Construction method of recombinant canine distemper virus strain for expressing mink parvovirus VP2 protein

Abstract

The invention provides a construction method of a recombinant canine distemper virus strain for expressing mink parvovirus VP2 protein, and relates to the technical field of genetic engineering. According to the construction method, a mink canine distemper virus attenuated vaccine CDV3 strain is adopted as a basis, a mink parvovirus VP2 gene is cloned into canine distemper virus genome cDNA, and a recombinant canine distemper virus rCDV3-mVP2 strain capable of simultaneously expressing CDV protein and MEV VP2 protein is obtained through virus reverse genetic technology rescue. A candidate vaccine strain is provided for research and development of a mink canine distemper and parvovirus enteritis bigeminal recombinant live vaccine.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a method for constructing a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein. Background Art

[0002] Mink parvovirus enteritis and mink distemper are two important infectious diseases that seriously endanger the mink farming industry. Mink parvovirus enteritis is caused by mink parvovirus (MEV), which mainly manifests as acute hemorrhagic enteritis, is highly contagious and has a high mortality rate; mink distemper is caused by canine distemper virus (CDV), which is highly contagious and has a high mortality rate, and often causes secondary infections.

[0003] Currently, there are vaccines on the market that can jointly prevent these two mink infectious diseases, but due to the complex production process of the above-mentioned live vaccines and the large number of immunizations, more effective vaccines need to be further developed.

[0004] CDV is an excellent vector platform for the development of recombinant virus vector vaccines. The successful construction of recombinant viruses expressing parvovirus antigenic proteins with canine distemper virus as a vector provides a good reference for the development of a two-unit recombinant live vaccine for mink distemper and mink parvovirus enteritis with canine distemper virus as a vector. For example: In 2015, Li Zhili used canine distemper virus CDV-L strain to express mink parvovirus VP2 protein. Although the recombinant virus rCDV-MEV-VP2 was rescued, the VP2 protein could not be successfully expressed; in 2015, Qin Lide used canine distemper virus CDV r20 / 8 strain to express codon-optimized canine parvovirus VP2 protein. The recombinant virus could only induce mice to produce low-level anti-CDV neutralizing antibodies. At present, there is no report on the successful construction of a recombinant canine distemper virus expressing mink parvovirus VP2 protein.

[0005] This study developed a recombinant canine distemper virus that can simultaneously express CDV protein and MEV VP2 protein, providing a candidate vaccine strain for the research and development of a combined mink distemper and mink parvovirus enteritis vaccine to achieve protection against canine distemper and mink parvovirus enteritis in pets and economic animals.

[0006] In view of this, the present invention is proposed. Summary of the invention

[0007] The object of the present invention is to provide a method for constructing a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein. The recombinant canine distemper virus strain obtained by the construction method can simultaneously express CDV protein and MEV VP2 protein of the recombinant canine distemper virus rCDV3-mVP2 strain, thereby providing a candidate vaccine strain for the research and development of a combined mink distemper and mink parvovirus enteritis vaccine.

[0008] In order to achieve the above-mentioned purpose of the present invention, the following technical solutions are particularly adopted:

[0009] The present invention provides a method for constructing a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein. The construction method is based on the mink canine distemper virus attenuated CDV3 strain, and a recombinant canine distemper virus strain capable of simultaneously expressing CDV protein and MEV VP2 protein is constructed by viral reverse genetics technology.

[0010] Furthermore, the construction method includes:

[0011] (A) Construction of viral infectious clones:

[0012] The coding nucleotides of the VP2 protein of mink parvovirus SD-4 strain were obtained by PCR amplification and then cloned into the pCR-rCDV3 recombinant plasmid to construct the pCR-rCDV3-mVP2 recombinant plasmid;

[0013] (B) Virus rescue:

[0014] The pCR-rCDV3-mVP2 plasmid and the auxiliary plasmid were co-transfected into BSR cells expressing T7 RNA polymerase, and then co-cultured with susceptible cells to obtain the recombinant canine distemper virus strain.

