Application of TaCBSX3 gene and protein coded by TaCBSX3 gene in improvement of wheat conversion efficiency

Abstract

The invention discloses application of a TaCBSX3 gene and a protein coded by the TaCBSX3 gene to improvement of wheat transformation efficiency, and belongs to the technical field of plant genetic engineering. According to the invention, the wheat TaCBSX3 gene is cloned, the TaCBSX3 gene is introduced into wheat varieties Yandai 1817 and Konnong 9204 which are difficult to transform, and the result shows that the TaCBSX3 gene can greatly improve the transformation efficiency of the wheat varieties which are difficult to transform, solves the problem of limitation of wheat transformation genotypes, and provides a new regenerated gene for genetic transformation of wheat.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to application of TaCBSX3 gene and protein encoded by the same in improving wheat transformation efficiency. Background Art

[0002] Genetic transformation is one of the most commonly used methods for wheat gene function research and agronomic trait improvement, and has become a powerful tool for wheat biological breeding. Genetic transformation is an effective means to improve existing varieties, and it provides an opportunity for the targeted improvement of wheat materials with important and excellent traits.

[0003] Efficient wheat regeneration is an important basis for genetic transformation, but because wheat is an allohexaploid with complex genetic characteristics, it is difficult to use transgenic technology for genetic transformation. In vitro tissue culture of wheat generally has problems such as low regeneration efficiency and strong dependence on genotype and explants, which has become the main factor restricting the development of wheat biological breeding. Among Chinese wheat varieties (lines), only a few varieties (lines) such as Kenong 199 and CB037 have a transformation efficiency of more than 20%, while the transformation efficiency of wheat varieties such as Jimai 22, Aikang 58, Jing 411, Zhongmai 895, Yangmai 16, Chunmai 42, Shi 4185, Shiluan 02-1, and Lunxuan 987 is less than 10% (Wang et al., 2017).

[0004] In order to improve the genetic transformation efficiency of wheat, studies have found that the introduction of genes such as GRF4-GIF1 (Debernardi et al., 2020; Qiu et al., 2022), TaWOX5 (Wang et al., 2022), TaDOF3.4 and TaDOF5.6 (Liu et al., 2023) into different wheat varieties can significantly improve the transformation efficiency, indicating that the use of regeneration-related genes can effectively overcome the genotype dependence of wheat genetic transformation. However, the number of regeneration genes that have been isolated is still small, and further isolation of new genes that can improve the efficiency of wheat regeneration and genetic transformation is of great significance for improving crop agronomic traits and promoting biotechnology breeding. Summary of the invention

[0005] In view of the above-mentioned prior art, the object of the present invention is to provide the application of TaCBSX3 gene and the protein encoded by it in improving the transformation efficiency of wheat.

[0006] To achieve the above object, the present invention adopts the following technical solution:

[0007] The first aspect of the present invention provides the use of the TaCBSX3 gene in promoting the introduction of nucleic acid molecules into target plants;

[0008] The TaCBSX3 gene is a DNA molecule as shown in the following i) or ii) or iii):

[0009] i) the nucleotide sequence is the DNA molecule shown in SEQ ID NO.1;

[0010] ii) DNA molecules that have 80% or more homology with the nucleotide sequence of i) and express proteins with the same or similar functions, as well as the corresponding alleles, homologous genes, mutant genes and derivative genes;

[0011] iii) A DNA molecule encoding the amino acid sequence shown in SEQ ID NO. 2 except i).

[0012] The term "homology" as used herein refers to sequence similarity to a natural nucleic acid sequence. Homology can be evaluated using computer software, such as the BLAST algorithm (Altschul et al. 1990. Journal of Molecular Biology 215: 403-410; Karlin and Altschul. 1993. Proceedings of the National Academy of Sciences 90: 5873-5877).

[0013] In the above nucleic acid molecules, the 80% or more homology may be at least 80%, 85%, 90%, 95%, 96%, 98% or 99% homology.

