Application of CmCAX5 gene in improving cold resistance of muskmelon

Abstract

The invention discloses an application of a CmCAX5 gene in improving the cold resistance of muskmelon. After the CmCAX5 gene is over-expressed in the muskmelon, the cold resistance of the muskmelon seedling is enhanced, and after the CmCAX5 gene is silenced, the cold resistance of the muskmelon seedling is reduced, which indicates that the gene can positively regulate the cold resistance of the muskmelon seedling stage, is an important candidate gene in genetic improvement of the cold resistance of the muskmelon, and has a certain application value in cultivation of cold-resistant muskmelon varieties.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to application of a CmCAX5 gene in improving cold tolerance of melon. Background Art

[0002] Melon is an important economic crop and occupies an important position in the global fruit production and consumption. It is deeply loved by people because of its rich nutrition, sweet and delicious taste. Melon originated in tropical and subtropical regions. It is characterized by being warm and heat-resistant. The suitable temperature for its seedling growth is 28-32℃, and it is extremely cold-resistant. At present, most of the melon facility cultivation in my country adopts two planting modes: early spring and late autumn. In the early spring production process in the north, it is very easy to suffer from low temperature damage, which causes the slow growth of melon seedlings, resulting in delayed fruit setting and fruit listing, and even affects the yield and quality of melons. At present, it is often the case that spring and autumn facility melons and open-field melons are listed at the same time, which seriously affects the benefits of spring facility cultivation. At present, there is a lack of commercial melon varieties with strong cold resistance in the Chinese market. Some popular melon varieties such as Yangjiaomi, Lubao, Huanghemi, Xizhoumi, Yugu, etc. are not strong cold-resistant melon varieties, which often faces greater risks in spring facility production of melons.

[0003] Because melon cold tolerance is a quantitative trait regulated by multiple genes, and melon genetic transformation has problems such as low efficiency and long cycle, only a few melon cold tolerance genes have been located and discovered. 2+ As a second messenger, CAX plays an important regulatory role in plant responses to various stresses. 2 / H + Antiporter protein family that utilizes the H+ concentration across the membrane to mediate Ca 2+ transport, which is important for increasing bioavailable Ca 2+ At present, there is no research report on the regulation of cold tolerance by CAX family genes in melon.

[0004] The CmCAX5 gene involved in the present invention is a member of the CAX family. The CmCAX5 gene significantly up-regulated expression in the early cold-induced period of cold-tolerant melon materials (ZTG00581, ZTG00509, and ZTG01037), and was able to respond quickly to low temperatures. Transient overexpression and VIGS silencing experiments both proved that the CmCAX5 gene could positively regulate the cold tolerance of melon seedlings. Therefore, the CmCAX5 gene has broad application prospects in the genetic improvement of cold tolerance of melons. Summary of the invention

[0005] The object of the present invention is to provide application of CmCAX5 gene in improving cold tolerance of melon.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0007] The CmCAX5 gene used in the present invention has a CDS sequence as shown in SEQ ID NO.1, or is a derivative gene having the same function as the nucleotide sequence shown in SEQ ID NO.1 by substitution, deletion and / or addition of one or more nucleotides.

[0008] The protein encoded by the CmCAX5 gene is selected from:

[0009] (1) Its amino acid sequence is shown in SEQ ID NO.2;

[0010] (2) a protein derived from (1) which is obtained by replacing, deleting or adding one or more (e.g., 1-30; preferably 1-20; more preferably 1-10; such as 5, 3) amino acid residues of the amino acid sequence of SEQ ID NO.2 and has the function of the protein of (1); or

[0011] (3) A protein derived from (1) that has 80% (preferably more than 90%, such as 95%, 98%, 99% or higher) homology with the protein sequence defined in (1) and has the function of the protein of (1).

[0012] That is to say, the functions of the genes protected by the present invention include not only the above-mentioned CmCAX5 gene, but also the functions of homologous genes with higher homology (such as higher than 80%; better higher than 90%; better higher than 95%; better higher than 98%) with SEQID NO.1 in improving the cold tolerance of plants.

[0013] The nucleotide sequence is 1374 bp as shown in SEQ ID NO.1, which is a CDS sequence. Its gene encodes a protein of 457 amino acids, and its sequence is shown in SEQ ID NO.2.

