Polynucleotides for treatment of phenylketonuria

Abstract

The present disclosure provides codon optimized polynucleotides encoding the liver enzyme phenylalanine hydroxylase. The disclosure also provides expression cassettes, vectors, viral particles or compositions containing the disclosed polynucleotides. In addition, methods and uses of these polynucleotides, expression cassettes, vectors, viral particles or compositions are also provided, including the treatment of diseases or conditions associated with PAH.

Description

[0001] priority This application claims the benefit of and priority to Application No. 2024108845103. Filed on July 2, 2024. The contents of these applications are incorporated herein by reference in their entirety for all purposes. Technical Field

[0002] The present disclosure belongs to the field of biomedicine, and in particular relates to a codon-optimized polynucleotide encoding a PAH protein, an expression frame, a vector, a viral particle and a composition comprising the polynucleotide, and use of the polynucleotide in preparing a gene therapy for treating a disease. Background Art

[0003] Phenylketonuria (PKU) is an autosomal recessive metabolic disorder characterized by a mutation in the gene for the liver enzyme phenylalanine hydroxylase (PAH), rendering the gene nonfunctional. PAH is required for the metabolism of the amino acid phenylalanine (Phe) to the amino acid tyrosine. When PAH activity is reduced, phenylalanine accumulates and is converted to phenylpyruvate (also known as phenylketone). If untreated, PKU can lead to mental retardation, seizures, and other serious medical problems. Currently, there is no cure for the disease, and the standard of care is through dietary management that minimizes foods that contain large amounts of protein. Summary of the invention

[0004] In one aspect, the present disclosure provides a polynucleotide encoding the liver enzyme phenylalanine hydroxylase, the polynucleotide being as shown in SEQ ID NO: 1 or SEQ ID NO: 5.

[0005] In another aspect, the present disclosure provides an expression cassette comprising the polynucleotide as described above.

[0006] In some embodiments, the expression cassette further comprises a promoter and / or an intron.

[0007] In some embodiments, the promoter is selected from SEQ ID NO:2.

[0008] In some embodiments, the intron is selected from SEQ ID NO:3.

[0009] In some embodiments, the expression cassette is as shown in SEQ ID NO:4.

[0010] In another aspect, the present disclosure provides a vector comprising the polynucleotide or expression cassette as described above.

[0011] In some embodiments, the vector is a viral vector.

[0012] In some embodiments, the viral vector is an adeno-associated virus (AAV) vector, an adenoviral vector, or a lentiviral vector.

[0013] In another aspect, the present disclosure provides an AAV particle comprising the vector and capsid protein as described above.

[0014] In some embodiments, the AAV is selected from serotype 1, 2, 3, 3B, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, rh10, or hu37.

[0015] In another aspect, the present disclosure provides a composition comprising the polynucleotide, expression cassette, vector or AAV particle as described above, and a pharmaceutically acceptable excipient.

[0016] In another aspect, the present disclosure provides use of a polynucleotide, expression cassette, vector, AAV particle or composition as described above in the preparation of a medicament for treating or ameliorating a disease or condition in a subject.

[0017] In some embodiments, the disease or disorder is a disease associated with the liver enzyme phenylalanine hydroxylase.

[0018] In some embodiments, the liver enzyme phenylalanine hydroxylase-related disease is phenylketonuria (PKU).

[0019] Beneficial Effects The present disclosure provides a codon-optimized polynucleotide encoding a PAH protein, which significantly improves the expression level of the PAH protein and provides a gene expression frame containing a liver-specific promoter and introns, thereby achieving a significant therapeutic effect on PAH-related diseases. BRIEF DESCRIPTION OF THE DRAWINGS The present disclosure can be more fully understood with reference to the following drawings.

[0020] Figure 1 It shows that the codon-optimized DNA sequence encoding human PAH protein increased the protein expression level in vitro. (A) The intensity of specific protein bands was quantitatively analyzed using Image J. The protein level expressed by codon-optimized PAH (co PAH) was significantly higher than that of wild-type PAH; (B) Vehicle is a control containing only culture medium, and Western-blot results also show that Huh7 cells have weak endogenous PAH expression. Values ​​are expressed as mean ± SEM; p<0.01, unpairedStudent's t-test.

[0021] Figure 2 (A) Schematic representation of the PAH gene expression box is shown. ITR: truncated AAV2 ITR sequence, HCR1: truncated liver control region-1, hAAT: truncated human α1-antitrypsin promoter, intron: human β-globulin / immunoglobulin hybrid intron, hPAH: codon-optimized human phenylalanine hydroxylase coding sequence, bGH: bovine growth hormone poly A tailing signal sequence; (B) Analysis of the purity of AAV capsid protein by SDS-PAGE; (C) Analysis of the integrity of the purified AAV5-PAH genome, 1-3 are 3 repeats.

[0022] Figure 3 Shows Pah enu2 Phenylalanine (Phe) levels in the blood of mice at different time points (1 to 24 weeks) after administration of vehicle or AAV5-hPAH (containing SEQ ID NO: 4) at four doses (vg / kg, n=3 / group) via the tail vein.