[0014] The second aspect of the present invention provides the use of the protein encoded by the TaCBSX3 gene in the following (1) or (2):

[0015] (1) Improving the transformation efficiency of nucleic acid molecules into target plants;

[0016] (2) Improve the regeneration efficiency of young embryos of target plants.

[0017] Preferably, the protein encoded by the TaCBSX3 gene is a protein as shown in any one of the following (A1) or (A2) or (A3):

[0018] (A1) a protein consisting of the amino acid sequence shown in SEQ ID NO.2 in the sequence listing;

[0019] (A2) A fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1).

[0020] (A3) The encoded protein is similar to the protein shown in SEQ ID NO. 2, or a protein obtained by substitution, deletion or insertion of one, several or dozens of amino acids.

[0021] The proteins described in (A1), (A2) and (A3) can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0022] In the above proteins, the protein tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. In order to facilitate the purification of the protein in (A1), a tag can be connected to the amino terminus or carboxyl terminus of the protein in (A1). The tag can be Poly-Arg (usually 6 RRRRR), Poly-His (usually 6 HHHHHH), FLAG (DYKDDDDK), Strep-tagII (WSHPQFEK) or c-Myc (EQKLISEEDL).

[0023] The third aspect of the present invention provides the use of an expression cassette, a recombinant expression vector or a recombinant bacterium containing the TaCBSX3 gene in promoting the introduction of nucleic acid molecules into target plants.

[0024] In the above application, the target plant is a monocotyledonous plant, including but not limited to wheat, corn, rice, barley, etc.

[0025] Preferably, the target plant is wheat; further, the wheat is the difficult-to-transform wheat varieties Yanda 1817 and Kenong 9204.

[0026] A fourth aspect of the present invention provides a method for improving the transformation efficiency of a nucleic acid molecule introduced into a target plant, comprising the following steps:

[0027] The expression cassette and nucleic acid molecule containing the TaCBSX3 gene are transferred into the target plant to improve the conversion efficiency of the nucleic acid molecule introduced into the target plant.

[0028] In the above method, the TaCBSX3 gene and nucleic acid molecule can be transferred into the target plant via one vector or via different vectors.

[0029] Preferably, the TaCBSX3 gene and nucleic acid molecule are introduced into the target plant via the pc186 expression vector.

[0030] In the above method, the target plants include but are not limited to monocotyledonous plants such as wheat, corn, rice, and barley, and can also be applied to dicotyledonous plants such as soybean and rapeseed.

[0031] Beneficial effects of the present invention:

[0032] The present invention cloned the wheat TaCBSX3 gene and introduced the TaCBSX3 gene into the difficult-to-transform wheat varieties Yanda 1817 and Kenong 9204. The results showed that the TaCBSX3 gene can greatly improve the transformation efficiency of difficult-to-transform wheat varieties, solve the problem of genotype limitation of wheat transformation, and provide a new regeneration gene for the genetic transformation of wheat. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is a schematic diagram of the partial structure of the plant expression vector pc186-TaCBSX3;

[0034] Figure 2 It is a schematic diagram of the partial structure of the plant expression vector pc186-GUS vector;

[0035] Figure 3 Schematic diagram of the results of PCR specific amplification of the bar gene in candidate transgenic plants obtained by transforming the plant expression vector pc186-TaCBSX3. In the figure, PC represents the positive plasmid, NC represents the negative control, CK represents the wild-type control, M represents the 2000 bp molecular weight marker, and 1-9 represents the candidate transgenic plants. DETAILED DESCRIPTION

[0036] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0037] As mentioned above, the application of transgenic technology in wheat lags far behind other major crops due to its large and complex genome, large number of repetitive DNA sequences and low regeneration ability. Studies have found that the use of regeneration genes can promote the efficiency of plant regeneration and genetic transformation in wheat in vitro tissue culture and broaden the range of transformable genotypes. However, the number of wheat regeneration genes isolated and identified is still very small, and some wheat genotypes cannot be successfully transformed. Therefore, it is very important to carry out in-depth research on the molecular basis of wheat regeneration and explore wheat regeneration-related genes to break through the limitations of wheat genotypes.

