Method for regulating and controlling verticillium wilt resistance of plants by using gene silencing technology

Abstract

The invention provides a method for regulating and controlling verticillium wilt resistance of plants by using a gene silencing technology, and belongs to the technical field of biological gene engineering. The invention provides a gene silencing vector for silencing an RAB5 homologous gene in a plant. The gene silencing vector is used for silencing the gene based on a TRV-mediated VIGS technology. According to the invention, the RAB5 homologous gene is found to be close to plant disease resistance through a method for silencing the RAB5 homologous gene, so that a new gene is provided for researching genetic breeding of germplasm resources of cotton. According to the embodiment of the invention, after cotton plants with low expression quantities of GhARA6 and GhARA7 are obtained, verticillium dahliae is inoculated, and the result shows that the plants of the silent gene GhARA6 / GhARA7 show higher disease resistance to verticillium wilt.

Description

Technical Field

[0001] The invention belongs to the technical field of biological gene engineering, and specifically relates to a method for regulating plant resistance to Verticillium wilt by utilizing gene silencing technology. Background Art

[0002] ARA6 (RABF1) / ARA7 (RABF2b) are homologous genes of RAB5 in plants. Both belong to Rab proteins, which are small GTPases in the Ras superfamily. As the "commander" of the intracellular transport system, Rab proteins regulate the formation, transport, anchoring and fusion of vesicles with the plasma membrane, and play the role of molecular switches in the endocytic and secretory pathways. After Rab5 was knocked out, the number of early endosomes, late endosomes and lysosomes was significantly reduced, and the endocytosis of cells was also inhibited.

[0003] TRV-mediated VIGS silencing (Virus-induced gene silencing) is an important method for studying plant gene function, which is simple, rapid and efficient, does not require complex genetic transformation of plants, and can be used to study the function of lethal genes. However, there is no research on silencing ARA6 / ARA7 gene expression and trait changes after gene silencing. Summary of the invention

[0004] The present invention provides a method for regulating plant resistance to Verticillium wilt by utilizing gene silencing technology. After silencing the homologous gene of RAB5, the plant exhibits stronger disease resistance.

[0005] The present invention provides a gene silencing vector for silencing a RAB5 homologous gene in a plant, comprising a virus-induced gene silencing vector as a basic vector, connected to a VIGS silencing fragment designed for the RAB5 homologous gene;

[0006] The VIGS silencing fragment includes a fragment with a nucleotide sequence as shown in SEQ ID No.1 and / or SEQ ID No.2.

[0007] In a preferred embodiment of the present invention, the basic vector comprises a TRV vector.

[0008] In a preferred embodiment of the present invention, the primer pair for amplifying the fragment shown in SEQ ID No. 1 includes an upstream primer having a nucleotide sequence shown in SEQ ID No. 3 and a downstream primer shown in SEQ ID No. 4.

[0009] In a preferred embodiment of the present invention, the primer pair for amplifying the fragment shown in SEQ ID No. 2 includes an upstream primer having a nucleotide sequence shown in SEQ ID No. 5 and a downstream primer shown in SEQ ID No. 6.

[0010] The present invention also provides application of the gene silencing vector in improving plant disease resistance.

[0011] In a preferred embodiment of the present invention, the plant includes cotton.

[0012] In a preferred embodiment of the present invention, the disease includes Verticillium wilt.

[0013] The present invention also provides a method for improving plant resistance to diseases, comprising using the above gene silencing vector to suppress the expression of RAB5 homologous genes in the plant genome.

[0014] In a preferred embodiment of the present invention, when the plant is cotton, the RAB5 homologous gene includes GhARA6 and / or GhARA7.

[0015] The present invention also provides the application of the gene silencing vector or the method in creating plant germplasm.

[0016] Beneficial effect: The present invention provides a gene silencing vector for silencing a homologous gene of RAB5 in a plant, and uses the gene silencing vector to silence the gene based on TRV-mediated VIGS technology. Figure 1 According to the process shown, VIGS vectors were constructed for the target genes ARA6 (RABF1) / ARA7 (RABF2b) in cotton, and the DNA fragments containing the coding sequences were connected to the vector carrying TRV2. The constructed gene silencing vectors were used to transform cotton to achieve gene silencing of GhARA6 and GhARA7, thereby obtaining two cotton plants with reduced expression levels of GhARA6 and GhARA7, respectively.