[0023] Figure 4 Adult males and females are shown Pah enu2 Mice were given vehicle or AAV5-hPAH (containing SEQ ID NO: 4) via tail vein for 8 weeks, and the cerebral cortex was collected and the levels of phenylalanine (A), 5-hydroxytryptophan (B), 5-hydroxyindoleacetic acid (C), kynurenine (D), tryptophan (E) and serotonin (F) were detected by liquid chromatography-mass spectrometry (n=5 / group). WT, wild type C57BL / 6. Homo: homozygous Pah enu2 Mouse. Values ​​are expressed as mean ± SEM; p<0.05, p<0.01, p<0.001, p<0.0001; Mann-Whitney U-test.

[0024] Figure 5 AAV5-hPAH is administered via tail vein Pah enu2 Expression levels of target DNA and hPAH in the liver of mice. Adult male Pah enu2Mice were administered 6E12 vg / kg and 2E13 vg / kg of AAV5-hPAH (containing SEQ ID NO: 4) via tail vein at week 1 (n=5 / dose), week 8 (n=5 / dose), and week 26 (n=3 / dose) for qPCR analysis of target AAV genome (VG) DNA copies (A), analysis of target gene hPAH mRNA levels (C), and Western-blot analysis of target protein hPAH (E). Adult female Pah enu2 qPCR analysis of target AAV genome (VG) DNA copies (B), analysis of target gene hPAH mRNA levels (D), and Western-blot analysis of target protein hPAH (F) were performed on mice given AAV5-hPAH (containing SEQ ID NO: 4) at 1 week (n=5 / dose), 8 week (n=5 / dose), and 26 week (n=3 / dose) via tail vein. Values ​​are expressed as mean ± SEM; p<0.05, p<0.01, p<0.001, p<0.0001; unpaired Student's t-test.

[0025] Figure 6 It shows that the codon-optimized DNA sequence encoding human PAH protein increased the protein expression level in vitro. (A) Western-blot detection was completed using a chemiluminescence imaging system (Hangzhou Shenhua Technology, SHST Capture Mini). The protein expression level of the codon-optimized PAH coding sequence PAHco1 in HepG2 cells was significantly higher than that of the wild-type PAHwt and the codon-optimized PAHco2; (B) The density of the specific target protein band was quantitatively analyzed using SHST Analysis software, and the relative expression of PAH protein was corrected using GAPDH. Values ​​are expressed as mean ± SEM; p<0.05, p<0.01, p<0.001, One-way ANOVA, Tukey's multiple comparisons test. DETAILED DESCRIPTION

[0026] The following description of the present disclosure is intended only to illustrate various different embodiments of the present disclosure. Therefore, the specific modifications discussed should not be interpreted as limiting the scope of the present disclosure. It is obvious to those skilled in the art that various different equivalents, changes and modifications can be made without departing from the scope of the present disclosure, and it should be understood that these equivalent embodiments will be included herein. All references cited herein, including publications, patents and patent applications, are incorporated herein by reference in their entirety.

[0027] Unless otherwise understood by skilled artisans, the same meaning is generally understood. As used herein, the terms "nucleotide" and "polynucleotide" are used interchangeably and refer to a polymeric form of nucleotides of any length, which may be ribonucleotides or deoxyribonucleotides. Thus, the term includes, but is not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers comprising, consisting essentially of, or consisting of purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural or derived nucleotide bases. In some embodiments, the polynucleotides described in the present disclosure comprise the sequence shown in SEQ ID NO: 1.

[0028] The term "promoter" as used herein means a control sequence, which is a region of a polynucleotide sequence that controls the initiation and rate of transcription of a coding sequence, such as a gene or a transgene. A promoter can be constitutive, inducible, repressible, or tissue-specific. In some embodiments, a promoter is used together with a polynucleotide described herein to improve transcription efficiency. In some embodiments, the promoter described herein is a liver-specific promoter, and in some embodiments, the promoter described herein is a truncated human α1-antitrypsin promoter. In some embodiments, the promoter described in the present disclosure is selected from SEQ ID NO: 2.

[0029] The term "intron" used in the present invention refers to a non-coding DNA segment. The intron of the present invention refers to a human β-globulin / immunoglobulin hybrid intron. In some embodiments, the intron of the present disclosure is selected from SEQ ID NO: 3.

[0030] The term "vector" as used herein refers to a nucleic acid comprising, consisting essentially of, or consisting of a complete replicon or terminal inverted repeat sequence, such that the vector can be stored and / or replicated when placed in a cell by, for example, a transfection, infection, or transformation process. It should be understood in the art that once inside a cell, the vector can be stored and / or replicated as an extrachromosomal (episomal) element, or can be integrated into a host cell chromosome. The vector may include nucleic acids derived from retroviruses, adenoviruses, herpes viruses, baculoviruses, modified baculoviruses, papillomaviruses, AAV viral vectors, lentiviral vectors, adenoviral vectors, alphaviral vectors, and the like, preferably, the vector described herein is selected from an AAV vector, an adenoviral vector, or a lentiviral vector.