[0038] Cystathionine β-synthase (CBS) domain proteins are a large and important protein gene family. Shi Youliang found that the expression protein of CaCBSX3 is located on the plasma membrane. The transient overexpression of this gene in pepper leaves can activate cell necrosis in pepper leaves, and correspondingly increase the conductivity of pepper leaves, suggesting that this gene may be involved in plant immune response (Separation and preliminary functional analysis of full-length cDNA of pepper CaHB3 and CaCBSX3, Master's thesis of Fujian Agriculture and Forestry University, 2013). Li Yan et al. found that CrCBSX3 can inhibit BAX-induced cell necrosis in Nicotiana benthamiana leaves, suggesting that CrCBSX3 may play a role in the early interaction between Catharanthus roseus and wheat blue dwarf phytoplasma (Cloning and preliminary functional exploration of Catharanthus roseus CrCBSX3 gene, Proceedings of the 2016 Academic Annual Meeting of the Chinese Society of Plant Pathology). Wang et al. (Glutathione S-transferase interactions enhance wheat resistance to powdery mildew but not wheat striperust, Plant Physiology, 2022) revealed the similarities and differences in wheat responses to stripe rust and powdery mildew infection through proteome sequencing, and further analyzed the molecular mechanism by which glutathione S-transferase TaGSTU6 positively regulates wheat resistance to powdery mildew but has no effect on stripe rust by interacting with the protein TaCBSX3 containing cystathionine β-synthase (CBS) domain. However, the application of TaCBSX3 gene in wheat genetic transformation has not been reported.

[0039] Based on this, the present invention has conducted an in-depth study on the function of the wheat TaCBSX3 gene. The nucleotide sequence of the TaCBSX3 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the TaCBSX3 gene is shown in SEQ ID NO.2; specifically as follows:

[0040] TaCBSX3 gene:

[0041] ATGTATGATTTGACGCAGAACAAAATGCAGCGAGCAATTCAAGCTATCGGATCACATGGCAGTGTGCTCAAATCTGCTGTCCTGCAACACATCAGTGTTGTGAAGCCTGCTATGCTGCCTGCTGTGTTCCCGCGCTTCATGTCAGTATCACCTGCTCAAATAGAGGAGAGTGGATTTGAGAGCAGCACTGTTGCGGACATTTTGAAGTCCAAAGGGAAGAGTGCTGATGGATCATGGCTCTGGTGCACCACTGATGACAGTGTCTATGATGCTGTCAAATCGATGACACAGCACAATGTGGGAGCTTTGGTGGTTGTTAAACCCGGGGAAGATAAATCAATTGCTGGCATCGTCACAGAGAGAGATTATCTCCGGAAAATCATAGTGCAGGGTCGATCCTCCAAGTCAACCAAAGTTGGAGATATCATGACCGAAGAGAACAAGCTGATCACGGTGAAACCTGAAACCAGAGTCCTGAAAGCAATGCAGCTGATGACAGACAAGCGTATCAGGCACATCCCGGTGATCAGCGGCACCGAGATGATGGGGATGGTCTCCATCGGCGACGTGGTGCGCGCGGTGGTCAGCGAGCACAAGGAGGAGCTGAACCGGCTCAACGCCTACATCCAGGGTGGGTACTAG(SEQ ID NO.1)

[0042] Protein encoded by TaCBSX3 gene:

[0043] MYDLTQNKMQRAIQAIGSHGSVLKSAVLQHISVVKPAMLPAVFPRFMSVSPAQIEESGFESSTVADILKSKGKSADGSWLWCTTDDSVYDAVKSMTQHNVGALVVVKPGEDKSIAGIVTERDYLRKIIVQGRSSKSTKVGDIMTEENKLITVKPETRVLKAMQLMTDKRIRHIPVISGTEMMGMVSIGDVVRAVVSEHKEELNRLNAYIQGGY(SEQ IDNO.2)

[0044] The present invention has carried out genetic transformation experiments on different wheat genotypes by Agrobacterium-mediated method, and found that TaCBSX3 gene can improve the transformation efficiency of extremely difficult-to-transform wheat varieties Yanda 1817 and Kenong 9204, and has great application prospects, thus proposing the present invention.

