BnMYB4 gene for regulating and controlling sclerotinia rot resistance of brassica napus and application of BnMYB4 gene

Abstract

The invention belongs to the field of plant genetic engineering, and particularly relates to application of a rape BnMYB4 gene in prevention and control of sclerotiniose. The rape BnMYB4 gene capable of enhancing the sclerotiniose resistance of the rape is screened out. The nucleotide sequence of the gene is as shown in SEQ ID NO: 1; the sequence of the protein coded by the gene is as shown in SEQ ID NO: 2. According to the method, a pGWB418-BnMYB4 overexpression strain and a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas9-BnMYB4 gene knockout strain are obtained by utilizing agrobacterium tumefaciens mediated transformation. Sclerotinia sclerotiorum inoculation identification on a transgenic material finds that the sclerotinia rot resistance of a BnMYB4 overexpression strain is enhanced, which indicates that the BnMYB4 is a positive regulation factor of the sclerotinia rot resistance of the rape and plays a positive regulation role in the sclerotinia rot resistance of the rape, and the sclerotinia rot resistance of the rape can be remarkably improved by overexpression of the gene.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and in particular relates to a BnMYB4 gene for regulating resistance to sclerotinia sclerotiorum of Brassica napus. Background Art

[0002] Rapeseed (Brassica napus L.) is the largest oil crop planted in my country and plays a pivotal role in the domestic edible oil market. Sclerotinia sclerotinia is one of the most serious diseases in rapeseed production. The incidence of sclerotinia sclerotinia in different regions is generally 10%-80%, causing a yield loss of 10%-70%. At the same time, sclerotinia sclerotinia will also have a serious impact on the quality and oil content of rapeseed.

[0003] At present, the prevention and control of sclerotinia rot in rapeseed is mainly carried out through measures such as spraying chemical pesticides, reasonable crop rotation, and breeding of sclerotinia rot-resistant varieties. Among them, chemical control is the most common, generally using sclerotinia rot, carbendazim, prochloraz, etc., but chemical pesticides have problems such as environmental pollution and unsatisfactory control effects; sclerotinia rot fungi are stubborn to survive, have many hosts, and spread rapidly, and agricultural control alone is difficult to limit the occurrence of the disease; biological control is efficient, specific, and environmentally friendly, but the current application technology of biological control is not mature, and the degree of commercialization is slow. Compared with chemical pesticides, its control cost is higher, the suitable period for control is relatively short, and there are certain technical limitations. Therefore, through molecular breeding technology, it is of great significance to study the mechanism of rapeseed's resistance to sclerotinia rot, screen rapeseed's resistance to sclerotinia rot genes, thereby improving rapeseed's resistance to sclerotinia rot, and providing genetic resources for molecular identification of rapeseed sclerotinia rot and disease-resistant breeding.

[0004] The C-terminus of MYB-type transcription factors (MYB TFs) usually contains a transcriptional activation region and the N-terminus has a conserved DNA binding domain. This domain is usually composed of up to four imperfect amino acid sequence repeats (R), each repeat forming three α-helices. The second and third helices of each repeat sequence construct a helix-turn-helix (HTH) structure with three regularly spaced tryptophan (or hydrophobic) residues, forming a hydrophobic core in the 3D HTH structure. The third helix is ​​the recognition helix, which is responsible for recognizing the DNA binding site and binding to the major groove of the target DNA with this structure.

[0005] The MYB transcription factors reported so far mainly participate in plant immune responses through the phenylalanine metabolic pathway, SA (salicylic acid) pathway, JA (jasmonic acid) pathway, etc. Lignin is one of the end products related to the phenylpropanoid metabolic pathway. Rice OsMYB30, OsMYB55 and OsMYB110 specifically activate the expression of lignin biosynthesis-related genes (i.e., Os4CL3, Os4CL5, OsPAL6 and OsPAL8), and limit the activity space of pathogens through lignification to prevent the spread of pathogens. AtMYB96 enhances plant resistance to Pseudomonas syringae by regulating the SA disease resistance pathway. The rose RcMYB84 and RcMYB123 genes interact with the RcJAZ1 protein and participate in the regulation of the jasmonic acid signaling pathway.

[0006] Although there have been studies on the involvement of the MYB gene family in regulating host resistance to bacteria and fungi, the disease resistance function of BnMYB4 has not been studied in depth. There are no reports on whether BnMYB4 can enhance rapeseed's resistance to Sclerotinia sclerotiorum, and its function needs further verification. Summary of the invention

[0007] The purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art, provide an application of the BnMYB4 gene in the resistance of Brassica napus to sclerotinia sclerotinia, and provide a new genetic resource for the breeding of rapeseed to resist sclerotinia sclerotinia.