[0015] Furthermore, the encoding nucleotide sequence of the mink parvovirus VP2 protein in step (A) is shown as SEQ ID NO.1.

[0016] Furthermore, in the pCR-rCDV3-mVP2 recombinant plasmid, MluⅠ and BssHⅡ restriction sites are added to both ends of the coding nucleotide sequence of the mink parvovirus VP2 protein, and a Kozak sequence is added to the 5' end.

[0017] Furthermore, the primer sequence for amplifying the coding nucleotide of the mink parvovirus VP2 protein in step (A) includes:

[0018] A forward primer having a nucleotide sequence as shown in SEQ ID NO.2;

[0019] and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.3.

[0020] Furthermore, the auxiliary plasmid in step (B) comprises:

[0021] pCAGGS-N, pCAGGS-P and pCAGGS-L.

[0022] Furthermore, the competent cells co-transfected in step (B) are BSR cells that can express T7 polymerase.

[0023] Furthermore, in step (B), the susceptible cells are Vero cells that can express canine SLAM receptors.

[0024] The invention provides a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein. The recombinant canine distemper virus strain is prepared by the construction method described in the invention.

[0025] The recombinant canine distemper virus strain obtained by the construction method provided by the present invention can be used for the preparation of vaccines or medicines.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] The method for constructing a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein in the present invention is based on the attenuated CDV3 strain of mink canine distemper virus, cloning the mink parvovirus VP2 gene into its genome, and using virus rescue technology to construct a recombinant canine distemper virus rCDV3-mVP2 strain that simultaneously expresses CDV protein and MEV VP2 protein. The recombinant virus strain provides a basis for the research and development of a combined vaccine for mink distemper and mink parvovirus enteritis. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the specific implementation of the present invention or the technical solution of the prior art, the drawings required for use in the specific implementation or the prior art description are briefly introduced. Obviously, the drawings described below are some implementations of the present invention, and for ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0029] Figure 1 A schematic diagram of the structure of the recombinant CDV genome cDNA plasmid pCR-rCDV3 provided in Example 1 of the present invention;

[0030] Figure 2 A schematic diagram of the structure of the recombinant viral genome plasmid rCDV3-mVP2 provided in Example 2 of the present invention;

[0031] Figure 3 A flowchart of virus rescue provided in Example 3 of the present invention;

[0032] Figure 4 This is a diagram showing the rescue results of the recombinant virus rCDV3-mVP2 provided in Example 3 of the present invention;

[0033] Figure 5 This is a diagram showing the RT-PCR identification results of the recombinant virus rCDV3-mVP2 provided in Example 4 of the present invention;

[0034] Figure 6This is a diagram showing the observation results of the 5th generation cytotoxic morphology of the recombinant virus rCDV3-mVP2 provided in Example 4 of the present invention;

[0035] Figure 7 This is a diagram showing the Western Blot results of the recombinant virus rCDV3-mVP2 provided in Example 4 of the present invention;

[0036] Figure 8a This is a graph showing the results of indirect immunofluorescence identification of the recombinant virus rCDV3-mVP2 using anti-CDV N protein monoclonal antibodies provided in Example 4 of the present invention;

[0037] Figure 8b This is a result diagram of indirect immunofluorescence identification of the recombinant virus rCDV3-mVP2 using anti-MEV VP2 protein monoclonal antibodies provided in Example 4 of the present invention;

[0038] Fig. 9 This is a graph showing the results of the hemagglutination property test of the recombinant virus rCDV3-mVP2 provided in Example 4 of the present invention;

[0039] Fig.10 This is a diagram showing the plaque cloning and purification results of the recombinant virus rCDV3-mVP2 provided in Example 5 of the present invention;

[0040] Fig.11 This is a graph showing the results of verification of the passage stability of the recombinant virus rCDV3-mVP2 provided in Example 5 of the present invention;

[0041] Fig.12 This is the growth curve of the recombinant virus rCDV3-mVP2 provided in Example 7 of the present invention on Vero cells and the induced cell fusion pathology diagram. DETAILED DESCRIPTION

[0042] The technical solution of the present invention will be described clearly and completely in conjunction with the embodiments below. Obviously, the described embodiments are only a part of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0043] According to one aspect of the present invention, a method for constructing a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein is provided. The method is based on the mink canine distemper virus attenuated CDV3 strain, and a recombinant canine distemper virus strain capable of simultaneously expressing CDV protein and MEV VP2 protein is constructed by viral reverse genetics technology.