[0017] The present invention uses a method of silencing RAB5 homologous genes to find that it is closely related to plant disease resistance, thereby providing new genes for studying the genetic breeding of cotton germplasm resources. In the embodiment of the present invention, after obtaining cotton plants with low expression of GhARA6 and GhARA7, they were inoculated with Verticillium dahliae, and the results showed that plants with silenced genes GhARA6 / GhARA7 showed stronger disease resistance to Verticillium wilt. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is the experimental flow chart of the present invention;

[0019] Figure 2 This is a diagram showing the results of cDNA sequence amplification of genes GhARA6 and GhARA7;

[0020] Figure 3 This is the result of enzyme digestion of TRV2 vector;

[0021] Figure 4 The TRV-VIGS vector map of GhARA6 and GhARA7;

[0022] Figure 5 This is the result of colony PCR identification;

[0023] Figure 6 The results of the relative expression of the target gene are shown in Figure 2. (a) TRV:GhCLA1 is the positive control, TRV:00 is the blank vector control, and the positive control plants turned white 10 days after VIGS injection. Compared with the control group, no significant developmental phenotypes were found in other experimental groups; (b) is the relative expression of the Gh-ARA6 gene in the plant; (c) is the relative expression of the Gh-ARA7 gene in the plant;

[0024] Figure 7 This is the result of the biomass of Verticillium dahliae in diseased cotton;

[0025] Figure 8 Disease phenotype of upland cotton TM-1 after inoculation with Verticillium dahliae. DETAILED DESCRIPTION

[0026] The present invention provides a gene silencing vector for silencing a RAB5 homologous gene in a plant, comprising a virus-induced gene silencing vector as a basic vector, connected to a VIGS silencing fragment designed for the RAB5 homologous gene;

[0027] The VIGS silencing fragment includes a fragment with a nucleotide sequence as shown in SEQ ID No.1 and / or SEQ ID No.2.

[0028] The present invention does not specifically limit the types of the plants, and conventional plants in the art may be used. For example, cotton is used as an example for experiments in one embodiment, but it cannot be considered as the entire protection scope of the present invention.

[0029] The present invention utilizes TRV-mediated VIGS technology to silence genes ARA6 and / or ARA7, wherein ARA6:>XM_041078078.1, LOC121207708. In one embodiment of the present invention, a VIGS silencing fragment is designed for the cDNA sequence of ARA6, as shown in SEQ ID No. 1:

[0030] AGTGATGGCCTTGGTTGGTAATAAAGCCGACCTTCAGGAAAAGCGCGAAGTACCAGTCCAAGATGGCATTGACTATGCAGAGAAGAATGGGATGTTCTTTATTGAGACATCTGCCAAGACTGCGGACAATATAAATCAGTTGTTTGAGGAAATTGCCAAGCGGCTGCCACGTCCATCACCTTCATG.

[0031] The gene ARA7 of the present invention:>XM_016897970.2, LOC107961815. In one embodiment, a VIGS silencing fragment designed for the cDNA sequence of ARA7 is shown in SEQ ID No. 2:

[0032] GGAAGGTGGCAACAGAGGAAGCACAAACTTATGCTCAGGAGAATGGTCTTTTCTTCATGGAAACTTCTGCAAAGACCGCATCCAATGTCAATGAACTTTTCTATGAAATAGCTAAAAGATTACCTCGAGTGCAGCCAGCACAAAATCCTGCTGGAATGGTTCTCATGGATAGACCTTCAGAAC.

[0033] The present invention uses the cDNA of the plant as a template and uses primers designed with homology arms to amplify the VIGS silencing fragment of the gene to be silenced. In one embodiment, the primer pair shown in SEQ ID No.3 and SEQ ID No.4 is used to amplify the VIGS silencing fragment of GhARA6, and the primer pair shown in SEQ ID No.5 and SEQ ID No.6 is used to amplify the VIGS silencing fragment of GhARA7. The sequences of the primers are shown in order as follows:

[0034] M-ARA6-F:aaggttaccgaattctctagaAGTGATGGCCTTGGTTGGTAAT;

[0035] M-ARA6-R:tgtcttcgggacatgcccgggCATGAAGGTGATGGACGTGGC;

[0036] M-ARA7-F:aaggttaccgaattctctagaGGAAGGTGGCAACAGAGGAAG;

[0037] M-ARA7-R:tgtcttcgggacatgcccgggGTTCTGAAGGTCTATCCATGAGAACC.