[0008] The technical solution of the present invention is as follows:

[0009] The applicant cloned a transcription factor BnMYB4 gene that regulates rapeseed resistance to sclerotinia sclerotinia, the nucleotide sequence of which is shown in SEQ ID NO: 1, and the protein sequence of which is shown in SEQ ID NO: 2.

[0010] The invention relates to application of the BnMYB4 gene in regulating the resistance of rapeseed to sclerotinia sclerotinia.

[0011] A more detailed technical solution is as follows:

[0012] 1. Cloning of BnMYB4 gene and vector construction

[0013] Based on the alignment of Arabidopsis homologous sequences, the gene screened out the BnMYB4 sequence with the highest homology, and the nucleotide sequence of the gene is shown in SEQ ID NO: 1. The present invention uses the genomic DNA of the Brassica napus Westar variety as a template to clone the BnMYB4 gene, and connects the BnMYB4 gene fragment with the linearized overexpression vector pGWB418 using T4 DNA Ligase to obtain the overexpression vector pGWB418-BnMYB4.

[0014] pCBC-DT1DT2 (the vector resistance is chloramphenicol) was used as the intermediate vector for gene editing ( Figure 2 Figure A), pKSE401 (vector resistance is kanamycin) is the final gene editing vector ( Figure 2 The CRISPR / Cas9-BnMYB4 gene editing vector of this gene was constructed.

[0015] 2. Creation of transgenic rapeseed of BnMYB4

[0016] The vector was transformed into Brassica napus westar by Agrobacterium transformation until regenerated differentiated seedlings were obtained. The genomic DNA of the leaves of wild-type Brassica napus as the control and transgenic rapeseed lines was extracted by CTAB method. The gene-edited lines were selected by PCR amplification and identification using primers U626-IDF (5'TGTCCCAGGATTAGAATGATTAGGC 3') and U629-IDR (5'AGCCCTCTTCTTTCGATCCATCAAC3'), and the CRISPR / Cas9 gene-edited positive lines of the gene were screened, and then the positive materials were sequenced and analyzed. The expression lines selected 418seq-F1 (5'CTATCCTTCGCAAGACCC 3') and MYB4-R (5'GTTTGTACAGTTACGCGCCT3') to obtain positive seedlings as subsequent experimental materials.

[0017] 3. Identification of the resistance of BnMYB4 rapeseed lines to Sclerotinia sclerotiorum

[0018] By inoculating Sclerotinia sclerotiorum, the disease resistance of the overexpression strains and the gene-edited strains were analyzed, the inhibitory effect of leaf extracts on the growth of Sclerotinia sclerotiorum was analyzed, and DAB staining was used to infer the relationship between disease resistance and the accumulation of reactive oxygen. The function of this gene in rapeseed's resistance to Sclerotinia sclerotiorum was identified, providing new genetic resources for the breeding of rapeseed resistant to Sclerotinia sclerotiorum.

[0019] Advantages of the present invention:

[0020] The present invention constructs a BnMYB4 gene overexpression vector and a gene editing vector, and finds that BnMYB4 can be used as a key gene for rapeseed resistance materials. Through genetic transformation, rapeseed with overexpression and gene editing of the gene is obtained to resist sclerotinia sclerotiorum, providing new materials for disease-resistant breeding of Brassica napus. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1:Analysis of the expression pattern of BnMYBs family genes after inoculation of wild type Westar of Brassica napus. Explanation of the accompanying symbols: Analysis of the expression pattern of BnMYB4, BnMYB7, BnMYB32, BnMYB46, BnMYB44, BnMYB55, and BnMYB43 genes in detached leaves of Brassica napus wild type Westar inoculated with Sclerotinia sclerotiorum at 0h, 6h, 12h, 24h, 36h, 48h, 60h, and 72h, and the PDA culture block was used as a blank control. The results showed that BnMYB4 may be a key gene mediating the resistance of rapeseed to Sclerotinia sclerotiorum.

[0022] Figure 2 : Construction of vector maps for BnMYB4 gene overexpression vector and gene editing vector. Figure 2 Figure A in the figure is the map of pGWB418 vector; Figure 2 Figure B is the map of the pCBC-DT1DT2 vector; Figure 2 Figure C is the pKSE401 vector map.

