Application of rice OsGLK1 gene in regulation and control of heading stage of rice

Abstract

The invention discloses application of a rice OsGLK1 gene in regulation and control of the heading stage of rice, and relates to the technical field of plant genetic engineering. Through overexpression of the OsGLK1 gene or the protein OsGLK1 encoded by the OsGLK1 gene in the rice, the heading period of the rice under long-day and short-day conditions can be greatly delayed. The invention provides a new method for regulating and controlling the heading period of the rice, and has important significance for optimizing the growth cycle of the rice and cultivating new varieties with environmental adaptability.

Description

Technical Field

[0001] The present application relates to the technical field of plant genetic engineering, and in particular to the application of rice OsGLK1 gene in regulating the heading period of rice. Background Art

[0002] Rice is an important food crop in my country, and its yield directly affects food security. The heading date of rice is one of the key agronomic traits that determines its growth cycle and environmental adaptability, and is closely related to yield, quality, and the selection of planting areas. The regulation of rice heading date is complexly regulated by photoperiod, temperature, endogenous hormones, and gene networks, among which genes and signal transduction pathways related to flowering time are research hotspots. In recent years, the role of transcription factors in flowering regulation has received extensive attention. The transcription factor GLK1 (Golden2-like 1) is a member of the GARP family unique to plants, and is traditionally believed to be mainly involved in the regulation of chloroplast development and photosynthesis genes. However, the latest studies have shown that the role of GLK family members in plant development is far more than chloroplast regulation, and may also be involved in other complex biological processes, such as response to environmental signals and coordination of developmental processes. In rice, the functional diversification of GLK1 has become a research hotspot. Summary of the invention

[0003] The present invention aims to reveal the key role of rice OsGLK1 gene in regulating rice heading period. Transgenic rice obtained by overexpressing OsGLK1 gene can significantly delay heading period under both long-day and short-day conditions.

[0004] To this end, the present invention provides an application of a rice OsGLK1 gene in regulating the heading period of rice. The nucleotide sequence of the OsGLK1 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the OsGLK1 gene is shown in SEQ ID NO.2.

[0005] Furthermore, the OsGLK1 gene is expressed in the stem, leaf sheath, leaf blade and panicle of rice, mainly in the leaf blade of rice, and is hardly expressed in the root of rice.

[0006] Furthermore, the expression of the OsGLK1 gene in rice shows rhythmic expression, being activated after darkness turns to light and then declining.

[0007] Furthermore, by overexpressing the OsGLK1 gene, OsGLK1 gene overexpression rice is obtained, and the OsGLK1 gene overexpression rice has delayed heading period under both long-day and short-day conditions.

[0008] Furthermore, compared with wild-type rice, the heading period of the OsGLK1 gene overexpressing rice was significantly delayed under both long-day and short-day conditions, with the significant delay time being 25 to 35 days.

[0009] Furthermore, compared with wild-type rice, the OsGLK1 gene overexpressing rice has a taller plant height, a longer panicle length, and a greater number of grains per panicle.

[0010] Furthermore, the method for obtaining the OsGLK1 gene overexpressing rice comprises:

[0011] The OsGLK1 gene is constructed into a vector pCAMBIA1300 to obtain a recombinant vector of the OsGLK1 gene, and the recombinant vector is transformed into a rice variety through an Agrobacterium-mediated transformation method to obtain the OsGLK1 gene overexpressing rice.

[0012] Furthermore, the recombinant vector of the OsGLK1 gene is constructed by:

[0013] Using RNA from wild-type rice Kitaake as a template, reverse transcription was performed to obtain cDNA, and primers OsGLK1-cds-F and OsGLK1-cds-R were designed to perform PCR amplification to obtain the target fragment;

[0014] The vector pCAMBIA1300 was digested with enzymes and connected with the target fragment, and then transformed into Escherichia coli. After screening and verification, the recombinant vector pCAMBIA1300-OsGLK1 was obtained.

[0015] The sequence of the primer OsGLK1-cds-F is shown in SEQ ID NO.3, the sequence of the primer OsGLK1-cds-R is shown in SEQ ID NO.4; and the rice variety is Kitaake.