[0014] First, by analyzing the cold-induced expression level of the CmCAX5 gene in three cold-tolerant melon materials, ZTG00581, ZTG00509 and ZTG01037, the present invention found that CmCAX5 was significantly upregulated in the early stage of cold induction and responded quickly to low temperature.

[0015] Secondly, the CmCAX5 gene was transiently overexpressed in the cold-sensitive melon material ZTG01056 by cotyledon injection to obtain overexpressed plants, and then the CmCAX5 overexpressed plants (CmCAX5-OE) and negative control plants (CK) were cold treated at 4°C. By comparing the phenotypic differences in cold tolerance between the CmCAX5 overexpressed plants (CmCAX5-OE) and the negative control plants (CK) before and after cold treatment, it was clear that CmCAX5 could positively regulate the cold tolerance of melon seedlings. At the same time, by extracting total RNA from leaves and reversely transcribing cDNA, the expression of CmCAX5 gene in CmCAX5-OE and CK plants was analyzed by real-time fluorescence quantitative analysis, confirming the reliability of the phenotypic data.

[0016] Finally, the CmCAX5 gene in the cold-tolerant melon material ZTG00969 was silenced using VIGS technology to obtain silenced plants (TRSV-CmCAX5). The negative control (TRSV) and silenced plants (TRSV-CmCAX5) were cold-treated at 4°C. By comparing the phenotypic changes of the plants before and after the cold treatment, and detecting the changes in active oxygen in the leaves using NBT / DAB chemical staining, it was once again confirmed that the CmCAX5 gene positively regulated the cold tolerance of melon seedlings. At the same time, real-time fluorescence quantitative detection found that the CmCAX5 gene in the silenced plants was significantly reduced compared with the control plants.

[0017] Therefore, the main purpose of the present invention is to provide the use of the above-mentioned CmCAX5 gene or a gene expression cassette, a recombinant vector, a recombinant microorganism, and a transgenic plant cell line containing the CmCAX5 gene in improving the cold tolerance of melon. Specifically, a cold-tolerant transgenic plant can be obtained by constructing a CmCAX5 overexpression vector. The cold tolerance is manifested as follows: after cold treatment, the cold tolerance of the seedlings of the CmCAX5 gene overexpression strain is higher than that of the wild type, while the cold tolerance of the seedlings of the CmCAX5 gene silenced strain is lower than that of the wild type. The temperature of the cold treatment is 4°C.

[0018] In practical application, cold-resistant plants can be obtained by genetic modification. Specifically, the CmCAX5 gene can be introduced into the target plant to obtain a transgenic plant, which has higher cold resistance than the target plant.

[0019] Specifically, the CmEAF7 gene can be introduced into the target plant through the overexpression vector. In the method, the recombinant expression vector can be used to transform plant cells or tissues by conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, etc., and the transformed plant tissues can be cultivated into plants.

[0020] The present invention also provides a method for improving cold tolerance of melon, the method comprising:

[0021] (1) by increasing the activity of CmCAX5 protein in melon or increasing the content of CmCAX5 protein in melon;

[0022] (2) by promoting the expression of CmCAX5 gene in melon;

[0023] Specifically, the expression of CmCAX5 gene in melon is promoted by overexpression or superexpression.

[0024] In addition, the present invention also provides a plant breeding method, the method comprising:

[0025] (1) obtaining a plant with stronger cold tolerance than the target plant by increasing the activity of the CmCAX5 protein in the target plant or increasing the content of the CmCAX5 protein in the target plant;

[0026] (2) Promoting the expression of the CmCAX5 gene in the target plant to obtain a plant with stronger cold tolerance than the target plant;

[0027] (3) obtaining plants with weaker cold tolerance than the target plants by inhibiting or reducing the expression of the CmCAX5 gene in the target plants;

[0028] Specifically, the expression of the CmCAX5 gene in the target plant is promoted by overexpression or superexpression, and the expression of the CmCAX5 gene in the target plant is inhibited or reduced by silencing the CmCAX5 gene or knocking out CmCAX5.