[0023] Figure 3 : Detection results of BnMYB4 gene expression in transgenic rapeseed plants.

[0024] Figure 4 : The bacterial spot condition of BnMYB4 overexpression strain and gene-edited strain after inoculation of Sclerotinia sclerotiorum on detached leaves at the seedling stage for 48 hours.

[0025] Figure 5 : BnMYB4 overexpression strain and gene-edited strain leaf extracts at seedling stage inoculated with Sclerotinia sclerotiorum 72h. Figure 5 Figure A shows the growth of bacterial plaques after adding leaf extract in a 1:1 ratio to PDA medium; Figure 5 Figure B shows the mycelial growth status recorded by stereomicroscope observation 72 hours after inoculation. Compared with the Sclerotinia on the medium without leaf extract, the Sclerotinia on the medium with leaf extract was inhibited, and the growth of Sclerotinia on the medium with leaf extract of BnMYB4-OE plants was significantly inhibited, and the mycelium was dense and neatly dense.

[0026] Figure 6 : 36hDAB staining of detached leaves of BnMYB4 overexpression strains and gene-edited strains inoculated with Sclerotinia sclerotiorum at the seedling stage. The leaves of BnMYB4 overexpression strains were stained with a darker brown color and a wider distribution range than those of the wild type, indicating a higher accumulation of H2O2; the leaves of BnMYB4 gene-edited strains were stained with a lighter color than those of the wild type, with only some brown dots, indicating a lower accumulation of H2O2. DETAILED DESCRIPTION

[0027] The present invention is further described in detail below in conjunction with specific embodiments. The examples are only for illustrating the present invention, but not for limiting the scope of the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, instruments, etc. used, unless otherwise specified, can all be obtained from commercial sources.

[0028] This example changes the resistance of Brassica napus to Sclerotinia sclerotiorum by adjusting the expression level of the BnMYB4 gene in Brassica napus. The DNA sequence of the BnMYB4 gene is SEQ ID NO: 1 in the sequence list, and the amino acid sequence is SEQ ID NO: 2 in the sequence list. The specific steps are as follows:

[0029] Example 1: Cloning of BnMYB4 gene and vector construction

[0030] The gene was compared based on the homologous sequences of the TAIR Arabidopsis database, and the BnMYB4 sequence with the highest homology was screened out, and the nucleotide sequence of the gene is shown in SEQ ID NO: 1. The present invention uses the genomic DNA of the Brassica napus Westar variety as a template, and clones the BnMYB4 gene using the forward primer myb-F (5'ATGGGAAGAGCACCATGT 3') and the reverse primer myb-R (5'TCAGAACTCGGGTATGTCC 3'). The BnMYB4 gene was tagged with plasminogen activator (PSA) and cleaved by PCR. The BnMYB4 gene was cloned and expressed in 96 different amino acids. The BnMYB4 gene was cloned in 96 different amino acids. The BnMYB4 gene was cloned in 96 different amino acids. The BnMYB4 gene was cloned in 96 different amino acids. The BnMYB4 gene was cloned in 96 different amino acids. The BnMYB4 gene was cloned in 96 different amino acids. The BnMYB4 gene was cloned in 96 different amino acids.

[0031] The BnMYB4 gene sequence was used to screen two gRNAs with the highest scores and strongest specificity using the online software CRISPR-GE (http: / / skl.scau.edu.cn / targetdesign / ). According to the gRNA sequence, amplification primers with BsaI restriction sites were synthesized, in which N was replaced with the designed gRNA, and the second gRNA was reversed and complementary, and pCBC-DT1DT2 (the vector resistance was chloramphenicol) was used as the gene editing intermediate vector ( Figure 2A in Figure 1), the target sequence with BsaI restriction site was obtained by mixing four primers: BsF: (5'ATATATGGTCTCGATTGNGTT3'), BsR: (5'ATTATTGGTCTCGAAACNCAA3') F (5'TGNGTTTTAGAGCTAGAAATAGC3'), and R: (5'AACNCAATCTCTTAGTCGACTCTAC3') to obtain the target sequence with BsaI restriction site and then PCR amplified with pKSE401 (vector resistance is kanamycin) gene editing final vector ( Figure 2 The CRISPR / Cas9-BnMYB4 gene editing vector of the gene was constructed.