[0045] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below in conjunction with specific embodiments.

[0046] The experimental materials used in the examples of the present invention that are not specifically described are all conventional experimental materials in the art and can be purchased through commercial channels. If the specific experimental conditions and methods are not specified in the examples of the present invention, conventional conditions are usually followed, such as J. Sambrook et al., ed., Molecular Cloning Experiment Guide (3rd Edition), Science Press, 2002; DL Spector et al., ed., Cell Experiment Guide, Science Press, 2001; or the conditions recommended by the manufacturer.

[0047] Example 1: Cloning of TaCBSX3 gene and construction of expression vector

[0048] Total RNA of wheat line Fielder was extracted using Ultrapure RNA Kit (Chemical Industry, Cat. No.: CW0581M).

[0049] cDNA was reverse transcribed according to FastKing RT Kit (With gDNase) (Tiangen Biochemical Technology (Beijing) Co., Ltd., Cat. No.: KR116)).

[0050] Using cDNA as template, PCR amplification was performed using primer pairs (upstream primer: 5'-ATGTATGATTTGACGCAGAAC-3', SEQ ID NO.3; downstream primer: 5'-CTAGTACCCACCCTGGATG-3', SEQ ID NO.4). The amplification system was 2 μl upstream primer (10 μmol / μl), 2 μl downstream primer (10 μmol / μl), 12.5 μl 2×Phanta Max Master Mix, 1 μl cDNA template, and ddH2O was added to make the total volume 25 μl. Amplification conditions were: 95°C pre-denaturation for 3 minutes; 95°C denaturation for 15 seconds, 58°C annealing for 15 seconds, 72°C extension for 25 seconds, 32 cycles; 72°C extension for 5 minutes.

[0051] The PCR product obtained by amplification was -Blunt3Cloning Kit (Beijing Quanshijin Biotechnology Co., Ltd., Cat. No.: CB301-01) Operation steps link -Blunt3 vector to obtain pEASY-Blunt3-TaCBSX3 vector, and sequenced it.

[0052] Through sequencing analysis, the nucleotide sequence of the PCR amplification product is Sequence 1 in the sequence list, and the gene shown by the PCR product is named TaCBSX3 gene; the protein encoded by the gene is named TaCBSX3, and the amino acid sequence of the protein is Sequence 2 in the sequence list.

[0053] Sequence 1 can also be artificially synthesized and connected to the pEASY-Blunt3 vector to obtain the pEASY-Blunt3-TaCBSX3 vector.

[0054] Using pEASY-Blunt3-TaCBSX3 as template, designed primer pair (upstream primer: 5'-CACCATGTATGATTTGACGCAG-3', SEQ ID NO.5; downstream primer: 5'-CTAGTACCCACCCTGGATG-3', SEQID NO.4) for PCR amplification. The amplification system was 2μl upstream primer (10μmol / μl), 2μl downstream primer (10μmol / μl), 12.5μl 2×Phanta Max Master Mix, 1μl cDNA template, and ddH2O was added to make the total volume 25μl. Amplification conditions were: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 25 seconds, 32 cycles; 72℃ extension for 5 minutes.

[0055] The amplified PCR product was referred to pENTR TM Directional Cloning Kit (ThermoScientific TM , Catalog number: K2400-20SP) Operation steps: ligation and sequencing. The correctly sequenced single clone was connected to the pc186 expression vector through LR reaction to obtain the pc186-TaCBSX3 vector. The schematic diagram of the vector structure is shown in the figure. Figure 1 shown.