[0044] The method for constructing a recombinant canine distemper virus strain expressing the mink parvovirus VP2 protein of the present invention is based on the attenuated CDV3 strain of mink canine distemper virus, the mink parvovirus VP2 gene is cloned into its genome, and the recombinant canine distemper virus rCDV3-mVP2 strain that can simultaneously express CDV protein and MEV VP2 protein is constructed by using virus rescue technology. This recombinant virus strain provides a candidate vaccine strain for the research and development of a combined vaccine for mink canine distemper and mink parvovirus enteritis.

[0045] In a preferred embodiment of the present invention, the construction method comprises:

[0046] (A) Construction of full-length infectious clones:

[0047] The coding nucleotides of the VP2 protein of mink parvovirus SD-4 strain were obtained by PCR amplification and then cloned into the pCR-rCDV3 recombinant plasmid to construct the pCR-rCDV3-mVP2 recombinant plasmid;

[0048] (B) Virus rescue:

[0049] The recombinant canine distemper virus strain was obtained by co-transfecting BSR cells expressing T7 RNA polymerase with pCR-rCDV3-mVP2 recombinant plasmid and auxiliary plasmid, and then co-incubating with susceptible cells.

[0050] In a preferred embodiment of the present invention, the encoding nucleotide sequence of the mink parvovirus VP2 protein in step (A) is as shown in SEQ ID NO.1.

[0051]

[0052] In a preferred embodiment of the present invention, in the pCR-rCDV3-mVP2 plasmid, MluⅠ and BssHⅡ restriction sites are added at both ends of the coding nucleotide sequence of mink parvovirus VP2 protein, and a Kozak sequence is added at the 5' end, and the Kozak sequence is 5'-GCCACC-3'.

[0053] In a preferred embodiment of the present invention, the primer sequence for amplifying the coding nucleotide of the mink parvovirus VP2 protein in step (A) comprises:

[0054] A forward primer having a nucleotide sequence as shown in SEQ ID NO.2; and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.3.

[0055] The specific sequence of SEQ ID NO.2 is as follows (primer sequence 5'→3'): GAGCCTAAGTCCTCTCCTAAAAA AaC GT ACCGCCACCATGAGTGATGG.

[0056] The specific sequence of SEQ ID NO.3 is as follows (primer sequence 5'→3'): GTAGATTAGTCAACGCTACAGA GCGCGC TTAATATAATTT TCTAGGTGCTAGTTGAG.

[0057] Note: In the above SEQ ID NO.2 and SEQ ID NO.3 sequences, italics indicate homology arms and horizontal lines indicate restriction sites.

[0058] In a preferred embodiment of the present invention, the helper plasmids in step (B) include: pCAGGS-N, pCAGGS-P and pCAGGS-L.

[0059] In a preferred embodiment of the present invention, the competent cells co-transfected in step (B) are BSR cells that can express T7 polymerase.

[0060] In a preferred embodiment of the present invention, the susceptible cells in step (B) are Vero cells that can express canine SLAM receptors.

[0061] According to one aspect of the present invention, a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein is provided. The recombinant canine distemper virus strain is mainly prepared by the above-mentioned construction method of the recombinant canine distemper virus strain expressing mink parvovirus VP2 protein.

[0062] According to one aspect of the present invention, a recombinant canine distemper virus strain obtained by the above construction method is used in the preparation of vaccines or medicines.

[0063] The recombinant canine distemper virus strain prepared by the construction method of the recombinant canine distemper virus strain expressing the mink parvovirus VP2 protein provided by the present invention can be widely used in the preparation of vaccines or drugs.

