Visual transformation method and application of cyclic genome virus

Abstract

The invention provides a visual transformation method and application of a cyclic genome virus, and belongs to the technical field of biological medicines. The invention provides a modified viral genome. The modified viral genome is characterized in that a tetracysteine tag is inserted into the 3'end of a target gene of a viral cyclic genome. According to the invention, a small molecule tetracysteine tag is inserted into a virus genome, so that a basis is provided for virus protein tracing. According to the invention, a gene engineering method is adopted, and a small molecule tetracysteine tag is inserted into the C terminal of the Cap protein, so that the visualization of the virus in a living cell is helped to be realized.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a method and application for visualizing and transforming a circular genome virus. Background Art

[0002] Porcine circovirus type 2 (PCV2), as the main pathogen of multisystemic wasting syndrome in weaned piglets, has become one of the important animal disease pathogens that seriously threaten the healthy development of the pig farming industry. PCV2 attacks the pig's immune system and has a strong resistance to the external environment. It can exist and spread in the pig herd for a long time in the form of latent infection or persistent infection. At present, the occurrence of the disease can be well controlled clinically through vaccine immunization, but PCV2 cannot be completely eliminated. Therefore, the replication mechanism of PCV2 still needs more in-depth research.

[0003] In the process of virology research, the construction of virus tracing system is an important tool for studying the biological function of viruses. Recombinant fluorescent virus is one of the most commonly used virus tracing systems, but due to the small size and circular structure of PCV2 genome, it is difficult to construct recombinant virus with large molecular fluorescent tags such as GFP due to the limited capacity of viral genome, so there are few reports on PCV2 tracing virus. Summary of the invention

[0004] The present invention provides a method and application for visual transformation of circular genome viruses, inserting a small molecule tetracysteine ​​tag into the viral genome, thereby achieving visual tracking of viral protein expression with a small genome and a circular structure.

[0005] The present invention provides a modified viral genome, comprising inserting a tetracysteine ​​tag into the 3' end of a target gene of a circular genome of a circular genome virus.

[0006] The invention provides a PCV2 infectious clone recombinant plasmid, comprising transforming a vector containing the whole genome of PCV2 virus, wherein the transformation comprises inserting a tetracysteine ​​tag into the 3' end of the cap gene of the vector containing the whole genome of PCV2 virus.

[0007] In one embodiment of the present invention, the amino acid sequence of the tetracysteine ​​tag is shown as SEQ ID No.1 or SEQ ID No.2.

[0008] The present invention also provides a method for constructing the above-mentioned PCV2 infectious clone recombinant plasmid, comprising the following steps: using a vector containing the whole genome of PCV2 virus as a template, amplifying a gene fragment carrying the tetracysteine ​​tag;

[0009] The gene fragment is inserted into a T vector to construct the PCV2 infectious clone recombinant plasmid.

[0010] In one embodiment of the present invention, the amplifying includes amplifying to obtain no less than one gene fragment carrying a homologous sequence.

[0011] In one embodiment of the present invention, when two gene fragments carrying homologous sequences are amplified, the sequences of the primers used for amplification are as shown in SEQ ID No.3 to SEQ ID No.6, or as shown in SEQ ID No.3, SEQ ID No.7, SEQ ID No.5 and SEQ ID No.8.

[0012] In one embodiment of the present invention, the T vector comprises a linearized backbone vector obtained by double enzyme digestion based on a vector containing the whole genome of PCV2 virus;

[0013] The enzyme used for the double enzyme digestion is compatible with the enzyme digestion site contained in the gene fragment carrying the tetracysteine ​​tag.

[0014] In one embodiment of the present invention, the enzymes used for the double digestion include HindIII and BamH I.

[0015] The present invention also provides a recombinant virus obtained by rescuing the above-mentioned viral genome or the above-mentioned PCV2 infectious clone recombinant plasmid or the PCV2 infectious clone recombinant plasmid constructed by the above-mentioned construction method.

[0016] The present invention also provides the use of the above-mentioned viral genome or the above-mentioned PCV2 infectious clone recombinant plasmid or the PCV2 infectious clone recombinant plasmid or the above-mentioned recombinant virus constructed by the above-mentioned construction method in visually tracking the expression of viral proteins in living cells.