[0029] The gene knockout includes knocking out the CmCAX5 using DNA homologous recombination technology, Cre / LoxP technology or CRISPR / Cas9 technology to obtain a transgenic plant strain.

[0030] In the present invention, there is no particular limitation on the plants applicable to the present invention, as long as they are suitable for gene transformation operations, such as various crops, flower plants or forestry plants, etc. The plants may be, for example (but not limited to): dicotyledonous plants, monocotyledonous plants, woody plants, Rosales plants, Rosaceae plants, Prunus, peach, Cruciferae plants, Arabidopsis plants, Arabidopsis thaliana, etc.

[0031] The "plant" mentioned in the present invention includes the whole plant, its parent and progeny plants and different parts of the plant, including seeds, fruits, buds, stems, leaves, roots (including tubers), flowers, tissues and organs, and our target gene or nucleic acid is present in these different parts. The "plant" mentioned here also includes plant cells, suspension cultures, callus, embryos, meristem regions, gametophytes, sporophytes, pollen and microspores, and similarly, each of the aforementioned objects contains the target gene / nucleic acid.

[0032] The present invention includes any plant cell, or any plant obtained or obtainable by the method therein, and all plant parts and propagules thereof. This patent also includes transfected cells, tissues, organs or whole plants obtained by any of the aforementioned methods. The only requirement is that the progeny exhibit the same genotypic or phenotypic characteristics, and the progeny obtained using the method of this patent have the same characteristics.

[0033] Advantages of the present invention:

[0034] The present invention constructs an overexpression vector by cloning the melon CmCAX5 gene, and then overexpresses the CmCAX5 gene in the melon. It is found that the cold tolerance of the melon seedlings is enhanced, while the cold tolerance of the melon seedlings is reduced after silencing the CmCAX5 gene, indicating that the gene can positively regulate the cold tolerance of the melon seedlings, is an important candidate gene in the molecular breeding of melon cold tolerance, and has potential application value for genetic improvement of melon cold tolerance. In practical application, the CmCAX5 gene can be introduced into the target plant to obtain a cold-tolerant melon plant, providing a new method for melon molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is the electrophoresis diagram of PCR amplified CmCAX5 gene.

[0036] Figure 2 It is the cold-induced expression level of CmCAX5 gene in three cold-tolerant melon materials (ZTG00581, ZTG00509, and ZTG01037).

[0037] Figure 3 These are the phenotypes of CmCAX5 transient overexpression plants (CmCAX5-OE) and negative control plants (CK) in the cold-sensitive melon material ZTG01056 before and after cold treatment.

[0038] Figure 4 It is the expression level of CmCAX5 gene in CmCAX5 transient overexpression plants (CmCAX5-OE) and negative control plants (CK) in the cold-sensitive melon material ZTG01056.

[0039] Figure 5 These are the plant phenotypes of the CmCAX5 transiently silenced plants (TRSV-CmCAX5) and the negative control plants (TRSV) in the cold-tolerant melon material ZTG00969 before and after cold treatment.

[0040] Figure 6 These are the NBT / DAB staining results of leaves of CmCAX5 silenced plants (TRSV-CmCAX5) and negative control plants (TRSV) in the cold-tolerant melon material ZTG00969 before and after cold treatment.

[0041] Figure 7It is the expression level of CmCAX5 gene in CmCAX5 silenced plants (TRSV-CmCAX5) and negative control plants (TRSV) in the cold-tolerant melon material ZTG00969. DETAILED DESCRIPTION

[0042] The present invention will be further described below in conjunction with specific examples, and the advantages and features of the present invention will become clearer as the description proceeds. However, the specific experimental methods involved in the following examples are all conventional methods or implemented under the conditions recommended by the manufacturer's instructions unless otherwise specified.

[0043] Unless otherwise specified, the technical means used in the examples are conventional means known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can all be purchased from the market.

[0044] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only.