[0064] The technical solution of the present invention will be further described below in conjunction with embodiments.

[0065] Example 1 Construction of pCR-rCDV3 recombinant plasmid:

[0066] (I) Viral RNA was extracted from canine distemper virus CDV3 strain and cDNA template was prepared. Primers for amplifying viral cDNA were designed with reference to CDV3 strain included in the GenBank database (GenBank: EU726268.1), and primers for amplifying pCRscript plasmid (pCR plasmid) were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0067] The genome of CDV3 strain was sequenced and the whole genome was divided into 6 segments for amplification according to the distribution of restriction sites.

[0068] Figure 1 This is a schematic diagram of the structure of the recombinant CDV genome cDNA plasmid pCR-rCDV3 provided in this example. Figure 1 T7p-opt is the T7 promoter; HhRbz is the hammer-shaped ribozyme; HdvRz is the delta-hepatitis ribozyme; and T7 Ter is the T7 terminator.

[0069] Table 1: Homologous recombination reaction system

[0070]

[0071]

[0072] The CDV3 genome was amplified using the primers in Table 1, and the high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, R045Q) was used. The reaction system and conditions were set according to the instructions.

[0073] (II) Connection of pCR-rCDV3:

[0074] The CDV3 gene fragments F1, F2, F3, F4, F5, and F6 amplified by high-fidelity enzyme were connected to the blunt-end sequencing vector pCE2-TA-Blunt-Zero and sent to Shanghai Bioengineering for sequencing. After the sequencing was correct, they were connected.

[0075] See Table 1. The upstream and downstream primers of the F1 fragment each contain a 20 bp sequence homologous to the end of the vector. The pCRscript plasmid vector was amplified by reverse PCR with pCR-F and pCR-R primers, and the F1 fragment was connected to synthesize pCR-F1 by homologous recombination. pCR-F1 was double-digested with PmeⅠ and MluⅠ, and F4 was connected by homology arms to obtain pCR-F1-F4. pCR-F1-F4 was double-digested with Eco065Ⅰ and MluⅠ, and F5 was connected by homology arms to obtain pCR-F1-F4-F5. Bln I and MluⅠpCR-F1-F4-F5 were connected to F6 to obtain pCR-F1-F4-F5-F6. The plasmids pEASY-F2 and pEASY-F3, which were connected to the pEASY-Blunt-Zero vector, were double-digested with Ned I and Not I, and then connected by T4 ligase to obtain pEASY-F2-F3. pEASY-F2-F3 and pCR-F1-F4-F5-F6 were digested with PmeⅠ and CpoⅠ and ligated with T4 ligase to obtain the recombinant plasmid pCR-rCDV3 (see Figure 1 ).

[0076] The pCR-rCDV3 recombinant plasmid sequence is shown in SEQ ID NO.4.

[0077]

[0078] Example 2 Construction of cDNA clone of recombinant CDV3 virus genome expressing VP2 protein:

[0079] The pCR-rCDV3 recombinant plasmid was digested with MluⅠ and BssHⅡ, the VP2 gene was amplified with the primers in Table 2, and pCR-rCDV3-mVP2 was constructed by homologous recombinase ligation. The ligation product was transformed into XL-10 competent cells, and a single colony was picked and sent to Biotechnology for sequencing after identification. The correctly sequenced plasmid was named pCR-rCDV3-mVP2.

[0080] Figure 2 This is a schematic diagram of the structure of the recombinant viral genome plasmid pCR-rCDV3-mVP2 provided in this example.

[0081] Figure 2 In the figure, T7 p-opt: T7 promoter; HhRbz: hammer-shaped ribozyme; HdvRz: hepatitis D ribozyme; T7 Ter: T7 terminator; VP2: MEV VP2 gene; GE: transcription termination signal; GS: transcription start signal; CDS: gene coding region; VP2 gene was inserted between P and M genes, MluⅠ and BssHⅡ restriction sites were added at both ends of the CDS region, and GS / GE sequence required for transcription regulation was added to the VP2 gene; GCCACC in italics is the Kozak sequence; lowercase acc is added to adjust the six-base rule.