[0017] Beneficial effects: The present invention provides a viral genome, including a tetracysteine ​​tag inserted into the 3' end of the target gene of the circular genome of the circular genome virus. The present invention provides a basis for protein tracing of the virus by inserting a small molecule tetracysteine ​​tag into a virus with a small genome and a circular genome. The present invention adopts a genetic engineering method to insert a small molecule tetracysteine ​​tag into the C-terminus of the Cap protein of PCV2 to help realize the visualization of the virus in living cells. During specific tracing, under the action of the double arsenic fluorescent marker dye, the membrane-permeable double arsenic fluorescent marker dye enters the cell without affecting the cell activity, and exerts its effect by covalently binding to the tetracysteine ​​tag (Tetracysteine ​​Tag, TC tag) attached to a specific part of the recombinant target protein, thereby realizing real-time observation of protein expression in living cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The plasmid maps are pMD18-T-PCV2-Cap-TC1 (A) and PCV2-TC1 (B);

[0019] Figure 2 The plasmid maps are pMD18-T-PCV2-Cap-TC2 (A) and PCV2-TC2 (B);

[0020] Figure 3 For identification of pMD-18T-PCV2-Cap-TC recombinant plasmid, A in the figure: pMD-18T-PCV2-Cap-TC recombinant plasmid enzyme digestion identification results, wherein lane 1 is pMD-18T-PCV2-Cap-TC1 negative plasmid, lane 2 is pMD-18T-PCV2-Cap-TC1 positive plasmid, lanes 3 and 4 are both pMD18-T-PCV2-Cap-TC2 positive plasmid; B: pMD-18T-PCV2-Cap-TC recombinant plasmid sequencing identification results;

[0021] Figure 4 This is the result of IFA identification of PCV2-TC recombinant strain;

[0022] Figure 5 The figure is the identification result of the 17th generation PCV2-TC recombinant virus, in which A: PCR identification result of the 17th generation PCV2-TC recombinant virus; B: genome sequencing identification result of the 17th generation PCV2-TC recombinant virus;

[0023] Figure 6 This is a diagram showing the identification results of the PCV2-TC tetracysteine ​​tag. DETAILED DESCRIPTION

[0024] The present invention provides a modified viral genome, comprising inserting a tetracysteine ​​tag into the 3' end of a target gene of a circular genome of a circular genome virus.

[0025] The circular genome virus of the present invention can be a currently known virus with a small genome and a circular structure, such as the PCV2 virus used in one embodiment. The present invention utilizes biological genetic engineering methods to insert a TC Tag into the 3' end of a specific protein in the genome.

[0026] The invention provides a PCV2 infectious clone recombinant plasmid, comprising transforming a vector containing the whole genome of PCV2 virus, wherein the transformation comprises inserting a tetracysteine ​​tag into the 3' end of the cap gene of the vector containing the whole genome of PCV2 virus.

[0027] The present invention does not specifically limit the source of the vector containing the full genome of PCV2 virus. The PCV2 genome can be amplified by conventional methods in the art and then inserted into the T vector. For example, in the embodiment, PCV2 HZ0201 strain is taken as an example, and the full-length genome of PCV2 HZ0201 is amplified by referring to the method of Chen Tingfei et al. (Chen Tingfei, Zhou Jiyong, Chen Qingxin, et al. Infectivity analysis of molecular clone of porcine circovirus type 2 HZ0201 strain [J]. Chinese Journal of Preventive Veterinary Medicine, 2007, 29(2): 86-91.), and then connected to pMD18-T to obtain the vector pMD18-T-PCV2 containing the full genome of PCV2 virus.

[0028] The present invention transforms the vector containing the whole genome of PCV2 virus, that is, inserts the TC Tag at the 3' end of the cap gene, and the amino acid sequence of the TC Tag can be as shown in SEQ ID No.1: FLNCCPGCCMEP (TC1 Tag), or as shown in SEQ ID No.2: CCPGCC (TC2 Tag). The transformation method of the present invention can be homologous recombination method or other methods.