[0038] When the amplification is performed in the present invention, the amplification system is calculated in 50 μL, including: 2×PhantaMax Master Mix 25 μL, forward primer (10 μM) 2 μL, reverse primer (10 μM) 2 μL, cDNA template 2 μL and the remaining RNase-free ddH2O; the reagents used to configure the amplification system are purchased from Nanjing Novozyme Biotechnology Co., Ltd.; the amplification program includes: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 sec, annealing at 58°C for 15 sec, extension at 72°C for 45 s, and 30 cycles; thorough extension at 72°C for 5 min.

[0039] The present invention utilizes a double enzyme digestion method to insert the amplified VIGS silencing fragment into a basic vector. In one embodiment, the enzymes used are XbaI and SmaI. For example, the fragment is connected to a TRV2 vector by homologous recombination to construct a TRV-VIGS vector of GhARA6 and GhARA7.

[0040] The present invention also provides application of the gene silencing vector in improving plant disease resistance.

[0041] In a preferred embodiment of the present invention, the plant includes cotton, and the disease includes Verticillium wilt. In one embodiment, verification was performed using cotton plants in which the GhARA6 and GhARA7 genes were silenced, and it was found that after either the GhARA6 or GhARA7 gene was silenced, the resistance to Verticillium dahliae could be significantly improved, thereby improving the resistance to Verticillium wilt.

[0042] The present invention also provides a method for improving plant resistance to diseases, comprising using the above gene silencing vector to suppress the expression of RAB5 homologous genes in the plant genome.

[0043] In a preferred embodiment of the present invention, when the plant is cotton, the RAB5 homologous gene includes GhARA6 and / or GhARA7. When silencing the gene, in one embodiment, the TRV-VIGS vectors of GhARA6 and GhARA7 constructed above are respectively transferred into Agrobacterium GV3101 competent cells, and then cotton is infected with Agrobacterium containing the TRV-VIGS vector of GhARA6 and / or GhARA7, thereby obtaining cotton plants in which GhARA6 and / or GhARA7 are silenced.

[0044] The present invention also provides the application of the gene silencing vector or the method in creating plant germplasm.

[0045] After silencing GhARA6 and / or GhARA7 using the method of the present invention, cotton plants exhibit higher disease resistance, such as cotton Verticillium wilt caused by Verticillium dahliae.

[0046] To further illustrate the present invention, a method for regulating plant resistance to Verticillium wilt using gene silencing technology provided by the present invention is described in detail below in conjunction with examples, but they should not be construed as limiting the scope of protection of the present invention.

[0047] Example 1

[0048] Silencing of ARA6 / ARA7 genes using TRV-mediated VIGS technology:

[0049] 1. The gene fragments of TRV-VIGS as shown in SEQ ID No. 1 and SEQ ID No. 2 were designed according to the cDNA sequences of the genes GhARA6 and GhARA7, and primers M-ARA6-F and M-ARA6-R, as well as M-ARA7-F and M-ARA7-R with homology arms were designed based on the fragments.

[0050] 2. Using cotton leaf cDNA of upland cotton TM-1 as template, PCR amplification was performed with the above primers as upstream and downstream primers to obtain gene fragments with homology arms. The PCR amplification kit was purchased from Nanjing Novozyme Biotechnology Co., Ltd. Figure 2 As shown, it was shown that the cDNA fragments of GhARA6 and GhARA7 were successfully amplified.

[0051] 3. Enzyme digestion of TRV2 vector

[0052] 20μL reaction system: empty vector TRV21μL, 10× buffer2μL, 0.1% BSA2μL, Xbal 1μL, SmaI 1μL and ddH2O 12μL, 37℃ enzyme digestion for 4h. The enzyme digestion results are as follows Figure 3 As shown, two segments, one long and one short, can be cut out.

[0053] 4. Connect it to the vector carrying TRV2 by homologous recombination

[0054] 20μL reaction system: 1μL double-enzyme digested vector, 3μL target gene, 5μL 2×CE Mix and 1μL ddH2O. PCR was performed at 50℃ for 10min and then kept at 4℃ to construct Figure 4 TRV-VIGS vectors for GhARA6 and GhARA7 are shown.

[0055] 5. Transfer to agricultural pole GV3101

[0056] (1) Take out the GV3101 competent cells from the -80°C refrigerator, thaw them on ice for 5 minutes, add 1 μL of vector plasmid, and let it stand on ice for 30 minutes.

[0057] (2) Rapidly place the tube in pre-cooled liquid nitrogen for quick freezing for 5 minutes, then immediately transfer the EP tube to a 37°C water bath for a 5-minute heat shock treatment.