[0082] Table 2:

[0083]

[0084] Example 3 Rescue of the recombinant CDV3 virus rCDV3-mVP2 expressing VP2 protein:

[0085] Figure 3 This is a flow chart of virus rescue provided in this embodiment.

[0086] See also Figure 3 It can be seen that the virus rescue process includes two processes: transfection and co-incubation with susceptible cells. It requires BSR cells expressing T7 polymerase to achieve viral RNA transcription and expression of auxiliary proteins and provide an environment for the assembly of RNPs, and Vero cells expressing canine SLAM receptors to achieve efficient virus proliferation.

[0087] The specific rescue process is as follows.

[0088] (1) Cell preparation: BSR cells were cultured and passaged in DMEM medium containing 10% fetal bovine serum, and VerodogSLAM cells were cultured and passaged in DMEM medium containing 5% serum. BSR cells were seeded into 6-well plates, and VerodogSLAM cells were passaged in T25 cell flasks at a ratio of 1:3 for later use.

[0089] (2) Transfection: When the density of BSR cells in a 6-well plate reached 80%, transfection was performed. The transfection amount was 8 μg of pCR-rCDV3-mVP2, 0.5 μg of pCAGGS-N, 0.5 μg of pCAGGS-P, and 1 μg of pCAGGS-L.

[0090] (3) Co-incubation: 48 hours after transfection, the cells in the 6-well plate were digested and inoculated into a VerodogSLAM cell bottle with a density of about 50%-60%, mixed evenly, and cultured at 34°C. After the cells were fully grown, 1 / 2 of the cells were taken and co-incubated with the VerodogSLAM cells again.

[0091] (4) Virus collection: After three generations of incubation, the cells and supernatant were collected, frozen and thawed three times, and then centrifuged to obtain the supernatant, which was then packaged and stored in a -80°C refrigerator.

[0092] The rescue results of the recombinant CDV3 strain virus expressing VP2 protein in this example are as follows:

[0093] The pCR-rCDV3-mVP2 plasmid and the auxiliary plasmids pCAGGS-N, pCAGGS-P, and pCAGGS-L were co-transfected into BSR cells at a ratio of 8:0.5:0.5:1. No large-scale cytopathic effect was observed in BSR cells 48 hours after transfection, but large-scale cytopathic effect was observed in VerodogSLAM cells after co-incubation for 48 hours. The virus was collected and tested after repeated freezing and thawing. For specific results, see Figure 4 .

[0094] Figure 4 This is a diagram showing the rescue results of the recombinant virus rCDV3-mVP2 provided in this example.

[0095] Figure 4 Center A is uninfected BSR cells; Figure 4 Middle B is the result of co-transfection of the full-length plasmid and the auxiliary plasmid into BSR cells for 48 h; Figure 4 Center C is uninfected VerodogSLAM cells; Figure 4 D in the middle shows the inoculation of VerodogSLAM cells 48 hours after co-incubation of VerodogSLAM cells for 96 hours.

[0096] Example 3 Identification of recombinant virus rCDV3-mVP2:

[0097] (I) RT-PCR identification of recombinant virus rCDV3-mVP2

[0098] The recombinant virus rCDV3-mVP2 was subcultured on VerodogSLAM cells for seven consecutive times, and the virus liquid of each generation was taken to extract RNA and perform reverse transcription, using primers SEQ ID NO.5 and SEQ ID NO.6.

[0099] The specific sequence of SEQ ID NO.5 is as follows: ATGAGTGATGGAGCAGTTC.

[0100] The specific sequence of SEQ ID NO.6 is as follows: TTAATATAATTTTCTAGGTGCTAGTTGAG.

[0101] PCR was performed using the primers in Table 3 to detect the presence of the VP2 gene in the recombinant virus genome.