[0056] The pc186-TaCBSX3 was transformed into Agrobacterium EHA105 competent cells, and an Agrobacterium strain that can be used for transformation was obtained and named pc186-TaCBSX3 / EHA105.

[0057] Example 2: Construction of control vector pc186-GUS

[0058] Refer to NCBI ( https: / / www.ncbi.nlm.nih.gov / ) website Sequence ID: MN266288.1, nucleotides 15108-16919, primer pairs (upstream primer: 5'-ATGTTACGTCCTGTAGAA-3', SEQ ID NO.6; downstream primer: 5'-TCATTGTTTGCCTCCCTG-3', SEQ ID NO.7) were used for PCR amplification. The amplification system was 2μl upstream primer (10μmol / μl), 2μl downstream primer (10μmol / μl), 12.5μl 2×Phanta Max Master Mix, 1μl cDNA template, and ddH2O was added to make the total volume 25μl. Amplification conditions were: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 55 seconds, 32 cycles; 72℃ extension for 5 minutes.

[0059] The PCR product obtained by amplification was -Blunt3 Cloning Kit (Cat. No.: CB301-01, Beijing Quanshijin Biotechnology Co., Ltd.) operation steps to obtain pEASY-B3-GUS, and then sequenced.

[0060] After sequencing analysis, the gene indicated by the PCR product was named GUS gene.

[0061] The GUS gene can also be artificially synthesized and connected to the pEASY-Blunt3 vector to obtain pEASY-Blunt3-GUS.

[0062] Using pEASY-Blunt3-GUS as template, designed primer pair (upstream primer: 5'-CACCATGTTACGTCCTGTAGAA-3', SEQ ID NO.8; downstream primer: 5'-TCATTGTTTGCCTCCCTG-3', SEQID NO.7) for PCR amplification. The amplification system was 2μl upstream primer (10μmol / μl), 2μl downstream primer (10μmol / μl), 12.5μl 2×Phanta Max Master Mix, 1μl cDNA template, and ddH2O was added to make the total volume 25μl. Amplification conditions were: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 55 seconds, 32 cycles; 72℃ extension for 5 minutes.

[0063] The amplified PCR product was referred to pENTR TM Directional Cloning Kit (Cat. No.: K2400-20SP, Thermo ScientificTM ) Operation steps: ligation and sequencing. The correctly sequenced single clone was ligated to the pc186 expression vector through LR reaction to obtain the pc186-GUS vector. The schematic diagram of the vector structure is shown in the figure. Figure 2 shown.

[0064] The pc186-GUS was transformed into Agrobacterium EHA105 competent cells, and an Agrobacterium strain that can be used for transformation was obtained and named pc186-GUS / EHA105.

[0065] Example 3: Agrobacterium-mediated transformation of wheat immature embryos and identification of resistant plants

[0066] 1. The detailed steps and methods of Agrobacterium-mediated transformation of wheat immature embryos refer to Wheat (Triticum aestivum L.) Transformation Using Immature Embryos (Ishida et al., 2015). The basic steps of genetic transformation are as follows:

[0067] 1. Three days before infection, inoculate pc186-TaCBSX3 / EHA105 and pc186-GUS / EHA105 Agrobacterium on YEP solid medium containing 50 mg / L kanamycin and 50 mg / L rifampicin, respectively, and culture in a dark incubator at 28°C for 2 days. Pick a single colony and inoculate it in YEP liquid medium containing 50 mg / L kanamycin and 50 mg / L rifampicin, and culture it with shaking at 28°C 220rpm overnight; put the above Agrobacterium solution into a 2ml centrifuge tube, centrifuge at 6000rpm for 5 minutes, discard the supernatant, resuspend the precipitate with resuspension solution, and obtain Agrobacterium resuspensions of pc186-TaCBSX3 / EHA105 and pc186-GUS / EHA105, respectively.