[0031] As used herein, the term "adeno-associated virus" or "AAV" refers to members of the class of viruses associated with that name and belonging to the genus Dependoviridae of the family Parvoviridae. Adeno-associated virus is a single-stranded DNA virus that grows exclusively in cells, where certain functions are provided by a co-infecting helper virus. All AAV serotypes clearly display a homologous repThe AAV particles contain three major viral proteins, VP1, VP2 and VP3, and are essentially composed of or composed of the proteins. In an embodiment, the AAV comprises an AAV capsid protein selected from the group consisting of AAVPHP.B, AAVrh74, AAV110, AAV204, AAV214, AAV214A, AAV214e, AAV214e8, AAV214e9, AAV214e10, AAV ITB102-45, and AAV214AB. In an embodiment, AAV refers to serotype AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13, AAVrh10, AAVhu37, or any one of the AAV serotypes isolated from human and non-human mammals, or variants thereof. In embodiments, the AAV particles comprise an AAV1, AAV2, AAV2G9, AAV3, AAV3a, AAV3b, AAV3-3, AAV4, AAV4-4, AAV5, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV10, AAV11, AAV12, AAV16.3, AAV24.1, AAV27.3, AAV42.12, AAV 42-1b, AAV42-2, AAV42-3a, AAV42-3b, AAV42-4, AAV42-5a, AAV42-5b, AAV42-6b, AAV42-8, AAV42-10, AAV42-11, AAV42-12, AAV42-13, AAV42-15, AAV42-aa, AAV43-1, AAV43-12, AAV43-20, AAV43-21, AAV43-23, AAV43-25, AAV43-5, AAV44.1, AAV44.2, AAV44.5, AAV223.1, AAV223.2, AAV223.4, AAV223.5, AAV223.6,AAV223.7、AAV1-7 / rh.48、AAV1-8 / rh.49、AAV2-15 / rh.62、AAV2-3 / rh.61、AAV2-4 / rh.50、AAV2-5 / rh.51、AAV3.1 / hu.6、AAV3.1 / hu.9、AAV3-9 / rh.52 、AAV3-11 / rh.53、AAV4-8 / r11.64、AAV4-9 / rh.54、AAV4-19 / rh.55、AAV5-3 / rh.57、AAV5-22 / rh.58、AAV7.3 / hu.7、AAV16.8 / hu.10、AAV16.12 / hu.11 AV29.3 / bb.1、AAV29.5 / bb.2、AAV106.1 / hu.37、AAV114.3 / hu.40、AAV127.2 / hu.41、AAV127.5 / hu.42、AAV128.3 / hu.44、AAV130.4 / hu.48、AAV145.1 / hu.53、AAV145.5 / hu.54、AAV145.6 / hu.55、AAV161.10 / hu.60、AAV161.6 / hu.61、AAV33.12 / hu.17、AAV33.4 / hu.15、AAV33.8 / hu.16、AAV52 / hu.19、AAV 52.1 / hu.20、AAV58.2 / hu.25、AAVA3.3、AAVA3.4、AAVA3.5、AAVA3.7、AAVC1、AAVC2、AAVC5、AAV-DJ、AAV-DJ8、AAVF3、AAVF5、AAVH2、AAVrh.72、AAVhu.8. 、AAVrh.68、AAVrh.70、AAVpi.1、AAVpi.3、AAVpi.2、AAVrh.60、AAVrh.44、AAVrh.65、AAVrh.55、AAVrh.47、AAVrh.69、AAVrh.45、AAVrh.59、AAVrh.12、AAVrh. AVH6、AAVLK03、AAVH-1 / hu.1、AAVH-5 / hu.3、AAVLG-10 / rh.40、AAVLG-4 / rh.38、AAVLG-9 / hu.39、AAVN721-8 / rh.43、AAVCh.5、AAVCh.5R1、AAVcy.2、AAVcy.3、AAVcy.4、AAVcy.5、AAVCy.5R1、AAVCy.5R2、AAVCy.5R3、AAVCy.5R4、AAVcy.6、AAVhu.1、AAVhu.2、AAVhu.3、AAVhu.4、AAVhu.5、AAVhu.6、AAVhu.7、AAVhu.9、AAVhu.10、AAVhu.11、AAVhu.13、AAVhu.15、AAVhu.16、AAVhu.17、AAVhu.18、AAVhu.20、AAVhu.21、AAVhu.22、AAVhu.23、AAVhu.24、AAVhu.25、 AAVhu.27、AAVhu.28、AAVhu.29、AAVhu.29R、AAVhu.31、AAVhu.32、AAVhu.34、AAVhu.35、AAVhu.37、AAVhu.39、AAVhu.40、AAVhu.41、AAVhu.42、AAVhu.43、 AAVhu.44、AAVhu.44R1、AAVhu.44R2、AAVhu.44R3、AAVhu.45、AAVhu.46、AAVhu.47、AAVhu.48、AAVhu.48R1、AAVhu.48R2、AAVhu.48R3、AAVhu.49、AAVhu.5 1、AAVhu.52、AAVhu.54、AAVhu.55、AAVhu.56、AAVhu.57、AAVhu.58、AAVhu.60、AAVhu.61、AAVhu.63、AAVhu.64、AAVhu.66、AAVhu.67、AAVhu.14 / 9、AAVhu.t 19、AAVrh.2、AAVrh.2R、AAVrh.8、AAVrh.8R、AAVrh.10、AAVrh.12、AAVrh.13、AAVrh.13R、AAVrh.14、AAVrh.17、AAVrh.18、AAVrh.19、AAVrh.20、AAVrh.21、AAVrh.22、AAVrh.23、AAVrh.24、AAVrh.25、AAVrh.31、AAVrh.32、AAVrh.33、AAVrh.34、AAVrh.35、AAVrh.36、AAVrh.37、AAVrh.37R 2、AAVrh.38、AAVrh.39、AAVrh.40、AAVrh.46、AAVrh.48、AAVrh.48.1、AAVrh.48.1.2、AAVrh.48.2、AAVrh.49、AAVrh.51、AAVrh.52、AAVrh.53、 