[0045] The terms "nucleic acid", "nucleic acid sequence", "nucleotide", "nucleic acid molecule" or "polynucleotide" as used herein are meant to include isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), natural types, mutant types, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, single-stranded or double-stranded structures. These nucleic acids or polynucleotides include gene coding sequences, antisense sequences and regulatory sequences of non-coding regions, but are not limited to these. These terms include a gene. "Gene" or "gene sequence" is widely used to refer to a functional DNA nucleic acid sequence. Therefore, a gene may include introns and exons in a genomic sequence, and / or include a coding sequence in a cDNA, and / or include a cDNA and its regulatory sequences. In specific embodiments, such as with respect to an isolated nucleic acid sequence, it is preferably assumed to be cDNA.

[0046] The cold-resistant melon materials (ZTG00581, ZTG00509, ZTG01037, ZTG00969) and the cold-sensitive melon material ZTG01056 used in the present invention are all from the National Watermelon and Melon Germplasm Medium-term Bank, and are currently stored in Henan Agricultural University.

[0047] Example 1: Cloning of the melon CmCAX5 gene

[0048] The seeds of the cold-resistant melon material ZTG00581 were soaked in 55°C warm water, germinated, and sown in black culture pots. They were placed in an artificial climate incubator with 16h light / 8h dark and a day / night temperature of 28 / 22°C for growth. When true leaves grew, RNA was extracted from the true leaves (Code#ET101-01), and then reverse transcribed into cDNA (Code#AUQ-01). The specific operation method of the experiment refers to the instruction manual of the full-form gold kit. Design of specific primer CmCAX5-F1

[0049] (ACGGGGGACTCTTGACCATGGTAATGGATGGATTTAGGAGTAACG, including vector linker), CmCAX5-R1

[0050] The cDNA synthesized by reverse transcription was used as a template to amplify the full length of CmCAX5 CDS (1374 bp). The sequence is shown in SEQ ID NO. 1. The PCR product was electrophoresed with 1% agarose gel. The agarose gel electrophoresis pattern is shown in Figure 1 As shown, the target band was recovered using the Novozymes DNA Recovery and Purification Kit and stored at -20°C for the construction of subsequent experimental vectors.

[0051] Example 2 Analysis of cold-induced expression of CmCAX5 gene

[0052] (1) Cold treatment of cold-resistant melon materials (ZTG00581, ZTG00509, ZTG01037)

[0053] The seeds of cold-tolerant melon materials (ZTG00581, ZTG00509 and ZTG01037) were soaked in 55°C warm water, germinated, and sown in black culture pots and placed in an artificial climate incubator with 16h light / 8h dark and a day / night temperature of 28 / 22°C. When they grew to three leaves and one heart, they were cold treated at 4°C, and the third true leaf was taken at 0h, 1h, 3h, 6h, 12h and 24h, respectively. Then the samples were fully ground with a low-temperature grinder and stored in a -80°C ultra-low temperature refrigerator.

[0054] (2) Design of fluorescent quantitative primers for CmCAX5 gene

[0055] Primer5 software was used to design fluorescent quantitative primers of CmCAX5 gene (Q-CmCAX5-F: GTGGTGGTTCGCAGAAACTT; Q-CmCAX5-R: GAAGACCCAACCATGGTGAC). Then the designed primers were blasted using the Cucurbitaceae genome database, and the primers showed specificity and could be used for subsequent experiments.

[0056] (3) Fluorescence quantitative detection of CmCAX5 gene expression

[0057] Total RNA of the samples was extracted using the All-Gold RNA Extraction Kit (Code#ET101-01), and reverse transcription and real-time fluorescence quantification were performed using the All-Gold Reverse Transcription and Fluorescence Quantification Kit (Code#AUQ-01), respectively, using primers Q-CmCAX5-F and Q-CmCAX5-R. Specific experimental operations were performed according to the instructions of the kit.

[0058] Real-time fluorescence quantitative results ( Figure 2 ) showed that the CmCAX5 gene in the three cold-tolerant melon materials was significantly upregulated in the early stage of cold stress, indicating that the CmCAX5 gene responded rapidly to cold stress and its expression was upregulated to enhance the cold tolerance of melon seedlings.