[0016] Compared with the prior art, the present invention has at least the following beneficial effects:

[0017] The application of the rice OsGLK1 gene provided by the present invention in regulating the heading period of rice can significantly delay the heading period of the rice under long-day and short-day conditions by overexpressing the OsGLK1 gene or the protein OsGLK1 encoded by the gene in rice. The present invention provides a new method for regulating the heading period of rice, which is of great significance for optimizing the growth cycle of rice and cultivating new varieties with environmental adaptability. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Various other advantages and benefits will become apparent to those of ordinary skill in the art by reading the following detailed description of the preferred embodiment.The accompanying drawings are only for the purpose of illustrating the preferred embodiments and are not to be considered as limiting the present application.

[0019] Figure 1 This is the structure diagram of the rice OsGLK1 gene provided in Example 1 of the present invention.

[0020] Figure 2 This is the circular plasmid map of the vector pCAMBIA1300 provided in Example 1 of the present invention.

[0021] Figure 3 This is the expression of OsGLK1 in the OsGLK1 overexpressing transgenic rice provided in Example 3 of the present invention.

[0022] Figure 4 The expression pattern of the rice OsGLK1 gene provided in the embodiment of the present invention; wherein the material is a wild type (Kitaake) 25-day-old rice seedling ( Figure 4 A), roots, stems, leaf sheaths, first leaves, second leaves, third leaves and spikes were used as materials for real-time fluorescence quantitative PCR experiments, Figure 4 The white vertical line in the lower right corner of A is the scale (representing 20mm). Figure 4 The bar graph in B shows the relative expression of OsGLK1 in different tissues. Figure 4 C is the expression characteristics of OsGLK1 under long-day and short-day conditions.

[0023] Figure 5 This is the investigation of the heading period phenotype of OsGLK1 overexpressing transgenic rice provided in Example 5 of the present invention.

[0024] Figure 6 This is an investigation of agronomic traits of OsGLK1 overexpressing transgenic rice provided in Example 5 of the present invention. DETAILED DESCRIPTION

[0025] In order to better understand the above-mentioned technical scheme, the technical scheme of the embodiments of the present application is described in detail below through the accompanying drawings and specific embodiments. It should be understood that the embodiments of the present application and the specific features in the embodiments are detailed descriptions of the technical scheme of the embodiments of the present application, rather than limitations on the technical scheme of the present application. In the absence of conflict, the embodiments of the present application and the technical features in the embodiments may be combined with each other.

[0026] The experimental methods in the following examples without specifying specific conditions were all carried out according to conventional procedures, and the materials and materials used were all commercially available products.

[0027] The embodiment of the present invention discloses the application of rice OsGLK1 gene in regulating rice heading period. The transgenic rice obtained by overexpressing the OsGLK1 gene has delayed heading under both long-day and short-day conditions.

[0028] Specifically, the present invention provides an application of the rice OsGLK1 gene in regulating the heading period of rice; wherein the nucleotide sequence of the rice OsGLK1 gene is shown in SEQ ID NO.1, and the gene is introduced into rice to overexpress the gene, which can significantly delay the heading period of the rice under long-day and short-day conditions. The present invention also provides a polypeptide encoded by the rice OsGLK1 gene, namely, the protein OsGLK1, whose amino acid sequence is shown in SEQ ID NO.2. The gene encoding the protein is introduced into rice to overexpress the protein, which can significantly delay the heading period of the rice under long-day and short-day conditions.

[0029] Furthermore, the present invention provides a method for delaying the heading period of rice, comprising the following steps:

[0030] (1) RNA of wild-type rice Kitaake was used as a template for reverse transcription to obtain cDNA, and PCR amplification was performed using the nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4 as primers to obtain an amplified product.

[0031] (2) The amplified product is connected into the BamHI restriction site of the pCAMBIA1300 vector through homologous recombination to obtain a recombinant vector.

[0032] (3) The recombinant vector is transformed into the rice variety Kitaake through Agrobacterium-mediated transformation to obtain rice with delayed heading period.

[0033] Example 1 Construction of OsGLK1 overexpression vector pCAMBIA1300-OsGLK1

[0034] like Figure 1 As shown, the gene structure of rice OsGLK1, OsGLK1 is located in the rice chromosome VI genome, the accession number is LOC_Os06g24070 or Os06g0348800, the gene sequence is located between 14078258 and 14082303, has 6 exons, and encodes a GARP type transcription factor.