AAVrh.54、AAVrh.56、AAVrh.57、AAVrh.58、AAVrh.61、AAVrh.64、AAVrh.64R1、AAVrh.64R2、AAVrh.67、AAVrh.73、AAVrh.74、AAVrh.8R、AAVrh.8R A586R mutantAAVrh8R R533A mutant, AAV, BAAV, caprine AAV, bovine AAV, AAVhE1.1, AAVhEr1.5, AAVhER1.14, AAVhEr1.8, AAVhEr1.16, AAVhEr1.18, AAVhEr1.35, AAVhEr1.7, AAVhEr1.36, AAVhEr2.29, AAVhEr2.4, AAVhEr2.16, AAVhEr2.30, AAVhEr2.31, AAVhEr2.36, AAVhER1.23, AAVhEr3.1, AAV2.5T, AAV-PAEC, AAV-LK01, AAV-LK02, AAV-LK03, AAV-LK04, AAV-LK05, AAV-LK06, AAV-LK07, AAV-LK08, AAV-LK09, AAV-LK10, AAV-LK11, AAV-LK12, AAV-LK13, AAV-LK14, AAV-LK15, AAV-LK16, AAV-LK17, AAV-LK18, AAV-LK19, AAV-PAEC2, AAV-PAEC4, AAV-PAEC6, AAV-PAEC7, AAV-PAEC8, AAV-PAEC11, AAV-PAEC12, AAV-2-pre-miRNA-101, AAV-8h, AAV-8b, AAV-h, AAV-b, AAV SM 10-2, AAVShuffle 100-1, AAV Shuffle 100-3, AAV Shuffle 100-7, AAV Shuffle 10-2, AAVShuffle 10-6, AAV Shuffle 10-8, AAV Shuffle 100-2, AAV SM 10-1, AAV SM 10-8, AAVSM 100-3, AAV SM 100-10, BNP61 AAV, BNP62 AAV, BNP63 AAV, AAVrh.50, AAVrh.43, AAVrh.62, AAVrh.48, AAVhu.19, AAVhu.11, AAVhu.53, AAV4-8 / rh.64, AAVLG-9 / hu.39, AAV54.5 / hu.23, AAV54.2 / hu.22, AAV54.7 / hu.24, AAV54.1 / hu.21, AAV54.4R / hu.27, AAV46.2 / hu.28, AAV46.6 / hu.29, AAV128.1 / hu.43, true type AAV (ttAAV), UPENNAAV 10, Japanese AAV serotype 10, AAV CBr-7.1AAV CBr-7.10、AAV CBr-7.2、AAV CBr-7.3、AAVCBr-7.4、AAV CBr-7.5、AAV CBr-7.7、AAV CBr-7.8、AAV CBr-B7.3、AAV CBr-B7.4、AAVCBr-E1、AAV CBr-E2、AAV CBr-E3、AAV CBr-E4、AAV CBr-E5、AAV CBr-e5、AAV CBr-E6、AAVCBr-E7、AAV CBr-E8、AAV CHt-1、AAV CHt-2、AAV CHt-3、AAV CHt-6.1、AAV CHt-6.10、AAVCHt-6.5、AAV CHt-6.6、AAV CHt-6.7、AAV CHt-6.8、AAV CHt-P1、AAV CHt-P2、AAV CHt-P5、AAV CHt-P6、AAV CHt-P8、AAV CHt-P9、AAV CKd-1、AAV CKd-10、AAV CKd-2、AAV CKd-3、AAVCKd-4、AAV CKd-6、AAV CKd-7、AAV CKd-8、AAV CKd-B1、AAV CKd-B2、AAV CKd-B3、AAV CKd-B4、AAV CKd-B5、AAV CKd-B6、AAV CKd-B7、AAV CKd-B8、AAV CKd-H1、AAV CKd-H2、AAV CKd-H3、AAV CKd-H4、AAV CKd-H5、AAV CKd-H6、AAV CKd-N3、AAV CKd-N4、AAV CKd-N9、AAV CLg-F1、AAV CLg-F2、AAV CLg-F3、AAV CLg-F4、AAV CLg-F5、AAV CLg-F6、AAV CLg-F7、AAV CLg-F8、AAV CLv-1、AAV CLv1-1、AAV Clv1-10、AAV CLv1-2、AAV CLv-12、AAV CLv1-3、AAV CLv-13、AAV CLv1-4、AAV Clv1-7、AAV Clv1-8、AAV Clv1-9、AAV CLv-2、AAV CLv-3、AAV CLv-4、AAV CLv-6、AAV CLv-8、AAV CLv-D1、AAV CLv-D2、AAV CLv-D3、AAV CLv-D4、AAV CLv-D5、AAV CLv-D6、AAV CLv-D7、AAV CLv-D8、AAV CLv-E1、AAV CLv-K1, AAV CLv-K3, AAV CLv-K6, AAV CLv-L4, AAV CLv-L5, AAV CLv-L6, AAV CLv-M1, AAV CLv-M11, AAV CLv-M2, AAV CLv-M11, AAV CLv-M2, AAV CLv-5 CLv-M6, AAV CLv-M7, AAV CLv-M8, AAV CLv-M9, AAV CLv-R1, AAV CLv-R2, AAV CLv-R3, AAV CLv-R4, AAV CLv-R5, AAV CLv-R4, AAV CLv-R5, AAV CLv-RAV CLv-R7, AAV CLv-R8, AAV CLv-R9, AAV CSp-1, AAV CSp-10, AAV CSp-11, AAV CSp-2, AAV CSp-3, AAV CSp-4, AAV Csp-6, SAAV CSp-7, AAVCSp-8, AAV CSp-8.10, AAV CSp-8.2, AAV CSp-8.4, AAV CSp-8.5, AAV CSp-8.6, AAV CSp-8.7, AAV CSp-8.8, AAV CSp-8.9. CSp-9、AAV.hu.48R3、AAV.VR-355、AAV3B、AAV4、AAV5、AAVF1 / HSC1、AAVF11 / HSC11 、AAVF12 / HSC12、AAVF13 / HSC13、AAVF14 / HSC14、AAVF15 / HSC15、AAVF16 / HSC16、AA VF17 / HSC17,AAVF2 / HSC2,AAVF3 / HSC3,AAVF4 / HSC4,AAVF5 / HSC5,AAVF6 / HSC6,AA VF7 / HSC7, AAVF8 / HSC8, AAVF9 / HSC9, AAV-PHP.B, AAV-PHP.A, G2B -26、G2B-13、TH1.1-32、TH1.1-35、AAVPHP.B2、AAVPHP.B3、AAVPHP.N / PHP.B-DGT、 AAVPHP.B-EST、AAVPHP.B-GGT、AAVPHP.B-ATP、AAVPHP.B-ATT-T、AAVPHP.B-DGT-T 、AAVPHP.B-GGT-T、AAVPHP.B-SGS、AAVPHP.B-AQP、AAVPHP.B-QQP、AAVPHP.B-SNP( 3)、AAVPHP.B-SNP、AAVPHP.B-QGT、AAVPHP.B-NQT、AAVPHP.B-EGS、AAVPHP.B-SGN、AAVPHP.B-EGT, AAVPHP.B-DST, AAVPHP.B-DST, AAVPHP.B-STP, AAVPHP.B-PQP, AAVPHP.B-SQP, AAVPHP.B-QLP, AAVPHP.B-TMP, AAVPHP.B-TTP, AAVPHP.S / G2A12, AAVG2A15 / G2A3, AAVG2B4, AAVG2B5 and their variants.