[0032] Example 2: Genetic transformation of rapeseed

[0033] Overexpression and gene-edited seedlings were obtained by Agrobacterium-mediated hypocotyl infection. The specific steps are as follows:

[0034] 1. Seedling: Select Westar seeds with full grains and good activity, put them into 2mL EP tubes, add mercuric chloride to disinfect for 4 minutes in the clean bench, pour out and recover the mercuric chloride, add 75% ethanol to disinfect for 2 minutes, pour out, wash with sterile water for 2 minutes, repeat 3 times, use sterile tweezers to evenly place the treated seeds in M0 culture medium, and culture them in the dark at 24℃ for 6 days.

[0035] 2. Activation of Agrobacterium: One day after the seedlings have sprouted, culture Agrobacterium on YEP medium supplemented with corresponding antibiotics at 28℃ for 48h; pick a single colony and add it to 5ml YEP culture medium, shake and culture at 28℃ for 36h; then draw 1mL of bacterial solution to 45ml YEP culture medium, shake and culture at 28℃ for 12h. Then centrifuge at 4000rpm and 4℃ to collect the cells, then resuspend the Agrobacterium in DM culture medium and dilute to OD600 of about 0.8.

[0036] 3. Infection and co-cultivation: Cut the cultured hypocotyls 8-10 mm in a clean bench, and add DM culture medium to keep them moist during the cutting process. Then soak them in the prepared Agrobacterium culture solution and infect them for 30 minutes. Use sterile tweezers to gently stir and fully infect them. Finally, aspirate the culture solution, transfer the hypocotyls to filter paper to absorb the excess culture solution, and place them in M1 culture medium and culture them in the dark at 24℃ for 2 days.

[0037] 4. Selective culture: Transfer the hypocotyls in M1 to M2 medium and culture at 24°C with 16 h light and 8 h darkness for 12 days.

[0038] 5. Differentiation culture: Remove the brown hypocotyls in M2 and transfer the hypocotyls in good condition to M3 medium. Culture at 24℃ with 16h light and 8h dark. Repeat every 15 days until germination.

[0039] 6. Rooting culture: After the buds appear, remove the callus tissue on the buds, insert them into M4 culture medium, and culture at 24℃ for 16h light and 8h dark until roots form.

[0040] The special culture medium, antibiotic and hormone formula and preparation thereof for rapeseed genetic transformation involved in the embodiments of the present invention are as follows:

[0041] Culture medium formula and preparation method:

[0042] 1.M0: Weigh 4.405 g of MS powder, add 1 L of deionized water to fully dissolve, adjust the pH to 5.85, dispense into seedling boxes, add 0.35 g of agar powder, and place in an autoclave to sterilize at 121°C for 20 min.

[0043] 2.M1: Weigh 4.405g MS powder, 30g sucrose, 18g mannitol, 1000μl 2,4-D (1mg / ml), 300μl KT (1mg / ml), add 1L deionized water to fully dissolve, adjust pH to 5.85, add 7g agar powder, place in an autoclave at 115℃, sterilize for 15min, then add 1000μl AS (100mM / mL) in a clean bench, mix well, dispense into culture dishes, and store in a 4℃ refrigerator.

[0044] 3.M2: The preparation method is the same as M1. Place in an autoclave at 115℃ for 15 minutes, sterilize, add 1500μl of AgNO3, 1000μl of TMT (200mg / ml), and 500μl of kan (50mg / ml) in a clean bench, mix thoroughly, dispense into culture dishes, and store in a refrigerator at 4℃.

[0045] 4.M3: Weigh 4.405g MS powder, 10g glucose, 0.25g xylose, and 0.6g ethanesulfonic acid, add 1L deionized water to fully dissolve, adjust the pH to 5.85, add 7g agar powder, place in an autoclave at 115℃, sterilize for 15min, add 2000μl ZT (0.5mg / mL), 100μl IAA (1mg / mL), and 1000μl TMT (200mg / ml) in an ultra-clean workbench, mix well, dispense into culture dishes, and store in a 4℃ refrigerator.

[0046] 5.M4: Weigh 2.202 g of MS powder, add 1 L of deionized water to fully dissolve, adjust the pH to 5.85, add 0.35 g of agar powder, heat to boiling and dispense into each conical flask 50 mL, place in an autoclave and sterilize at 121°C for 20 min.

[0047] 6.DM: Weigh 4.405 g of MS powder, 30 g of sucrose, 1000 μl of 2,4-D (1 mg / ml), and 300 μl of KT (1 mg / ml), add 1 L of deionized water to fully dissolve, adjust the pH to 5.85, dispense into conical bottles, and place in an autoclave at 121°C for 20 min.