[0102] Table 3:

[0103]

[0104]

[0105] The specific results are as follows:

[0106] The recombinant virus rCDV3-mVP2 was serially passaged, and RNA was extracted and the VP2 gene was detected by RT-PCR. The results showed that the recombinant virus genome still carried the VP2 gene after seven consecutive passages.

[0107] Figure 5 This is a diagram of the RT-PCR identification results of the recombinant virus rCDV3-mVP2.

[0108] Figure 5 Middle M: ​​DL 2000DNA marker; 1: negative control; 2: rCDV3-mVP2 P1; 3: rCDV3-mVP2 P2; 4: rCDV3-mVP2 P3; 5: rCDV3-mVP2 P4; 6: rCDV3-mVP2 P5; 7: rCDV3-mVP2 P6; 8: rCDV3-mVP2P7.

[0109] (II) Electron microscopic observation of recombinant virus rCDV3-mVP2:

[0110] The fifth generation of recombinant virus rCDV3-mVP2 was taken and centrifuged at 5 000r / min for 10min after repeated freezing and thawing for 3 times. The supernatant was negatively stained with 2% phosphotungstic acid and observed under electron microscope.

[0111] Figure 6 This is the result of observation on the 5th generation cytotoxic morphology of the recombinant virus rCDV3-mVP2. Figure 6 Electron microscopic examination showed that the isolated strain had the unique morphological characteristics of canine distemper virus.

[0112] (III) Western Blot Identification of Recombinant Virus rCDV3-mVP2:

[0113] VerodogSLAM cells were plated on 60mm dishes. When the cell density reached 70%, the parental rCDV3 strain and the recombinant virus rCDV3-mVP2 were used to infect the cells. When the cells showed obvious lesions, they were collected into 1.5mL centrifuge tubes, centrifuged at 3000rpm for 5min, PBS was discarded, and the cells were frozen at -80℃ for 10min. After the cells were taken out and thawed, 50μL of RIPA lysis buffer containing 1% PMSF was added, and the cells were lysed on ice for 30min. The lysed samples were centrifuged at 4℃ and 12000rpm for 10min, transferred to new centrifuge tubes, 12.5μL loading buffer was added to mix, centrifuged and aliquoted for use.

[0114] Take 10 μL protein sample for SDS-PAGE electrophoresis, run electrophoresis at 200 V constant voltage for 30 min, wet transfer at 100 V constant voltage for 50 min, block with 5% skim milk at room temperature for 2 h, wash twice with TBST, use mouse anti-CDV N protein monoclonal antibody G3N1 and mouse anti-MEV VP2 protein monoclonal antibody as primary antibodies, and Bios goat anti-mouse IgG as secondary antibody. After washing the membrane 4 times with TBST, use chemical fluorescent colorimetric solution ECL for color development.

[0115] Figure 7 This is the Western Blot result of the recombinant virus rCDV3-mVP2.

[0116] Depend on Figure 7 It can be seen that after the recombinant virus rCDV3-mVP2 infected VerodogSLAM cells, the cells were collected and lysed, and samples were prepared for Western Blot detection of the expression of CDV N protein and MEV VP2 protein. The results of Western Blot showed that the expression of CDV N protein and MEV VP2 protein was detected in the recombinant virus rCDV3-mVP2, while the expression of the two proteins was not detected in the uninfected group.

[0117] (IV) Indirect immunofluorescence identification of recombinant virus rCDV3-mVP2:

[0118] VerodogSLAM cells were plated in a 48-well plate, and when the cell density reached 80%, rCDV3 and rCDV3-mVP2 were infected at an MOI of 0.1. After obvious lesions appeared, the culture medium was discarded, 4% tissue fixative was added for fixation for 30 minutes, and PBS was washed twice; 0.5% Triton X-10 was added for permeabilization for 30 minutes, and PBS was washed twice; 1% BSA was added for blocking at room temperature for 1 hour, and PBS was washed twice; mouse anti-CDV N protein monoclonal antibody G3N1 and mouse anti-MEV VP2 protein monoclonal antibody were used as primary antibodies, and FITC-labeled goat anti-mouse IgG (H+L) was used as secondary antibodies. After washing twice with PBS, fluorescence was observed under a fluorescence microscope.