[0029] The present invention also provides a method for constructing the above-mentioned PCV2 infectious clone recombinant plasmid, comprising the following steps: using a vector containing the whole genome of PCV2 virus as a template, amplifying a gene fragment carrying the tetracysteine ​​tag;

[0030] The gene fragment is inserted into a T vector to construct the PCV2 infectious clone recombinant plasmid.

[0031] In the embodiment of the present invention, the TC Tag is inserted into the C-terminus of the Cap protein by homologous recombination to help realize the visualization of PCV2 in living cells.

[0032] The present invention first uses a vector containing the whole genome of PCV2 virus as a template to amplify a gene fragment carrying the TC Tag, and during the amplification, no less than one gene fragment carrying a homologous sequence can be amplified, such as two genome fragments. In the embodiment, the TC Tag is inserted into the 3' end of the cap gene by genetic engineering technology to obtain PCV2 infectious clone recombinant plasmids: pMD18-T-PCV2-Cap-TC1 and pMD18-T-PCV2-Cap-TC2, wherein the TC Tag inserted into pMD18-T-PCV2-Cap-TC1 is TC1 Tag, and the TC Tag inserted into pMD18-T-PCV2-Cap-TC2 is TC2 Tag.

[0033] Table 1 Primer information used to construct recombinant plasmids

[0034]

[0035] Using the primer pairs in Table 1, the annealing temperature of primer pair ZAI-1 and TC1-F was 55°C, the extension time was 43.7s, and the amplified A fragment was 1456bp; the annealing temperature of primer pair ZAI2 and TC1-R was 62°C, the extension time was 13.7s, and the amplified B fragment was 457bp; the annealing temperature of primer pair ZAI-1 and TC2-F was 55°C, the extension time was 43.7s, and the amplified C fragment was 1449bp; the annealing temperature of primer pair ZAI-2 and TC2-R was 62°C, the extension time was 13.7s, and the amplified D fragment was 443bp. In Table 1, the underlined part of ZAI-1 is the HindIII restriction site, and the underlined part of ZAI-2 is the BamH I restriction site.

[0036] In one embodiment of the present invention, PCR amplification was performed using the specific primers designed in Table 1 and using NEB PCRsing High-Fidelity DNA Polymerase was used for PCR amplification. The system, in 50 μL, included: Q5 High-Fidelity DNA Polymerase 0.5 μL, 5X Q5 Reaction Buffer 10 μL, dNTPMix 1 μL, Forward Primer (40 μM) 0.625 μL, Reverse Primer (40 μM) 0.625 μL, pMD18-T-PCV2 (10 ng / μL) 1 μL and the balance ddH2O. The amplification program was: 98°C pre-denaturation for 30 s; 98°C denaturation for 10 s, annealing for 20 s, 72°C extension for 20-30 s / kb, 30 cycles; 72°C extension for 2 min.

[0037] In one embodiment of the present invention, the T vector includes a linearized backbone vector obtained after double enzyme digestion based on a vector containing the whole genome of PCV2 virus; the enzyme used for the double enzyme digestion is compatible with the restriction site contained in the gene fragment carrying the four cysteine ​​tags. In the embodiment of the present invention, pMD18-T-PCV2 is used as the original vector, and double enzyme digestion is performed using HindIII and BamH I to recover fragment E. The double enzyme digestion system of the present invention is calculated in 50 μL, including: HindIII 0.5 μL, BamH I 0.5 μL, 10×quick cut buffer 5 μL, pMD18-T-PCV2 4 μg and the balance ddH2O; 37°C water bath for 1 hour.

[0038] The present invention mixes the purified fragments A and B or fragments C and D with fragment E in a certain ratio according to the product concentration, performs homologous recombination, and obtains a PCV2 infectious clone recombinant plasmid. In one embodiment of the present invention, the homologous recombination is performed using ClonExpress Ultra One Step Cloning Kit V2 of Novogene, and the connection system is calculated in 10 μL, including: 2×CE Mix 5 μL, 0.03 pmol of each fragment A+B+E (or C+D+E) and the balance ddH2O; and is treated at 50°C for 15 minutes.

[0039] The present invention also provides a recombinant virus obtained by rescuing the above-mentioned viral genome or the above-mentioned PCV2 infectious clone recombinant plasmid or the PCV2 infectious clone recombinant plasmid constructed by the above-mentioned construction method.