[0048] 7. YEP: Weigh 2g of peptone powder, 2g of yeast powder, 1g of NaCL, and 15g of agar. Sterilize in an autoclave at 121°C for 20 minutes, then dispense into culture dishes and store in a refrigerator at 4°C.

[0049] Antibiotic formula:

[0050] 1. Kanamycin (Kan, 50 mg / ml): Weigh 0.5 g of kanamycin powder, add 10 ml of deionized water to fully dissolve, filter and dispense into sterile EP tubes, and store in a -20°C refrigerator.

[0051] 2. Ampicillin (Amp, 50 mg / ml): Weigh 0.5 g of ampicillin dry powder, add 10 ml of deionized water to fully dissolve, filter and sterilize, then divide into portions and store in a -20°C refrigerator.

[0052] 3. Timentin (TMT, 200 mg / l): Use a syringe to inject 4 ml of sterile deionized water into 1.6 g of unopened bottled Timentin powder under sterile conditions, mix by pipetting and then aspirate, then add 4 ml of sterile deionized water and mix thoroughly, directly dispense into sterile EP tubes, and finally store in a -20°C refrigerator.

[0053] 4. Rifampicin (Rif, 30 mg / ml): Weigh 0.5 g of rifampicin dry powder, add 10 ml of DMSO to fully dissolve, filter and sterilize, then dispense into sterile EP tubes and store in a -20°C refrigerator.

[0054] 5. Spectinomycin (spec, 50 mg / ml): Weigh 0.5 g of kanamycin dry powder, fully dissolve it with 10 ml of sterile deionized water, filter and sterilize it, then divide it into sterile EP tubes and store it in a -20°C refrigerator.

[0055] Hormone formula:

[0056] 1. Acetosyringone (As, 100 mM / mL): Weigh 0.196 g of acetosyringone powder, add 10 mL of DMSO to fully dissolve, filter and sterilize, then dispense into sterile EP tubes, and finally store in a -20°C refrigerator.

[0057] 2. Plant auxin (2,4-D, 1 mg / mL): Weigh 100 mg of 2,4-D, add 1 mL of 1N KOH and shake for 5 min. Then add 10 mL of sterile deionized water and shake until 2,4-D is fully dissolved. Finally, add sterile deionized water to make up to 100 mL and store in a refrigerator at 4°C.

[0058] 3. Kinetin (KT, 1 mg / mL): Weigh 100 mg of KT dry powder, then add 1 mL of 1N KOH and shake until KT is completely dissolved. Then add ddH2O to make up to 100 mL and store at 4°C.

[0059] 4. Naphthaleneacetic acid (NAA, 1 mg / ml): Weigh 100 mg of NAA, add 1 mL of 1N KOH and shake until NAA is completely dissolved, then add sterile deionized water to make up to 100 mL, and store in a refrigerator at 4°C away from light.

[0060] 5. Zeatin (ZT, 0.5 mg / mL): Under aseptic operation, add 95% ethanol to each tube of 5 mg, and then add sterile deionized water to make up to 10 mL after complete dissolution. Then filter and sterilize, and store in a -20℃ refrigerator.

[0061] 5. Indoleacetic acid (IAA, 1 mg / mL): Weigh 100 mg of IAA dry powder and dissolve it in 5 ml of anhydrous ethanol. Add sterile deionized water to make up to 100 mL, then filter and sterilize, and finally store in a -20°C refrigerator.

[0062] Example 3: Positive identification of transgenic materials and expression level determination

[0063] The CTAB method was used to extract genomic DNA from the leaves of wild-type Brassica napus as a control and transgenic rapeseed lines. The forward primer 418-F1 (5'CTATCCTTCGCAAGACCC3') was designed based on the pGWB418 vector sequence, and the reverse primer MYB4-OE-R (5'GTTGGATCAATCCCTCGGTTT 3') was designed based on the BnMYB4 gene sequence for PCR amplification to screen positive lines. In order to determine whether BnMYB4 is overexpressed in rapeseed, the identified transgenic plants were analyzed using the fluorescence quantitative PCR (qPCR) method. qPCR was used Green Realtime PCR Master Mix-Plus-Kit, PCR program was set to 95℃ pre-denaturation for 30 sec, followed by 40 cycles (95℃10 sec, 60℃10 sec, 72℃26 sec), using the rape housekeeping gene BnActin7 (Brassica napus actin-7) as the internal standard gene. The qPCR primers for BnActin7 (Gene ID: 106418315) are:

[0064] BnActin7-F1: 5′-TCTTCCTCACGCTATCCTCCG-3′ and

[0065] BnActin7-R1: 5'-AGCCGTTCCAGCTCTTGC-3'

[0066] The qPCR primers for the BnMYB4 gene are:

[0067] Q-MYB4-OE-F: 5'CTTCTTGGCAACAAATGGTCG 3' and

[0068] Q-MYB4-OE-R: 5'GTTGGATCAATCCCTCGGTTT 3' Analyze the transcription level of BnMYB4 gene in the above positive seedlings and select the strains with higher expression for testing (see Figure 2 ).