[0119] Figure 8a This is the result of indirect immunofluorescence identification of the recombinant virus rCDV3-mVP2 using anti-CDV N protein monoclonal antibody;

[0120] Figure 8b This is the result of indirect immunofluorescence identification of the recombinant virus rCDV3-mVP2 using anti-MEV VP2 protein monoclonal antibody;

[0121] Depend on Figure 8a and Figure 8b It can be seen that the recombinant virus rCDV3-mVP2 strain and the parental virus rCDV3 strain were used to infect VerodogSLAM cells, and anti-CDV N protein monoclonal antibodies and anti-MEV VP2 protein monoclonal antibodies were used for identification. In the recombinant virus infection group, obvious green fluorescence representing CDV N protein and MEV VP2 protein was observed at the lesion site, while in the parental rCDV3 group, only green fluorescence representing the expression of CDV N protein was observed at the lesion site.

[0122] (V) Detection of hemagglutination properties of recombinant virus rCDV3-mVP2

[0123] The first four generations of cytotoxic isolates were selected as test samples for hemagglutination test. A 1% porcine red blood cell suspension was used in a 96-well V-type reaction plate according to the conventional method, and the reaction was carried out at 4°C for 60 minutes before observation. The highest dilution of 50% red blood cell agglutination was used as the judgment result, and the HA titer of the virus was calculated.

[0124] The hemagglutination properties of the first four generations of recombinant virus rCDV3-mVP2 were tested. The results are shown in Fig. 9 .

[0125] Fig. 9 This is a graph showing the results of the hemagglutination property test of the recombinant virus rCDV3-mVP2. Fig. 9 Middle A is the MEV positive control; Fig. 9 Middle B is rCDV3-mVP2P1 (first generation); Fig. 9Middle C is rCDV3-mVP2 P2 (second generation); Fig. 9 D in the middle is rCDV3-mVP2 P3 (third generation); Fig. 9 Middle E is rCDV3-mVP2P4 (fourth generation).

[0126] Depend on Fig. 9 It can be seen that the hemagglutination titers of the recombinant viruses rCDV3-mVP2-P1, rCDV3-mVP2-P2, rCDV3-mVP2-P3, and rCDV3-mVP2-P4 were 2 3 , 2 7 , 2 7 , 2 8 .

[0127] Example 4 Plaque Purification of Recombinant Virus rCDV3-mVP2

[0128] The plaque purification method of the recombinant virus rCDV3-mVP2 is as follows:

[0129] (1) Take 200 μL of the recombinant virus rCDV3-mVP2 prepared in Example 2 and inoculate it in a 60 mm VerodogSLAM cell dish for overnight culture.

[0130] (2) Prepare agar culture medium: add 0.5 g of low melting point agar to 10 mL of pure water, sterilize at 120° C. for 20 min, cool, add 30 mL of culture medium containing 10% FBS, mix well and set aside.

[0131] (3) Remove the plate, discard the culture medium, pour in 5 mL of agar medium, and cool to room temperature.

[0132] (4) Add 10-fold diluted 0.03% neutral red dye solution to the culture dish for staining.

[0133] When obvious syncytia appear, the virus is plaque purified using low melting point agarose. Obvious plaques can be observed by neutral red staining, and a single plaque is picked for expansion culture.

[0134] Fig.10 This is a diagram showing the plaque cloning and purification results of the recombinant virus rCDV3-mVP2 provided in this example.

[0135] See also Fig.10 , the virus was infected into VerodogSLAM cells and then plaque purified. Fig.10 The middle frame is the enlarged empty spot.

[0136] Example 5 Verification of the stability of recombinant virus rCDV3-mVP2 expressing exogenous genes

[0137] The plaque-purified virus was serially passaged on VerodogSLAM cells for seven times, and the virus titer of each generation of virus was detected on VerodogSLAM. Each detection was repeated twice and the results were averaged.