[0035] 1. Acquisition of OsGLK1 gene:

[0036] Total RNA was extracted from leaves of wild-type rice Kitaake, and reverse transcribed to obtain cDNA. PCR amplification was performed using the crop template and OsGLK1-cds-F and OsGLK1-cds-R as primers to obtain a PCR product of 1368 bp, which was the target fragment.

[0037] The primer sequences are as follows:

[0038] sequence name Sequence (lowercase sequence is vector linker) Sequence number OsGLK1-cds-F 5'-tgtgtgtgcagcccgggatccATGCTTGCCGTGTCGCCGGC-3' SEQ ID NO.3 OsGLK1-cds-R 5'-tccatggtacctgcaggatccTCCACACGCTGGAGGAACGTTT-3' SEQ ID NO.4

[0039] 2. Construction of recombinant vector:

[0040] The vector pCAMBIA1300 was digested with restriction endonuclease BamHI, and a DNA fragment of about 11145 bp was recovered to obtain the vector fragment. The vector circular plasmid map is shown in Figure 2 As shown. Using the homologous recombinase from Novizan ( https: / / bio.vazyme.com / , Catalog No.: C112-01), the above vector fragment was connected with the target fragment obtained in step 1 according to the instructions. The ligation product was then transferred into E. coli DH5a, screened with kanamycin screening medium, and a single clone was selected for sequencing. If the sequencing was correct, the construction was successful, and the recombinant plasmid was named pCAMBIA1300-OsGLK1.

[0041] The recombinant vector pCAMBIA1300-OsGLK1 was transformed into the Agrobacterium EHA105 strain by the heat shock method, and after screening with rifampicin and kanamycin screening medium, a single clone was selected to obtain the recombinant Agrobacterium EHA105 / pCAMBIA1300-OsGLK1.

[0042] Example 2 Obtaining OsGLK1 overexpressing transgenic rice

[0043] 1. Rice callus induction:

[0044] The sterilized rice (Kitaake) seeds were sown in callus induction medium (pH 5.8, Sucrose 30 g / L, MS Media 4.4 g / L, Agar 0.8%, 2,4-D 2 mg / L), and rice callus was obtained after about 20 days.

[0045] 2. Agrobacterium infection:

[0046] Recombinant Agrobacterium EHA105 / pCAMBIA1300-OsGLK1 was cultured at 28°C, and the overnight cultured bacterial solution was mixed with the infection solution (Yeast Extra 3g / L, Tryptone 5g / L, Acetos-yringone 0.2M, pH5.5) at a ratio of 1:30, and cultured at 25°C, 200rpm in the dark for 3 hours. The rice callus obtained in step 1 was mixed with the infection solution containing recombinant Agrobacterium for infection, and after about 30 minutes, the rice callus was transferred to a sterile filter paper until there was no infection solution on the surface. Then it was transferred to MSD2 (Sucrose 30g / L, MS Media 4.4g / L, Sorbitol 50g / L, Agar 1.4%, 2,4-D 2mg / L, Acetosyringone 0.2M, pH5.8) medium and cultured in the dark for 2-3 days.

[0047] Select healthy rice callus tissue and place it in MSD (MS Media 4.4g / L, Sucrose 30g / L, Carbenicillin400mg / L, Plant Preservative Mixture 1ml / L, pH5.8) liquid medium, turn it upside down for 10 minutes, pour out the MSD liquid medium, and repeat at least 3 times. Then transfer the callus to the screening medium MSD3 (MS Media 4.4g / L, Sucrose 30g / L Agar 0.8%, 2,4-D 2mg / L, Carbenicillin 250mg / L, Plant Preservative Mixture1ml / L, Hygromycin B 50mg / L, pH5.8) medium and place it in a constant temperature and uninterrupted light incubator at 28°C for 30-50 days. Subculture once every 15 days.

[0048] 3. Inducing callus differentiation:

[0049] After the infected callus grows fresh callus, transfer the callus to MSD4 (MS Media 4.4g / L, Sucrose 30g / L Sorbitol 50g / L, Agar 1.4%, N-(Phenylmethyl)-9H-purin-6-amine 3mg / L, NAA 0.5mg / L, Carbenicillin 50mg / L, Hygromycin B 50mg / L, pH 5.8) medium and place it in an incubator at 28°C with uninterrupted light for 30-50 days. Subculture every 15 days.