[0040] In one embodiment of the present invention, PK-15 cells are used as hosts to rescue recombinant viruses. During operation, PK-15 cells are inoculated into 96-well plates, 200 μL per well, and cultured in a 37°C 5% CO2 incubator. When the cells are covered with about 90%, the cells are transfected by GET mediation. The transfection system is as follows: 0.4 μg DNA and 0.8 μL GET are added to 12.5 μL buffer, and replaced with DMEM medium containing 5% serum after 12 hours. After 48 hours of cultivation, the cells are blindly propagated for 20 generations in a row, and part of the cells are plated every 2 generations for IFA identification to detect whether the infectious clone is successful, and the cells and supernatants of each generation are preserved.

[0041] The present invention also provides the use of the above-mentioned viral genome or the above-mentioned PCV2 infectious clone recombinant plasmid or the PCV2 infectious clone recombinant plasmid or the above-mentioned recombinant virus constructed by the above-mentioned construction method in visually tracking the expression of viral proteins in living cells.

[0042] The visual tracking described in the present invention is based on a double arsenic dye-tetracysteine ​​labeling system. After the membrane-permeable double arsenic fluorescent labeling dye enters the cell, it does not affect the cell activity. It works by covalently binding to the TC Tag sequence connected to a specific part of the recombinant target protein, and the expression of the protein can be observed in real time in living cells. In one embodiment of the present invention, the double arsenic dye FlAsH-EDT2 (green) was used for verification, and it was found that after the recombinant virus was used to infect PK-15 cells, the Cap protein was incubated in the dark with the FlAsH-EDT2 (green) double arsenic dye for a period of time, and then IFA verification was performed on the Cap protein. It was found that green fluorescence could be observed, indicating that the Cap protein carrying the TC Tag can be successfully expressed in the cell.

[0043] In order to further illustrate the present invention, a circular genome virus visualization transformation method and application provided by the present invention are described in detail below in combination with the embodiments, but they should not be understood as limiting the scope of protection of the present invention.

[0044] Example 1

[0045] Using the PCV2 HZ0201 strain full genome vector pMD18-T-PCV2 as a template, a tag (TC Tag) was inserted into the 3' end of the cap gene through genetic engineering technology to obtain a PCV2 infectious clone recombinant plasmid: Figure 1 pMD18-T-PCV2-Cap-TC1 and Figure 2 pMD18-T-PCV2-Cap-TC2 shown in A. PCV2 infectious clone recombinant strains were obtained by transfecting cells: Figure 1 PCV2-TC1 and Figure 2 PCV2-TC2 shown in B.

[0046] Step 1: Construction of infectious clone PCV2-TC:

[0047] (1) Primer design

[0048] GenScript Biotech was commissioned to synthesize the primers listed in Table 1.

[0049] (2) PCR amplification

[0050] The PCV2 HZ0201 strain full genome vector pMD-18T-PCV2 was used as a template and the specific primers in Table 1 were used by NEB PCR Using High-Fidelity DNA Polymerase amplified the A+B and C+D fragments of the plasmid respectively.

[0051] After the PCR was completed, the PCR product was electrophoresed on a 0.8% agarose gel for verification; DpnI enzyme was added to the PCR product to digest the template at 37°C for 20 minutes, and then recovered.

[0052] (3) Construction of infectious clone plasmid pMD-18T-PCV2-Cap-TC

[0053] pMD18-T-PCV2 was double-digested with HindIII and BamH I, and fragment E was obtained by gel excision and recovery.

[0054] Then, the purified fragments A, B or fragments C, D and fragment E were mixed in a certain ratio according to the product concentration. Homologous recombination was performed using ClonExpress Ultra One Step Cloning Kit V2 of Novogene.

[0055] The ligation product was transformed into TOP10 competent cells, spread on ampicillin resistance plates, picked and shaken, and the plasmid was extracted. After the recombinant plasmid was identified by ECoR I restriction enzyme digestion, the positive plasmid was sequenced.