[0068] 2. The immature embryos of different wheat genotypes (wheat varieties Yanda 1817 and Kenong 9204) about 14 days after flowering were infected with Agrobacterium resuspensions of pc186-TaCBSX3 / EHA105 and pc186-GUS / EHA105, respectively, and spread with the scutellum side up on WLS-AS medium (1 / 10MS basic medium, 1 / 10MS vitamins, 10 g / L glucose, 100 μM acetosyringone, and 8 g / L agarose) and cultured in the dark at 23°C incubator for 2 days.

[0069] 3. Transfer the immature embryos after co-cultivation to WLS-Res medium (MS basic medium, MS vitamins, 2,4-D 0.5 mg / L, picloram 2.2 mg / L, glutamine 0.5 g / L, casein 0.1 g / L, MgCl2·6H2O 0.75 g / L, maltose 40 g / L, AgNO3 0.85 mg / L, vitamin C 100 mg / L, carbenicillin 250 mg / L, agarose 5 g / L), and culture in a dark incubator at 25°C for 5 days.

[0070] 4. The callus tissue after recovery culture was transferred to WLS-P5 medium (WLS-Res medium supplemented with PPT 5 mg / L) and cultured in a 25°C incubator in the dark for 14 days.

[0071] 5. The callus was then transferred to WLS-P10 medium (WLS-Res medium supplemented with 10 mg / L PPT) and cultured in a 25°C incubator in the dark for 21 days.

[0072] 6. The callus was transferred to LSZ-P5 medium (MS basic medium, LS vitamins, zeatin 5 mg / L, sucrose 20 g / L, carbenicillin 250 mg / L, PPT 5 mg / L, phytagel 3 g / L), and cultured in a 25°C incubator under light for 2 weeks.

[0073] 7. Transfer the regenerated buds of wheat callus to LSF-P5 medium (MS basic medium, LS vitamins, IBA0.2 mg / L, sucrose 15 g / L, carbenicillin 250 mg / L, PPT 5 mg / L, plant gel 3 g / L), and culture in a 25°C incubator under light until the roots of the regenerated buds are about 1-2 cm long.

[0074] 8. Transplant the strong seedlings with roots into nutrient soil to obtain resistant seedlings of pc186-TaCBSX3 and pc186-GUS respectively.

[0075] 2. PCR detection of candidate transgenic plants

[0076] The CTAB method (Sambrook and Russell, Molecular Cloning Laboratory Guide, 2001) was used to extract genomic DNA from leaves of T0 generation wheat plants transformed with pc186-TaCBSX3 and pc186-GUS vectors.

[0077] Primers were designed to detect the bar gene, the primer pair sequence (upstream primer: 5'-GGCGGTCTGCACCATCGTCAACCACTAC-3', SEQ ID NO.9; downstream primer: 5'-AGTCCAGCTGCCAGAAACCCACGTCATG-3', SEQ ID NO.10), and the amplified sequence length was 446bp. The amplification system was 1μl upstream primer (10μmol / μl), 1μl downstream primer (10μmol / μl), 10μl 2×Rapid Taq Master Mix, 1μl cDNA template, and ddH2O was added to make the total volume 20μl. The amplification conditions were: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 15 seconds, 32 cycles; 72℃ extension for 5 minutes.

[0078] PCR identification results Figure 3 As shown, there is no 446 bp bar gene fragment in wild-type wheat.

[0079] 3. Statistics of transformation efficiency of different wheat genotypes

[0080] After the wheat embryos were infected with Agrobacterium tumefaciens 14-15 days after pollination, the induced callus was screened with a screening agent, and the number of resistant callus formed was counted when it was transferred to LSF-P5 medium; after PCR identification, the number of positive seedlings was counted, and finally the resistant callus induction rate and transformation efficiency were calculated. The calculation formula is as follows:

[0081] Resistant callus induction rate (%) = (number of resistant callus ÷ total number of young embryos) × 100%;

[0082] Transformation efficiency (%) = (number of positive seedlings ÷ total number of young embryos) × 100%;

[0083] Compared with the control vector pc186-GUS, transformation with the pc186-TaCBSX3 vector can effectively improve the transformation efficiency of wheat. The results are shown in Table 1.

