverse transcribing to obtain the first cDNA chain, using the first cDNA chain as a template, and using the nucleotide sequences shown in SEQ ID No.14 and SEQ ID No.15 as primers to amplify the BjuPDS-c fragment with homology arms.

4. Use of the leafy vegetable VIGS silencing system according to any one of claims 1 to 3 in silencing the PDS gene of leafy vegetables, characterized in that: The recombinant vector pTRV2 containing the target gene fragment is transformed into Escherichia coli DH5α competent cells to prepare a recombinant plasmid, the recombinant plasmid and the vector pTRV1 are respectively transformed into Agrobacterium tumefaciens GV3101 competent cells to obtain a bacterial solution containing the vector pTRV1 and a bacterial solution containing the recombinant vector pTRV2, the bacterial solution containing the vector pTRV1 and the bacterial solution containing the recombinant vector pTRV2 are mixed to obtain an infection solution, and the infection solution is injected into leaves of leafy vegetables.

5. The use according to claim 4, characterized in that: The leafy vegetables are bok choy, mustard seed and cabbage mustard.

6. The use according to claim 4, characterized in that: When the infection fluid contains the recombinant vector pTRV2 connected to the BrPDS fragment, it is injected into the leaves of Shanghai green; when the infection fluid contains the recombinant vector pTRV2 connected to the BjuPDS-g fragment, it is injected into the leaves of Sporangium juncea; when the infection fluid contains the recombinant vector pTRV2 connected to the BjuPDS-c fragment, it is injected into the leaves of Bulbous mustard.

7. The use according to claim 6, characterized in that: When injected into the leaves of Shanghai Green, the infection solution OD 600 =0.3~1.0; when injected into the leaves of mustard, the infection solution OD 600 =0.5~0.8; when injected into the leaves of mustard, the infection solution OD 600 =0.5~1.

0.

8. The use according to claim 4, characterized in that: The bacterial solution containing the vector pTRV1 and the bacterial solution containing the recombinant vector pTRV2 were mixed at a volume ratio of 1:

1.

9. The use according to claim 4, characterized in that: The leafy vegetables are at the 6 true leaf stage.

10. A kit for detecting PDS gene in leafy vegetables, characterized in that: The kit comprises: A primer set for detecting the BrPDS gene of Shanghai bluegill, the nucleotide sequences of the primer set are shown in SEQ ID No.20 and SEQ ID No.21; A primer set for detecting the BjuPDS-g gene of B. juncea, wherein the nucleotide sequences of the primer set are shown in SEQ ID No. 24 and SEQ ID No. 25; A primer set for detecting the BjuPDS-c gene of Brassica juncea, wherein the nucleotide sequences of the primer set are shown in SEQ ID No.26 and SEQ ID No.27.

Images