[0056] After EcoR I digestion, two bands of different sizes appeared at 2000 bp, which was consistent with the size of pMD-18T empty vector and PCV2 genome ( Figure 3 A in the middle, which is a positive plasmid with successful connection, otherwise it is a negative plasmid. The plasmid verified by enzyme digestion was sent to Jinweizhi Biological Company for sequencing, and the sequencing results showed that the tag was successfully inserted ( Figure 3 (middle B).

[0057] Step 2: Transfection, passage and identification of PCV2 infectious clones in PK-15 cells

[0058] (1) Preparation of PCV2 genome

[0059] The recombinant plasmid was prepared in large quantities, digested with EcoR I, subjected to nucleic acid electrophoresis, and the viral genome was recovered by gel excision. After concentration determination, the linear PCV2 genome was circularized in vitro using T4 DNA ligase.

[0060] 10μL ligation system: T4 ligase 1μL, DNA 0.3 pmol, 1μL 10× buffer and the balance ddH2O; 16°C, overnight ligation.

[0061] (2) Transfection of recombinant plasmid into PK-15 cells

[0062] PK-15 cells were inoculated into 96-well plates, 200 μL per well, and cultured in a 37°C 5% CO2 incubator. When the cells were about 90% confluent, the cells were transfected by GET. The specific transfection steps were as follows: 0.4 μg DNA and 0.8 μL GET were added to 12.5 μL buffer, and the medium was replaced with DMEM medium containing 5% serum after 12 hours. After 48 hours of culture, the cells were blindly propagated for 20 generations. Every 2 generations, some cells were plated for indirect immunofluorescence assay (IFA) to detect whether the infectious clone was successful, and the cells and supernatants of each generation were saved.

[0063] Identification by indirect immunofluorescence experiment: The cells were harvested 48 hours after transfection and recorded as the P0 generation rescued virus. The virus was continuously subcultured to about the 20th generation. The cells were tested by IFA every 2 generations. If an obvious Cap positive signal appeared in the IFA result, it indicated that the PCV2 infectious clone was successful.

[0064] The cells were fixed with frozen methanol at -20°C for 20 min, then the fixative was discarded and the cells were placed in a fume hood to dry. The primary antibody was then incubated. Cap monoclonal mouse antibody 5E11 was added to PBS at a ratio of 1:2000. The monoclonal antibody was prepared and preserved by our laboratory and has been published in the article (Shang Shaobin. Fine positioning of porcine circovirus capsid protein antigen epitopes and indirect ELISA detection technology [D]. Zhejiang University, 2007.). After mixing, 50-100 μL was added to each well and incubated at 37°C for 1 h. After the primary antibody incubation, the cells were washed 3 times with PBS, each time for 3 min. After washing, the secondary antibody was incubated. FITC goat anti-mouse fluorescent secondary antibody was added to PBS at a ratio of 1:400 (the secondary antibody was purchased from Jackson ImmunoResearch, catalog number: 166656), add 100 μL to each well after mixing, incubate at 37°C in the dark for 1 hour; wash with PBS 3 times after incubation, and then immediately observe and record the results under an inverted fluorescence microscope. Use IFA experiment to detect whether PCV2 recombinant strains have appeared in the cells, such as Figure 4 As shown, the IFA results all showed obvious Cap positive signals, indicating that the PCV2 recombinant virus was successfully rescued.

[0065] (3) Sequencing verification

[0066] Viral DNA was extracted from the supernatant and cells collected during the blind culture process using a DNA extraction kit: add 0.6 ml of solution A to 0.2 ml of sample, shake for 30 seconds to mix, and place at room temperature for 10 minutes. After a brief centrifugation, transfer the solution to the adsorption column and place at room temperature for 2 minutes. Centrifuge at 12,000 rpm for 1 minute at room temperature, discard the flow-through, and return the adsorption column to the collection tube. Add 0.7 ml of universal column wash solution to the adsorption column, centrifuge at 12,000 rpm for 1 minute at room temperature, discard the flow-through, and return the adsorption column to the collection tube. Centrifuge at 12,000 rpm for 1 minute at room temperature, and discard the centrifuge tube containing the flow-through. Put the adsorption column into a new 1.5 ml centrifuge tube, add 30 μl of DNA elution solution to the middle of the filter membrane of the adsorption column, and then place at room temperature for 2 minutes. Centrifuge at 12,000 rpm for 1 minute at room temperature to obtain a DNA solution.