[0058] (3) After the heat shock treatment, add 600 μL of liquid LB medium without antibiotics. Place in a shaker, set the temperature to 28°C, the speed to 200 rpm, and perform shaking culture for 2 to 3 hours.

[0059] (4) Centrifuge the EP tube at 5000 rpm for 1 minute, aspirate 500 μL of the culture medium, and evenly blow the remaining 200 μL of bacteria with a pipette, and spread it on a solid LB medium containing kanamycin (Kan) and rifampicin (Rif).

[0060] (5) Place in an incubator at 28°C and culture for about 2 days. Select a single colony for colony PCR identification and verify by gel electrophoresis. Figure 5 shown.

[0061] 6. Infect cotton with Agrobacterium containing TRV-VIGS vectors of GhARA6 and GhARA7 respectively:

[0062] (1) Planting of cotton seedlings

[0063] Upland cotton TM-1 seeds were soaked in tap water for more than 8 h, and cotton seedlings were cultured in an artificial climate chamber until about 8 days after emergence, when the cotyledons were fully expanded and the cotton had two leaves and one heart.

[0064] (2) Preparation of infection solution

[0065] Agrobacterium containing TRV-VIGS vectors of GhARA6 and GhARA7 were placed in 100 ml LB liquid culture medium with Kan and Rif, respectively, on a shaker at 28°C, shaken at 200 rpm for about 24 hours, and the colonies were collected by centrifugation.

[0066] Prepare 100 ml of resuspension: 1 ml MgCI2, 1 ml MES, 100 μL AS, add sterile water to 100 ml. Mix the TRV2 resuspension containing TRV1 and the target gene fragment in a 1:1 volume ratio to prepare a solution for cotton cotyledon injection.

[0067] (3) Cotton injection

[0068] The prepared infection solution was injected into the cotyledons of cotton. Three leaves were injected for each cotton plant. The injection area of ​​each leaf was at least 2 / 3 of the leaf area. Twelve plants were injected for each gene.

[0069] (4) Verify silencing efficiency

[0070] Extract RNA from infected plant leaves: extract RNA from infected cotton leaves according to the kit and store it at -20°C. Reverse transcription: reverse transcribe the extracted injected cotton RNA into cDNA and store it at -20°C for later use.

[0071] Using cotton EIF4α as the internal reference gene, and the non-VIGS fragments in GhARA6 and GhARA7 as qPCR fragments, a 25 μL system was prepared: 2×SuperRealPreMix Plus 12.5 μL, forward primer (10 μM) 0.75 μL, reverse primer (10 μM) 0.75 μL, cDNA template 1 μL and RNase-free ddH2O 10 μL.

[0072] qEIF4α-F (SEQ ID No. 7):ACATGGACCAGAACACTCGT;

[0073] qEIF4α-R (SEQ ID No. 8):AACCTTCCACTTCGTCCGAT;

[0074] qARA6-F (SEQ ID No. 9): GCTTTGCAGGAACACTTCTCTC;

[0075] qARA6-R (SEQ ID No. 10):TGGGGTCAAACCTGAAATTATTAAA;

[0076] qARA7-F(SEQ ID No.11):GGCCACCACTGGAAACAAGAAC;

[0077] qARA7-R (SEQ ID No. 12): CGGCCAATGTCTGGGAAAAGA;

[0078] The relative expression of the target gene was calculated using the comparative CT method. Where △△Ct=(Ct 目的基因 -Ct 内参基因 ) 实验组 -(Ct 目的基因 -Ct 内参基因 ) 对照 The experimental results were repeated three times and the average value was taken for graphical analysis.

[0079] The results are as follows Figure 6 As shown, TRV:GhCLA1 was used as the positive control and TRV:00 was used as the blank vector control. The positive control plants turned white 10 days after VIGS injection. Compared with the control group, no significant developmental phenotypes were found in other experimental groups. Compared with the control group, the relative expression levels of Gh-ARA6 and Gh-ARA7 genes in the experimental groups were reduced.

[0080] The cotton plants with successful gene silencing were selected for subsequent Verticillium dahliae inoculation experiments:

[0081] (5) Activation and cultivation of Verticillium dahliae

[0082] Take the Verticillium dahliae cultured at -80℃ and spread it on PDA solid culture medium. Activate it in a 20℃ incubator for 5 days, cut it into small pieces of about 1 cm in a clean bench and add it to the Czapek medium prepared in advance. Add about 5 bacterial pieces to every 100 mL of culture medium, place it in a 25℃ shaker, and shake it at 200 rpm for about 7 days.