[0032] As used herein, the term "subject" includes any human or non-human animal. The term "non-human animal" includes all vertebrates, such as mammals and non-mammals, such as non-human primates, sheep, dogs, cats, horses, cows, chickens, rats, mice, amphibians, reptiles, etc. Unless otherwise indicated, the terms "patient" or "subject" are used interchangeably. In the present disclosure, the preferred subject is a human.

[0033] As used herein, the term "treatment" refers to administering to a subject an effective amount of a polynucleotide, nucleic acid construct, vector, AAV particle or pharmaceutical composition as described herein, so that the subject has a reduction in at least one symptom of the disease or an improvement in the disease, for example, a beneficial or desired clinical outcome. For the purposes of this disclosure, beneficial or desired clinical outcomes include, but are not limited to, alleviation of one or more symptoms, reduction in the extent of the disease, stabilization of the disease state (i.e., no worsening), delay or slowing of disease progression, improvement or alleviation of the disease state, and relief (whether partial relief or total relief), whether detectable or undetectable. Treatment may refer to prolonging survival compared to the expected survival without treatment. Therefore, those skilled in the art recognize that treatment may improve the disease condition, but may not be a complete cure of the disease. As used herein, the term "treatment" includes prevention. Alternatively, treatment is "effective" in the case of a reduction or cessation of disease progression. "Treatment" may also mean prolonging survival compared to the expected survival without treatment. In some embodiments, patients in need of treatment include those who have been diagnosed with metal ion-related disorders. In some embodiments, patients in need of treatment include those who have been diagnosed with Wilson's disease and those who are at risk of developing the disease due to genetic predisposition or other factors.

[0034] Example In order to enable those skilled in the art to better understand the solutions of the present disclosure, the technical solutions in the embodiments of the present disclosure will be clearly and completely described below. Obviously, the described embodiments are only part of the embodiments of the present disclosure, rather than all of the embodiments.

[0035] Example 1: Construction of AAV plasmid The wild-type PAH sequence (SEQ ID NO: 6), codon-optimized DNA sequence 1 encoding hPAH (SEQ ID NO: 1), and codon-optimized DNA sequence 2 encoding PAH (SEQ ID NO: 9) were cloned into the plasmid backbone containing the mutant ITR (SEQ ID NO: 7), complete ITR (SEQ ID NO: 8), and kanamycin resistance gene of AAV2, respectively, to construct three plasmids: plasmid PAHwt, plasmid PAHco1, and plasmid PAHco2. Then the three plasmid DNAs were transfected into HepG2 cells, and the protein levels of PAH were compared by Western-blot analysis.