[0050] 4. Positive transgenic acquisition:

[0051] The green callus was transferred to a new MSD4 (MS Media 4.4g / L, Sucrose 30g / L, Agar 1.4%, Carbenicillin 50mg / L, Hygromycin B 50mg / L, pH5.8) medium and placed in an incubator at 28°C with uninterrupted light for 30 days. When the seedlings are 15cm long, they can be transferred out of the sterile environment, the residual medium and callus are washed off, and after 3 days in the incubator, they can be transferred to a greenhouse carrier to obtain T0 generation plants.

[0052] Example 3 Identification of OsGLK1 overexpressing transgenic rice

[0053] 1. DNA identification of OsGLK1 overexpressing transgenic rice:

[0054] The genomic DNA of a single OsGLK1 overexpressing transgenic rice was extracted as a template, and PCR amplification was performed using primers Hyg-F and Hyg-R, where Hyg-F corresponds to vector 63-82 bp, and Hyg-R corresponds to vector 10640-10659 bp. If a 588 bp fragment can be amplified, it proves that the single plant is a positive seedling.

[0055] The primer sequences are as follows:

[0056] Hyg-F: 5'-TAAATAGCTGCGCCGATGGT-3',

[0057] Hyg-R: 5'-TCTGCTGCTCCATACAAGCC-3'.

[0058] 2. Identification of OsGLK1 overexpressing transgenic rice mRNA:

[0059] To detect the expression of OsGLK1 in transgenic rice, real-time fluorescence quantitative PCR was performed using the wild type and two independent transgenic lines GLK1-OX1 and GLK1-OX 2. The PCR reaction was performed using the Novizan kit ( https: / / bio.vazyme.com / , Catalog No.: Q711-02), the reaction system and program settings were carried out according to the instructions, and the reaction was carried out on the BIO-RAD instrument CFX Connect Real-Time System. The internal reference gene was rice OsUBQ. The real-time fluorescence quantitative PCR identification primers are as follows:

[0060] OsGLK-qrt-F:GCAAGAATCAGCAGGACGCACA,

[0061] OsGLK1-qrt-R: AGGCAACCACGGTTTCGATAAAA.

[0062] The results are as follows Figure 3 As shown, the relative expression levels of OsGLK1 in both transgenic rice lines were significantly increased compared with the wild type (Kitaake).

[0063] Example 4 Tissue expression characteristics and rhythmic expression of OsGLK1

[0064] To detect the expression of OsGLK1 in different tissues of rice, roots, stems, leaf sheaths, first leaves, second leaves, third leaves and panicles of rice plants grown for 25 days were collected for real-time fluorescence quantitative PCR analysis. Figure 4 As shown in A, the scale bar represents 20 mm. Figure 4 As shown in B, OsGLK1 is expressed in different tissues, but is mainly expressed in leaves and almost not expressed in rice roots.

[0065] Real-time fluorescence quantitative PCR analysis was performed on rice seedlings grown in long-day (14 h light / 10 h dark) and short-day (10 h light / 14 h dark) incubators for 20 days to detect the expression characteristics of OsGLK1. Figure 4 As shown in C, OsGLK1 expression showed rhythmic expression, being activated after the transition from darkness to light and then decreasing.

[0066] Example 5 Investigation of phenotype and agronomic traits of OsGLK1 overexpressing transgenic rice

[0067] 1. Phenotypic investigation at heading stage:

[0068] Wild-type (Kitaake) and OsGLK1 overexpressing transgenic rice were planted in Yangzhou (long-day) and Hainan (short-day), and the heading period was counted and photographed. The heading period refers to the time from sowing to the first ear emerging from the leaf sheath. Figure 5 As shown, WT represents wild type, GLK1-OX 1 and GLK1-OX 2 represent two independent OsGLK1 overexpression lines, Figure 5 A shows the rice plant type. Figure 5 B shows the statistical heading date of Yangzhou and Hainan. Compared with the wild type, the heading date of the two overexpression rice lines was significantly delayed by about 30 days in both long-day and short-day periods, indicating that OsGLK1 overexpression delayed heading.