[0067] The DNA was then amplified by PCR, with a 25 μL PCR reaction system: 12.5 μL 2× PhantaFlashMasterMix (DyePlus), 0.25 μL PCV2-1 (40 μM), 0.25 μL PCV2-2 (40 μM), 20 ng viral DNA, and the balance ddH2O;

[0068] Reaction program: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 60°C for 5 s, extension at 72°C for 10 s, 30 cycles; extension at 72°C for 1 min.

[0069] Primer sequences:

[0070] PCV2-1 (SEQ ID No. 9): AACCTTAACCTTTCTTATTCTGTAGTATTC;

[0071] PCV2-2 (SEQ ID No. 10): GAATTCTGGCCCTGCTCCCCGATCACCCAGGGTGAC.

[0072] PCR results are as follows Figure 5 As shown in A, the recovered samples were sequenced, and the sequencing results were as follows Figure 5 As shown in B, the tag was successfully inserted into the viral genome.

[0073] (4) Tetracysteine ​​tag verification

[0074] The PK-15 cells infected with PCV2-TC were washed once with HBSS and then incubated with 3 μM FlAsH-EDT2 (green) double arsenic dye at 37°C in the dark for 30 min. They were washed twice with 250 μM BAL Wash Buffer. They were then fixed with frozen formaldehyde and the Cap protein was verified by IFA in the same way as the above IFA steps. The results are shown in Figure 2. Figure 6 As shown, green fluorescence can be observed, indicating that the Cap protein carrying the TC Tag can be successfully expressed in the cells.

[0075] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A modified viral genome, characterized in that: The method comprises inserting a tetracysteine ​​tag at the 3' end of the target gene in the circular genome of the circular genome virus.

2. A porcine circovirus type 2 infectious clone recombinant plasmid, characterized in that: The invention comprises transforming a vector containing the whole genome of porcine circovirus type 2 virus, wherein the transformation comprises inserting a tetracysteine ​​tag into the 3' end of the cap gene of the vector containing the whole genome of porcine circovirus type 2 virus.

3. The porcine circovirus type 2 infectious clone recombinant plasmid according to claim 2, characterized in that: The amino acid sequence of the tetracysteine ​​tag is shown as SEQ ID No.1 or SEQ ID No.

2.

4. The method for constructing the porcine circovirus type 2 infectious clone recombinant plasmid according to claim 2 or 3, characterized in that: The following steps are involved: Amplifying a gene fragment carrying the tetracysteine ​​tag using a vector containing the whole genome of porcine circovirus type 2 as a template; The gene fragment is inserted into a T vector to construct the porcine circovirus type 2 infectious clone recombinant plasmid.

5. The construction method according to claim 4, characterized in that: During the amplification, the step includes amplifying at least one gene fragment carrying a homologous sequence.

6. The construction method according to claim 5, characterized in that: When two gene fragments carrying homologous sequences are obtained by amplification, the sequences of the primers used for amplification are shown as SEQ ID No.3 to SEQ ID No.6, or as shown as SEQ ID No.3, SEQ ID No.7, SEQ ID No.5 and SEQ ID No.

8.

7. The construction method according to claim 4, characterized in that: The T vector comprises a linearized backbone vector obtained after double restriction digestion based on a vector containing the whole genome of porcine circovirus type 2 virus; The enzyme used for the double enzyme digestion is compatible with the enzyme digestion site contained in the gene fragment carrying the tetracysteine ​​tag.

8. The construction method according to claim 7, characterized in that: The enzymes used for the double digestion include HindIII and BamH I.

9. A recombinant virus obtained by rescuing the viral genome of claim 1, the porcine circovirus type 2 infectious clone recombinant plasmid of claim 2 or 3, or the porcine circovirus type 2 infectious clone recombinant plasmid constructed by the construction method of any one of claims 4 to 8.

10. Use of the viral genome of claim 1, the porcine circovirus type 2 infectious clone recombinant plasmid of claim 2 or 3, the porcine circovirus type 2 infectious clone recombinant plasmid constructed by the construction method of any one of claims 4 to 8, or the recombinant virus of claim 9 in visually tracking the expression of viral proteins in living cells.

Images