[0084] Table 1: Comparison of transformation efficiency between control vector and pc186-TaCBSX3 vector

[0085]

[0086] When the immature embryos of wheat variety Yanda 1817 were used as explants for Agrobacterium transformation, the resistant callus induction rates of pc186-TaCBSX3 vector and control vector pc186-GUS were 96.80% and 93.81%, respectively; the transformation efficiency of pc186-TaCBSX3 vector was 45.60%, while the control vector pc186-GUS could not obtain transgenic plants. When Kenong 9204 was used as the recipient for genetic transformation, the resistant callus induction rate and transformation efficiency of pc186-TaCBSX3 vector were 90.71% and 27.86%, respectively, which were higher than 86.13% and 5.84% of the control vector pc186-GUS. From the above results, it can be seen that TaCBSX3 gene can greatly improve the transformation efficiency of difficult-to-transform wheat varieties.

[0087] The above description is only the preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. The use of TaCBSX3 gene in promoting the introduction of nucleic acid molecules into target plants, characterized in that: The TaCBSX3 gene is a DNA molecule as shown in the following i) or ii) or iii): i) the nucleotide sequence is the DNA molecule shown in SEQ ID NO.1; ii) DNA molecules that have 80% or more homology with the nucleotide sequence of i) and express proteins with the same or similar functions, as well as the corresponding alleles, homologous genes, mutant genes and derivative genes; iii) A DNA molecule encoding the amino acid sequence shown in SEQ ID NO. 2 except i).

2. Use of the protein encoded by the TaCBSX3 gene in the following (1) or (2): (1) Improving the transformation efficiency of nucleic acid molecules into target plants; (2) Improve the regeneration efficiency of young embryos of target plants.

3. The use according to claim 2, characterized in that: The protein encoded by the TaCBSX3 gene is a protein as shown in any one of the following (A1) or (A2) or (A3): (A1) a protein consisting of the amino acid sequence shown in SEQ ID NO.2 in the sequence listing; (A2) A fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1). (A3) The encoded protein is similar to the protein shown in SEQ ID NO. 2, or a protein obtained by substitution, deletion or insertion of one, several or dozens of amino acids.

4. Use of an expression cassette, a recombinant expression vector or a recombinant bacterium containing the TaCBSX3 gene in promoting the introduction of nucleic acid molecules into target plants, characterized in that: The TaCBSX3 gene is a DNA molecule as shown in the following i) or ii) or iii): i) the nucleotide sequence is the DNA molecule shown in SEQ ID NO.1; ii) DNA molecules that have 80% or more homology with the nucleotide sequence of i) and express proteins with the same or similar functions, as well as corresponding alleles, homologous genes, mutant genes and derivative genes; iii) A DNA molecule encoding the amino acid sequence shown in SEQ ID NO.2 except i).

5. The use according to any one of claims 1 to 4, characterized in that: The target plant is a monocotyledonous plant.

6. The use according to claim 5, characterized in that: The target plant is wheat; preferably, the wheat is the difficult-to-transform wheat varieties Yanda 1817 and Kenong 9204.

7. A method for improving the transformation efficiency of nucleic acid molecules into target plants, characterized in that: The following steps are involved: The expression cassette and nucleic acid molecule containing the TaCBSX3 gene are transferred into the target plant to improve the conversion efficiency of the nucleic acid molecule introduced into the target plant.

8. The method according to claim 7, characterized in that The TaCBSX3 gene and nucleic acid molecule are transferred into the target plant via one vector or via different vectors.

9. The method according to claim 7 or 8, characterized in that: The target plant is wheat.

Images