[0036] Table 3. Sequence information

[0037] Example 2: Codon-optimized DNA sequences encoding human PAH protein increase protein expression levels in vitro Huh7 cells (Meilunbio, PWE-HU045) cultured overnight in 6-well cell plates were transfected with plasmid DNA (1000 ng / well, n=4 / group) containing wild-type (wt) and codon-optimized (co) human PAH (SEQ ID NO: 1) gene expression cassettes. After about 48 hours, the cells were lysed and centrifuged at 4°C and 12,000 rpm for 15 min. The supernatant was collected and the total protein concentration was determined using a Biophotometer (Eppendorf). A certain volume of sample was mixed in loading buffer, denatured at 98°C for 5 min, and loaded on a 10% polyacrylamide gel. After SDS-PAGE, the membrane was transferred to a nitrocellulose membrane, 5% skim milk powder in TBST was added, and the membrane was left at room temperature for about 1 hour. Then, anti-human PAH-specific antibody (Sigma, HPA028407) and anti-GAPDH antibody (ABclonal, AC002) were added and reacted at 4°C overnight. After washing with TBST three times, HRP-conjugated secondary antibody was added and reacted at room temperature for about 1 hour. After washing with TBST three times, the membrane was treated with UltraSignal ECL (4AW011, 4ABiotech) and Western-blot analysis was completed. The endogenous protein GAPDH of Huh7 cells was used for correction ( Figure 1A). The intensity of specific protein bands was quantitatively analyzed using Image J. The results showed that the protein level expressed by codon-optimized PAH (co PAH) was significantly higher than that of wild-type PAH ( Figure 1 B). Compared with the control group containing only culture medium (Vehicle), Western-blot results also showed that Huh7 cells had weak endogenous PAH expression.

[0038] HepG2 cells (Chinese Academy of Sciences, Cat. No. SCSP-510) cultured overnight in 6-well cell plates were transfected with plasmid DNA (1500 ng / well, n=3 / group) containing wild-type (wt) and codon-optimized (co) human PAH gene expression cassettes using Lipofectamine 3000. Untransfected (NT) cells were used as negative controls. About 48 hours later, cells were lysed with RIPA buffer, centrifuged at 4°C and 12,000 rpm for 15 min, the supernatant was taken to determine the total protein concentration, 10 μg of the sample was mixed in loading buffer, denatured at 98°C for 5 min, and loaded on 4-12% NuPAGE Bis-Tris gel. After SDS-PAGE, the membrane was transferred to a PVDF membrane, and 5% skim milk powder in TBST was added. The membrane was left at room temperature for about 1 hour. Then, anti-PAH specific antibody (Sigma, HPA028407, diluted 1000 times) and anti-GAPDH antibody (Cell Signaling Technology, Lot: 97166, diluted 2000 times) diluted in TBST buffer containing 5% BSA were added and reacted at 4°C overnight. After washing three times with TBST, HRP-conjugated secondary antibody (Goat Anti-Rabbit IgG (H+L) (Jackson, Lot: 151083), Goat Anti-Mouse IgG (H+L) (Jackson, Lot: 150976)) diluted 2000 times in TBST containing 5% skim milk powder was added and reacted at room temperature for about 1 hour. After washing three times with TBST, the membrane was treated and Western-blot detection was completed using a chemiluminescence imaging system (Hangzhou Shenhua Technology, SHSTCapture Mini) ( Figure 6 A, and the density of the specific target protein bands was quantitatively analyzed using SHST Analysis software, and the relative expression of PAH protein was corrected using GAPDH ( Figure 6 B).

[0039] The results confirmed that the protein expression level of the codon-optimized PAH coding sequence PAHco1 (SEQ ID NO: 1) in HepG2 cells was significantly higher than that of the wild-type PAHwt (SEQ ID NO: 6) and the codon-optimized PAHco2 (SEQ ID NO: 9).

[0040] Example 3: Production and characterization of AAV5-PAH HEK293 cells (ATCC) were co-transfected with 3 plasmids (plasmid 1 was an AAV plasmid containing ITR and hPAH expression cassette, plasmid 2 was an AAV plasmid containing Rep2Cap5, and plasmid 3 was a pHelper helper plasmid) and PEIpro (Polyplus) reagent for 3 days. The cells were harvested and lysed, and the cellular DNA was removed by Benzonase treatment. AAV5-hPAH was then purified by gradient iodixanol ultracentrifugation or affinity column chromatography. The AAV genomic DNA titer was analyzed by ddPCR and universal ITR primer probe, and the purity of AAV capsid protein was analyzed by SDS-PAGE ( Figure 2 B). The purified AAV5-hPAH was denatured and then loaded onto alkaline gel to analyze the integrity of the genome ( Figure 2 C).

[0041] The results showed that by transfecting HEK293 cells with three plasmids, recombinant AAV5-hPAH with high purity and containing complete genomic DNA could be produced.