[0059] Example 3 Overexpression of CmCAX5 gene improves cold tolerance of melon seedlings

[0060] (1) Construction of CmCAX5 gene overexpression vector

[0061] The empty plasmid of pCAMBIA1302-GFP overexpression vector was double digested by NcoI and SpeI restriction enzymes, and the product was purified after 37℃ digestion for 2h. The 1371bp target fragment of CmCAX5 gene without the stop codon was homologously recombined with the linearized pCAMBIA1302-GFP vector fragment by homologous recombination. The recombinant product was transferred into Escherichia coli competent cells DH5α by heat shock method, and after growing on LB plates containing kanamycin resistance for 12h, several single clones were picked for expansion culture, and positive detection was performed using pCAMBIA1302-GFP vector universal primers 35s-F (ACGCACAATCCCACTATCCTTC) and 1302-R (CGTATGTTGCATCACCTTCAC). After sequencing of positive clones, plasmids were extracted and further transformed into Agrobacterium competent cells GV3101. After growing on LB plates containing kanamycin and rifampicin resistance for 48 hours, 35s-F and 1302-R were used again for positive identification. The pCAMBIA1302-CmCAX5 recombinant bacterial solution was stored in 30% glycerol and stored at -80°C for future use.

[0062] (2) Transient overexpression of CmCAX5 gene by injection into melon cotyledons

[0063] The seeds of cold-sensitive melon material ZTG01056 were soaked in 55°C warm water, germinated, and sown in black culture pots and placed in a plant culture box with 16h light / 8h dark and a day / night temperature of 28 / 22°C for growth. Cotyledon injection was performed when the cotyledons were flattened and true leaves had not grown (4-5 days after sowing).

[0064] 3-4 days in advance, the constructed pCAMBIA1302-CmCAX5 overexpression vector (CmCAX5-OE), pCAMBIA1302-GFP negative control (CK) and P19 Agrobacterium culture were streaked and activated on LB solid plates containing 100 mg / L kanamycin and 50 mg / L rifampicin. Then, single clones were picked and added to 5 mL of LB liquid containing 100 mg / L kanamycin and 50 mg / L rifampicin, and cultured overnight on a shaker at 28°C. Then, the culture was expanded on LB solid plates containing 100 mg / L kanamycin and 50 mg / L rifampicin at a ratio of 1:100. After culturing in the dark at 28°C for 3 days, the bacteria were collected with MMA suspension (10 mM MES, 10 mMMgCl2 and 100 μM AS, 1 M KOH to adjust the pH to 5.6-6.0), and the concentration of the bacterial solution was adjusted to OD 600 The resuspended bacterial solution of overexpression and negative control was about 0.8, and then the resuspended bacterial solution of P19 was mixed with the resuspended bacterial solution of P19 in a ratio of 1:1, and cultured at 28℃ in the dark for 2-3h. After the culture, inject the back of the cotyledon with a 1mL syringe (without the needle) to fill the entire cotyledon, and then culture at 22℃ in the dark for 12-24h. Pay attention to spraying water on the surface of the leaves to prevent the edges of the leaves from withering and wilting, and then transfer to an artificial climate culture with 16h light / 8h dark, temperature 22℃, and humidity 70% for culture, and perform 4℃ cold treatment after 2-3d of culture.

[0065] (3) Identification of the function of the CmCAX5 gene by cold treatment

[0066] CmCAX5 overexpression (CmCAX5-OE) and negative control (CK) plants were cold treated in a climatic incubator at 4°C and 22000Lux light intensity. Before the cold treatment, there was no significant difference in the phenotypes of CmCAX5-OE and CK plants, but after 6 hours of cold treatment at 4°C, the two cotyledons of CK drooped significantly, while the two cotyledons of CmCAX5-OE did not change much from before the cold treatment, indicating that the cold tolerance of CmCAX5-OE plants was significantly enhanced ( Figure 3 ).

[0067] (4) Determination of CmCAX5 gene expression

[0068] The cotyledons of CmCAX5 overexpression (CmCAX5-OE) and negative control (CK) plants were taken, and the total RNA of the samples was extracted with RNA extraction solution, followed by reverse transcription and real-time fluorescence quantitative PCR. The fluorescence quantitative primers were Q-CmCAX5-F and Q-CmCAX5-R. The specific experimental operation was carried out according to the instructions of the corresponding kit. The real-time fluorescence quantitative results showed ( Figure 4 ), the expression level of CmCAX5 overexpressing plants was significantly higher than that of the negative control, indicating that CmCAX5 was overexpressed in the cotyledons of CmCAX5-OE. The results of this experiment are reliable, that is, the CmCAX5 gene positively regulates the cold tolerance of melon seedlings.