[0083] (6) Preparation of pathogen inoculation solution

[0084] Measure the OD of bacterial solution using a spectrophotometer 600 After it reaches about 1.0, dilute it 5 to 8 times with tap water to make the pathogen infection solution.

[0085] (7) Inoculation method

[0086] Using the root irrigation method, 50 mL of Verticillium dahliae infection solution was poured at the root of each cotton plant, and the incidence of cotton inoculated with Verticillium dahliae was observed and counted for about 25 days.

[0087] Disease level description: Level 0 - the cotton plants are healthy, without diseased leaves, and growing normally; Level 1 - less than a quarter of the leaves of the cotton plants are diseased, and turn yellow and wilt; Level 2 - more than a quarter but less than half of the leaves of the cotton plants are diseased, and turn yellow and wilt; Level 3 - more than half but less than three quarters of the leaves of the cotton plants are diseased, and turn yellow and wilt; Level 4 - more than three quarters of the leaves of the cotton plants are diseased, or the cotton plants wither and die.

[0088] Disease index = ∑ (number of plants at each disease level × disease index at each level) ÷ (total number of plants surveyed × highest index) × 100%.

[0089] (8) Counting the biomass of Verticillium dahliae in diseased cotton

[0090] The qRT-PCR method was used to count the biomass of Verticillium dahliae in diseased cotton, and cotton EIF4α was used as an internal reference gene. The specific primers for Verticillium dahliae are as follows:

[0091] VdEF-α-F (SEQ ID No. 13): 5′-TGAGTTCGAGGCTGGTATCT-3′;

[0092] VdEF-α-R (SEQ ID No. 14): 5′-CACTTGGTGGTGTCCATCTT-3′.

[0093] 25μL system: 2×SuperReal PreMix Plus 12.5μL, forward primer (10μM) 0.75μL, reverse primer (10μM) 0.75μL, cDNA template 1μL and RNase-free ddH2O 10μL.

[0094] Calculate relative expression: The method is the same as above. Figure 7 As shown, the biomass of Verticillium dahliae was significantly reduced in TRV:GhARA6 and TRV:GhARA7 compared to TRV:00.

[0095] Disease phenotypes of upland cotton TM-1 after inoculation with Verticillium dahliae Figure 8 As shown, 30 days after inoculation with Verticillium dahliae, the incidence of Verticillium wilt in each experimental group from severe to healthy was as follows: TRV:00>TRV:GhARA6,TRV:GhARA7. In the control experimental group not inoculated with Verticillium dahliae, no Verticillium wilt was found in cotton.

[0096] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A gene silencing vector for silencing a RAB5 homologous gene in a plant, characterized in that: It includes a virus-induced gene silencing vector as a basic vector, connected to a VIGS silencing fragment designed for the RAB5 homologous gene; The VIGS silencing fragment includes a fragment with a nucleotide sequence as shown in SEQ ID No.1 and / or SEQ ID No.

2.

2. The gene silencing vector according to claim 1, characterized in that: The base vector includes a TRV vector.

3. The gene silencing vector according to claim 1, characterized in that: The primer pair for amplifying the fragment shown in SEQ ID No. 1 includes an upstream primer having a nucleotide sequence shown in SEQ ID No. 3 and a downstream primer shown in SEQ ID No.

4.

4. The gene silencing vector according to claim 1, characterized in that: The primer pair for amplifying the fragment shown in SEQ ID No.2 includes an upstream primer having a nucleotide sequence shown in SEQ ID No.5 and a downstream primer shown in SEQ ID No.

6.

5. Use of the gene silencing vector according to any one of claims 1 to 4 in improving plant disease resistance.

6. The use according to claim 5, characterized in that: The plants include cotton.

7. The use according to claim 5, characterized in that: The diseases include Verticillium wilt.

8. A method for improving plant resistance to disease, characterized in that: The method comprises using the gene silencing vector according to any one of claims 1 to 4 to suppress the expression of a RAB5 homologous gene in a plant genome.

9. The method according to claim 8, characterized in that: When the plant is cotton, the RAB5 homologous genes include GhARA6 and / or GhARA7.

10. Use of the gene silencing vector according to any one of claims 1 to 4 or the method according to claim 8 or 9 in creating plant germplasm.

Images