[0042] Example 4: Intravenous administration of AAV5-hPAH Pah enu2 Mice can restore blood Phe levels and correct phenotypes Adult (about 10 weeks old) C57BL / 6- pah enu2 / enu2 (Also known as Pah enu2 ) The levels of phenylalanine (Phe) in the blood of mice at different time points (1 to 24 weeks) after four doses (vg / kg, n=3 / group) of vehicle or AAV5-hPAH (containing SEQ ID NO: 4) were administered via the tail vein. The detection method was liquid chromatography-mass spectrometry (LC-MS). Pah enu2 The control group of PKU model mice was not given any medication, and the control group of normal C57BL / 6 mice was not given any medication. All animals were fed with normal feed containing 0.94-0.97%. Pah enu2The levels of phenylalanine (Phe) in the blood of mice were measured at different time points (1 to 24 weeks) after four doses (vg / kg, n=3 / group) of vehicle or AAV5-hPAH (containing SEQ ID NO: 4) were administered via the tail vein. enu2 In mice treated with AAV5-hPAH at a dose of 6E12 vg / kg or more, blood Phe levels were reduced to normal levels ( Figure 3 A). In female Pah enu2 In mice, treatment with AAV5-hPAH at a dose of 2E12 vg / kg reduced blood Phe levels relative to untreated animals, treatment with AAV5-hPAH at a dose of 6E12 vg / kg significantly reduced blood Phe levels, and treatment with AAV5-hPAH at a dose of 6E13 vg / kg or more reduced blood Phe levels to normal levels ( Figure 3 B).

[0043] Adult (about 10 weeks old) C57BL / 6-pah enu2 / enu2 (Also known as Pah enu2 ) mice were administered vehicle or AAV5-hPAH (containing SEQ ID NO: 4) via tail vein at four doses (vg / kg) before administration, and 8, 16, and 24 weeks after administration. enu2 In mice, the coat color of AAV5-hPAH treated with 6E12 vg / kg or higher doses returned to normal levels after 24 weeks of treatment. enu2 In mice, the coat color of AAV5-hPAH treated with a dose of 2E13 vg / kg or more returned to normal levels after 24 weeks ( Figure 3 C).

[0044] Embodiment 5: Pah enu2 Neurotransmitter levels in the cerebral cortex of mice can be restored to normal after AAV5-hPAH treatment Adult males and females Pah enu2Mice were given vehicle or AAV5-hPAH (containing SEQ ID NO: 4) via tail vein for 8 weeks, and the cerebral cortex was removed and the levels of phenylalanine (A), 5-hydroxytryptophan (B), 5-hydroxyindoleacetic acid (C), kynurenine (D), tryptophan (E) and serotonin (F) were detected by liquid chromatography-mass spectrometry. The cerebral cortex was removed after dissection, frozen in liquid nitrogen, and stored at -80°C. When ready for analysis, the cerebral cortex samples were homogenized, and then 0.05 g was mixed with 0.5 mL of 70% methanol, vortexed at 2500 rpm for 3 min, and then centrifuged at 4°C and 12000 rpm for 10 min. 0.3 mL of the supernatant was transferred to a centrifuge tube, placed at -20°C for 30 min, and then centrifuged again at 4°C and 12000 rpm for 10 min. Finally, 0.2 mL of the supernatant was taken and analyzed by liquid chromatography-tandem mass spectrometry (LC-MS / MS) using AB Sciex QTRAP 6500 (http: / / www.metware.cn / ).

[0045] The results showed that adults Pah enu2 Eight weeks after a single intravenous administration of AAV5-hPAH to mice, both phenylalanine and neurotransmitters in the cerebral cortex returned to normal levels, achieving significant therapeutic effects.

[0046] Example 6: AAV5-hPAH administered via tail vein Pah enu2 Expression levels of target DNA and hPAH in mouse liver Adult male Pah enu2 Mice were administered 6E12 vg / kg and 2E13 vg / kg of AAV5-hPAH (containing SEQ ID NO: 4) via the tail vein at weeks 1 (n=5 / dose), 8 (n=5 / dose), and 26 (n=3 / dose) for qPCR analysis of target AAV genomic DNA copies, analysis of target gene hPAH mRNA levels, and Western-blot analysis of target protein hPAH.

[0047] Adult female Pah enu2 Mice were administered 2E13 vg / kg and 6E13 vg / kg of AAV5-hPAH (containing the sequence SEQ ID NO: 4) via the tail vein at week 1 (n=5 / dose), week 8 (n=5 / dose), and week 26 (n=3 / dose) for qPCR analysis of target AAV genomic DNA copies, analysis of target gene hPAH mRNA levels, and Western-blot analysis of target protein hPAH.

[0048] Liver tissue was obtained after the animals were dissected, frozen in liquid nitrogen, and stored at -80°C. When analyzing the target DNA, genomic DNA was extracted using the TIANamp Genomic DNA kit (TIANGEN, 4992254), and the DNA concentration was determined using the NanoDropspectrophotometer 2000 (Thermo Fisher Scientific). Then 100 ng of DNA was used for qPCR reaction, and the instrument used was the CFX Opus 384 Real-Time PCR system (Bio-Rad). The primers used were hPAHco-F: TAAGGTTCTGCGGCTGTTT, hPAHco-R: GGTGGGTGAAGAACTCATACTC, and the probe was hPAHco-P: TGAACCTGACCCACATTGAGAGCC. The linearized plasmid DNA containing SEQ ID NO: 4 was used as a standard to analyze and calculate the copy number of the target DNA in the liver sample.