[0069] Example 4 Silencing the CmCAX5 gene reduces cold tolerance of melon seedlings

[0070] (1) Construction of CmCAX5 gene VIGS vector

[0071] The TRSV2 vector and its auxiliary vector TRSV1 used in the VIGS experiment were donated by Geng Chao from Shandong Agricultural University (Fang et al., 2021). The TRSV2 empty vector plasmid was digested with SnaBI for 2 h and then the product was purified. Specific primers within the range of 300-500 bp of the CmCAX5 gene were designed using NCBI online software:

[0072] CmCAX5-TRSV2-F:

[0073] TGTTTTAAATGCCTTTACGTATCCCAGTCGATGAGGTGGAT (including vector linker)

[0074] CmCAX5-TRSV2-R:

[0075] AACACACAAAACACCTACGTAATCCTGCAACATGAAGGCCA (including vector linker)

[0076] The above-mentioned specific primers were used to amplify the 434bp specific fragment of the CmCAX5 gene. The 434bp specific fragment of CmCAX5 was homologously recombined with the linearized TRSV2 vector fragment. The recombinant product was transferred into the Escherichia coli competent cell DH5α by the heat shock method. After growing on an LB plate containing kanamycin resistance for 12 hours, several single clones were picked for expansion culture, and positive detection was performed using the TRSV2 vector universal primer TRSV-F (TGCGTCGCACTGAGGCA) and the CmCAX5 specific primer CmCAX5-TRSV2-R. After the positive clones were sequenced correctly, the plasmid was extracted and further transferred into the Agrobacterium competent cell GV3101. After growing on an LB plate containing kanamycin and rifampicin resistance for 48 hours, the above-mentioned primers were used again for positive identification. The TRSV-CmCAX5 recombinant bacterial solution was stored in 30% glycerol and stored at -80°C for future use.

[0077] (2) Transient silencing of the CmCAX5 gene

[0078] On the first day, TRSV1, TRSV2 and TRSV-CmCAX5 Agrobacterium strains were spread on LB solid plates containing 100 mg / L kanamycin and 50 mg / L rifampicin at a ratio of 1:100 for bacterial liquid: water to expand the culture. On the second day, the seeds of cold-tolerant melon ZTG00969 were shelled, sterilized and placed in 1 / 2MS medium at 30°C for germination until the roots grew to about 1-2 cm. After the strains were cultured in the dark at 28°C for 3 days, the bacterial liquid was resuspended with melon MMA suspension (a suspension of 4.43 g / L MS, 30 g / L sucrose, 1.25 mM MES and 100 μM AS), and the OD was adjusted. 600 is about 1.0. TRSV1 was mixed with TRSV2 and TRSV2-CmCAX5 in equal proportions, and placed in a dark incubator at 28°C for 2-3 hours before subsequent vacuum infection. Melon seeds with a root length of 1-2 cm were placed in 10 mL centrifuge tubes containing TRSV1+TRSV2 and TRSV1+TRSV2-CmCAX5 resuspended bacterial solutions, respectively, and vacuumed at -0.9 MPa for 5 minutes to allow the bacterial solution to penetrate from the roots and cotyledons. After vacuum infection, the residual bacterial solution on the seeds was blotted dry with sterile filter paper, and co-cultured at 25°C in the dark for 3-5 days (co-culture medium formula: 4.43 g / L MS, 30 g / L sucrose, 1.25 mM MES, 100 μM AS and 8 g / L agar, pH 5.8). Finally, the seeds were transplanted into a culture pot and cultured in an artificial climate box at 25°C, 16 h light (22000 Lux) / 8 h dark.