[0069] 2. Agronomic traits investigation:

[0070] After rice matured, the agronomic traits of wild type (Kitaake) and OsGLK1 overexpressing transgenic rice were investigated. At least 4 plants were selected from each line, and at least 10 rice ears were selected from each plant to measure plant height, ear length, and number of grains per ear. Figure 6As shown in A, 6B and 6C, WT represents the wild type, GLK1-OX 1 and GLK1-OX 2 represent OsGLK1 overexpression lines, and compared with the wild type, the transgenic rice plant height is significantly higher, the panicle length is significantly longer, and the number of grains per panicle is significantly increased. This shows that OsGLK1 overexpression can effectively increase the number of grains per panicle.

[0071] It is easy for those skilled in the art to understand that, under the premise of no conflict, the above-mentioned advantageous methods can be freely combined and superimposed. The above are only preferred embodiments of the present application and are not intended to limit the present application. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present application should be included in the protection scope of the present application. The above are only preferred implementation methods of the present application. It should be pointed out that for ordinary technicians in this technical field, several improvements and variations can be made without departing from the technical principles of the present application, and these improvements and variations should also be regarded as the protection scope of the present application.

Claims

1. Application of rice OsGLK1 gene in regulating rice heading period, wherein the nucleotide sequence of the OsGLK1 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the OsGLK1 gene is shown in SEQ ID NO.

2.

2. The use of the rice OsGLK1 gene in regulating the heading period of rice according to claim 1, characterized in that: The OsGLK1 gene is expressed in the stem, leaf sheath, leaf blade and panicle of rice, mainly in the leaf blade of rice, and is hardly expressed in the root of rice.

3. The use of the rice OsGLK1 gene in regulating the heading period of rice according to claim 1, characterized in that: The expression of the OsGLK1 gene in rice shows rhythmic expression, is activated after darkness turns to light, and then decreases.

4. The use of the rice OsGLK1 gene in regulating the heading period of rice according to any one of claims 1 to 3, characterized in that: By overexpressing the OsGLK1 gene, OsGLK1 gene overexpression rice is obtained, and the OsGLK1 gene overexpression rice has delayed heading period under both long-day and short-day conditions.

5. The use of the rice OsGLK1 gene in regulating the heading period of rice according to claim 4, characterized in that: Compared with wild-type rice, the heading period of the OsGLK1 gene overexpressing rice is delayed by 25 to 35 days under both long-day and short-day conditions.

6. The use of the rice OsGLK1 gene in regulating the heading period of rice according to claim 4, characterized in that: Compared with wild-type rice, the OsGLK1 gene overexpressing rice has a taller plant height, a longer panicle length, and a greater number of grains per panicle.

7. The use of the rice OsGLK1 gene in regulating the heading period of rice according to claim 4, characterized in that: The method for obtaining the OsGLK1 gene overexpressing rice comprises: The OsGLK1 gene is constructed into a vector pCAMBIA1300 to obtain a recombinant vector of the OsGLK1 gene, and the recombinant vector is transformed into a rice variety through an Agrobacterium-mediated transformation method to obtain the OsGLK1 gene overexpressing rice.

8. The use of the rice OsGLK1 gene in regulating the heading period of rice according to claim 7, characterized in that: The recombinant vector of the OsGLK1 gene is constructed by: Using RNA from wild-type rice Kitaake as a template, reverse transcription was performed to obtain cDNA, and primers OsGLK1-cds-F and OsGLK1-cds-R were designed to perform PCR amplification to obtain the target fragment; The vector pCAMBIA1300 was digested with enzymes and connected with the target fragment, and then transformed into Escherichia coli. After screening and verification, the recombinant vector pCAMBIA1300-OsGLK1 was obtained.

9. The use of the rice OsGLK1 gene in regulating the heading period of rice according to claim 8, characterized in that: The sequence of the primer OsGLK1-cds-F is shown in SEQ ID NO.3, and the sequence of the primer OsGLK1-cds-R is shown in SEQ ID NO.

4.

10. The use of the rice OsGLK1 gene in regulating the heading period of rice according to claim 7, characterized in that: The rice variety is Kitaake.

Images