[0049] The mRNA level of the target gene hPAH was analyzed using the RT-qPCR method. Total RNA in the liver sample was extracted with TRIzol reagent (ThermoFisher Scientific, 15596026), and DNA was removed by digestion with DNase I. Reverse transcription was performed using PrimeScript™ RT Reagent Kit (TaKaRa, RR037B) to obtain cDNA, and then quantitative PCR reaction and analysis were performed using SYBRGreen PCR Master Mix (Vazyme, Q711-02) on the Bio-RAD CFX 384 Real-Time PCR System. The specific reaction conditions were: denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 10s and 60°C for 30s. Mouse GAPDH was used as an internal reference gene for calibration, and the relative expression level of hPAH was calculated using 2 (-△△Ct) method.

[0050] The target protein hPAH was analyzed by Western-blot. After quick freezing in liquid nitrogen, 7 μL of lysis buffer (1X Cocktail, 50 mM Tris-HCl, 0.5% Triton-X100, 150 mM KCl and 1 mM EDTA) was added to each mg of liver sample. After grinding, it was placed on ice for 30 min, and then centrifuged at 4°C and 12000 rpm for 30 min. The supernatant was used for Western-blot analysis. The total protein concentration was determined using a Biophotometer (Eppendorf). A certain volume of sample was mixed in the loading buffer, placed at 98°C for denaturation for 5 min, and loaded on a 10% polyacrylamide gel (10ug / well). After SDS-PAGE, the membrane was transferred to a nitrocellulose membrane, and 5% skim milk powder in TBST was added. After being placed at room temperature for about 1 hour, anti-human PAH-specific antibody (Sigma, HPA028407) and anti-GAPDH antibody (ABclonal, AC002) were added to react at 4°C overnight. After washing with TBST 3 times, HRP-conjugated secondary antibody was added to react at room temperature for about 1 hour. After washing with TBST 3 times, the membrane was treated with UltraSignal ECL (4AW011, 4A Biotech) to complete Western-blot analysis. Mouse GAPDH protein was used as an endogenous reference protein for calibration of the target protein.

[0051] AAV5-hPAH (containing SEQ ID NO: 4) containing a hepatocyte-specific promoter was administered intravenously once to adult Pah enu2 After treatment, the mice showed high levels of hPAH expression in the liver, and the protein expression level could last for at least 24 weeks. The Phe level in the blood and the neurotransmitter level in the cerebral cortex were restored to normal. The coat color of the treated animals also returned to normal, which fully proved that the liver-targeted AAV5-hPAH was effectively administered once in Pah enu2 Significant therapeutic effects were achieved in mice ( Figure 5 ).

[0052] Incorporated by Reference Each patent and scientific article mentioned herein is incorporated by reference in its entirety for all purposes.

[0053] Equivalence The present disclosure may be embodied in other specific ways without departing from its spirit or essential characteristics. Therefore, the above embodiments should be regarded as illustrative in all cases, rather than limiting the invention described herein. Therefore, the scope of the present disclosure is indicated by the appended claims rather than by the above description, and all changes within the equivalent meaning and scope of the claims are intended to be covered therein.

Claims

1. A polynucleotide encoding the liver enzyme phenylalanine hydroxylase, the polynucleotide being as shown in SEQ ID NO: 1 or SEQ ID NO:

5. An expression cassette comprising the polynucleotide according to claim 1.

3. The expression cassette of claim 2, further comprising a promoter and / or an intron.

4. The expression cassette of claim 2, wherein the promoter is selected from SEQ ID NO:

2.

5. The expression cassette of claim 2, wherein the intron is selected from SEQ ID NO:

3.

6. The expression cassette according to any one of claims 2 to 5, wherein the expression cassette is shown in SEQ ID NO:

4.

7. A vector comprising the polynucleotide of claim 1 or the expression cassette of any one of claims 2 to 6.

8. The vector of claim 7, wherein the vector is a viral vector.

9. The vector of claim 8, wherein the viral vector is an adeno-associated virus (AAV) vector, an adenoviral vector, or a lentiviral vector.

10. An AAV particle comprising the vector according to any one of claims 7 to 9 and a capsid protein.

11. The AAV particle of claim 10, wherein the AAV is selected from serotype 1, 2, 3, 3B, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, rh10, or hu37.

12. A composition comprising the polynucleotide of claim 1, the expression cassette of any one of claims 2 to 6, the vector of any one of claims 7 to 9 or the AAV particle of claim 10 or 11, and a pharmaceutically acceptable excipient.

13. Use of a polynucleotide as claimed in claim 1, an expression cassette as claimed in any one of claims 2 to 6, a vector as claimed in any one of claims 7 to 9, an AAV particle as claimed in claim 10 or 11, or a composition as claimed in claim 12 in the preparation of a medicament for treating or ameliorating a disease or condition in a subject.

14. The use according to claim 13, wherein the disease or disorder is a disease related to the liver enzyme phenylalanine hydroxylase.

15. The use according to claim 14, wherein the liver enzyme phenylalanine hydroxylase-related disease is phenylketonuria.

Images