[0069] Example 4: Identification of the ability of transgenic rapeseed line BnMYB4 to resist sclerotinia sclerotiorum

[0070] 1. Inoculation of detached leaves with Sclerotinia: Take a 6mm mycelium block of Sclerotinia and culture it in a PDA plate for activation. When the mycelium is about to expand to the edge of the plate, take a 6mm new mycelium block close to the edge of the plate and place it in a new PDA plate for activation. Culture it in the dark at 22℃ for about 40h. Place 3 layers of absorbent paper at the bottom of a clean, non-toxic fresh-keeping box, and add an equal amount of sterile water to each fresh-keeping box. Take the penultimate leaf of the fully expanded and same size, wrap the petiole with moistened absorbent cotton to retain water, and place it in a fresh-keeping box. Use a hole puncher to take a mycelium block with a diameter of 6mm and place it on the leaf, with the mycelium facing down, avoiding the main veins, and inverted in the same position on the leaf. Spray an equal amount of sterile water evenly to keep it moist, place it in an artificial incubator for dark culture, and set the temperature to 22℃. Observe and record the infection of Sclerotinia regularly, and set 3 biological replicates for each strain.

[0071] The experiment found that 48 hours after inoculation, the lesion area of ​​the BnMYB4 gene-edited strain was larger than that of the wild type, and the edited materials Bnmyb4-1 and Bnmyb4-9 expanded by 16.12% and 11.60%, respectively; the overexpression materials BnMYB4 and BnMYB4-22 showed a smaller lesion area than the wild type, which decreased by 18.84% and 33.42%, respectively.

[0072] 2. Leaf extract inoculation: Weigh 10.65g, 12.14g, 0.03g, and 1.74g of MES, Tris, EDTA, and NaCl, respectively, add sterile deionized water to 1L, and prepare leaf extract. Grind 2g of leaves of the same part and size into powder, add 40mL of extract solution and mix well, centrifuge at 4500 rpm for half an hour at room temperature; aspirate the supernatant and sterilize it with a bacterial filter membrane, and add it to PDA culture medium at a ratio of 1:1 for storage. Use a puncher to punch a 6mm mycelium block along the edge of the mycelium, place the mycelium down in the center of the PDA culture medium, and use the mycelium expansion area as the basis for resistance to Sclerotinia.

[0073] The experiment found that 72 hours after inoculation with Sclerotinia sclerotiorum, the area of ​​Sclerotinia sclerotiorum plaques in the culture medium supplemented with leaf extracts of the BnMYB4 overexpressing strain was significantly smaller than that in the culture medium supplemented with leaf extracts of the wild-type strain; the area of ​​Sclerotinia sclerotiorum plaques in the culture medium supplemented with leaf extracts of the BnMYB4 gene-edited strain was significantly larger than that in the culture medium supplemented with leaf extracts of the wild-type strain.

[0074] 3. DAB staining: Cut leaves of equal size along the edge of hyphae extension, which were inoculated for 36 hours, and place them in 50mL of diaminobenzidine solution (1mg / mL). Vacuum for 20 minutes and incubate at 28℃ for 8 hours. Decolorize with 95% alcohol for 10 hours, and change 95% alcohol 1-2 times during this period. Finally, prepare the slides and take photos with a stereo microscope. The H2O2 accumulation in the leaves can be judged by observing the color depth of the brown polymer formed by the combination of DAB and H2O2.

[0075] The experiment found that the leaves of this study were stained with DAB 36 hours after the bacteria were connected. The results showed that the leaves of the BnMYB4 overexpression strain were darker brown than the wild type, indicating a higher H2O2 accumulation; the leaves of the BnMYB4 gene-edited strain were lighter in color than the wild type, indicating a lower H2O2 accumulation.

Claims

1. Application of the BnMYB4 gene that regulates resistance to Sclerotinia sclerotinia in Brassica napus.

Images