[0079] (3) Identification of the function of the CmCAX5 gene by cold treatment

[0080] When the silenced plants and the control plants grew to 3-4 true leaves, they were cold treated at 4°C. Before the cold treatment, there was no significant difference in the phenotype between the CmCAX5 silenced plants (TRSV-CmCAX5) and the negative control (TRSV), but after 8 hours of cold treatment, the leaves of the CmCAX5 silenced plants wilted and drooped significantly, while the leaves of the negative control plants still performed well ( Figure 5 ). At the same time, take the second true leaf for NBT / DAB chemical staining ( Figure 6 ), and detected the reactive oxygen content of CmCAX5 silenced plants (TRSV-CmCAX5) and negative controls (TRSV) before and after cold treatment. The results showed that after cold treatment, the leaves of CmCAX5 silenced plants (TRSV-CmCAX5) were more severely damaged and accumulated more reactive oxygen than the negative control. In summary, silencing the CmCAX5 gene reduced the cold tolerance of melon seedlings.

[0081] (4) Detection of CmCAX5 gene expression in silenced plants

[0082] The third true leaf of the CmCAX5 silenced plant (TRSV-CmCAX5) and the negative control (TRSV) was taken to extract the total RNA of the samples, and then reverse transcription and real-time fluorescence quantification were performed. The fluorescence quantitative primers were Q-CmCAX5-F and Q-CmCAX5-R. The specific experimental operations were carried out according to the instructions of the corresponding kit.

[0083] Real-time fluorescence quantitative results showed that the expression level of CmCAX5 in the CmCAX5 silenced plants (TRSV-CmCAX5) was significantly lower than that in the negative control (TRSV) ( Figure 7 ), indicating that the CmCAX5 gene was successfully silenced in the CmCAX5-silenced plants. The results of this experiment are reliable, that is, the CmCAX5 gene positively regulates the cold tolerance of melon seedlings.

[0084] Sequence of SEQ ID NO.1:

[0085]

[0086] Sequence of SEQ ID NO.2:

[0087]

Claims

1. Application of CmCAX5 gene in improving cold tolerance of melon, characterized in that: The CDS sequence of the CmCAX5 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: By constructing a CmCAX5 overexpression vector, cold-tolerant transgenic plants were obtained.

3. The use according to claim 2, characterized in that: The cold tolerance is manifested as follows: after cold treatment, the cold tolerance of seedlings of the CmCAX5 gene overexpression strain is higher than that of the wild type, while the cold tolerance of seedlings of the CmCAX5 gene silenced strain is lower than that of the wild type.

4. The use according to claim 3, characterized in that: The temperature of the cold treatment is 4°C.

5. Use of a gene expression cassette, a recombinant vector, a recombinant microorganism, and a transgenic plant cell line containing the CmCAX5 gene in improving the cold tolerance of melon, characterized in that: The CDS sequence of the CmCAX5 gene is shown in SEQ ID NO.

1.

6. A method for improving cold tolerance of melon, characterized in that: The method comprises: (1) by increasing the activity of CmCAX5 protein in melon or increasing the content of CmCAX5 protein in melon; (2) by promoting the expression of CmCAX5 gene in melon; The amino acid sequence of the CmCAX5 protein is shown in SEQ ID NO.2, and the CDS sequence of the CmCAX5 gene is shown in SEQ ID NO.

1.

7. The method for improving cold tolerance of melon according to claim 6, characterized in that: The expression of CmnCAX5 gene in melon is promoted by overexpression or superexpression.

8. A plant breeding method, characterized in that: The method comprises: (1) obtaining a plant with stronger cold tolerance than the target plant by increasing the activity of the CmCAX5 protein in the target plant or increasing the content of the CmCAX5 protein in the target plant; (2) Promoting the expression of the CmCAX5 gene in the target plant to obtain a plant with stronger cold tolerance than the target plant; (3) obtaining plants with weaker cold tolerance than the target plants by inhibiting or reducing the expression of the CmCAX5 gene in the target plants; The amino acid sequence of the CmCAX5 protein is shown in SEQ ID NO.2, and the CDS sequence of the CmCAX5 gene is shown in SEQ ID NO.

1.

9. The plant breeding method according to claim 8, characterized in that: The way to promote the expression of CmCQX5 gene in the target plant is overexpression or superexpression, and the way to inhibit or reduce the expression of CmCAX5 gene in the target plant is silencing CmCAX5 gene.

10. The plant breeding method according to claim 8, characterized in that: The target plant is melon.

Images