[0138] Fig.11 This is a graph showing the results of verification of the stability of the recombinant virus rCDV3-mVP2 provided in this example.

[0139] Depend on Fig.11 It can be seen that the purified virus was continuously passaged on VerodogSLAM cells, and the titer of each generation of virus was detected. The results showed that the titer of the recombinant virus was stable after 7 consecutive passages, and the titer was around 10 after the second generation. 4.5 TCID 50 / mL or above.

[0140] Example 6 Study on the in vitro growth characteristics of the recombinant virus rCDV3-mVP2

[0141] To compare the growth kinetics of the recombinant virus rCDV3-mVP2 and the parental rCDV3 strain, the recombinant virus and the parental rCDV3 strain were used to infect Vero cells at an MOI of 0.005, and the viruses were harvested at different time points to plot growth curves.

[0142] Specifically, Vero cells were plated in 24-well plates and cultured overnight at 37°C. Parental virus rCDV3 and recombinant virus rCDV3-mVP2 were inoculated into 24-well plates at MOI = 0.005 and cultured at 37°C. Cells and supernatants were collected at 24, 36, 48, 72, and 96 hours after infection, with two wells collected at each time point, and the supernatant was collected by centrifugation after freeze-thaw three times for virus titer determination.

[0143] Fig.12 This is the growth curve and induced cytopathic effect graph of the recombinant virus rCDV3-mVP2 on Vero cells provided in this example.

[0144] Depend on Fig.12 It can be seen that the recombinant virus rCDV3-mVP2 can induce syncytial cytopathic effects similar to that of the parent. The growth curve shows that the growth characteristics of the recombinant virus and the parent are similar, both reaching the peak of the virus at 72 hours, and the peak titer of the recombinant virus is not significantly different from that of the parent, both exceeding 10 5.0 TCID 50 / mL

[0145] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for constructing a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein, characterized in that: The construction method is based on the attenuated CDV3 strain of mink canine distemper virus, and through the virus reverse genetic technology, a recombinant canine distemper virus strain capable of simultaneously expressing CDV protein and MEV VP2 protein is constructed.

2. The method for constructing a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein according to claim 1, characterized in that: The construction method comprises: (A) Construction of viral infectious clones: The coding nucleotides of the VP2 protein of mink parvovirus SD-4 strain were obtained by PCR amplification and then cloned into the pCR-rCDV3 recombinant plasmid to construct the pCR-rCDV3-mVP2 recombinant plasmid; (B) Virus rescue: The recombinant canine distemper virus strain was obtained by co-transfecting BSR cells expressing T7 RNA polymerase with pCR-rCDV3-mVP2 recombinant plasmid and auxiliary plasmid, and then co-incubating with susceptible cells.

3. The method for constructing a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein according to claim 2, characterized in that: The encoding nucleotide sequence of the mink parvovirus VP2 protein in step (A) is shown in SEQ ID NO.

1.

4. The method for constructing a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein according to claim 2, characterized in that: MluⅠ and BssHIⅡ restriction sites are added to both ends of the nucleotide sequence encoding the mink parvovirus VP2 protein in the pCR-rCDV3-mVP2 plasmid, and a Kozak sequence is added to the 5' end.

5. The method for constructing a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein according to claim 2, characterized in that: The primer sequence for amplifying the coding nucleotide of the mink parvovirus VP2 protein in step (A) comprises: A forward primer having a nucleotide sequence as shown in SEQ ID NO.2; and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.

3.

6. The method for constructing a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein according to claim 2, characterized in that: The auxiliary plasmid in step (B) comprises: pCAGGS-N, pCAGGS-P and pCAGGS-L.

7. The method for constructing a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein according to claim 2, characterized in that: The competent cells for co-transfection in the step (B) are BSR cells that can express T7 polymerase.

8. The method for constructing a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein according to claim 2, characterized in that: The susceptible cells in step (B) are Vero cells (VerodogSLAM cells) that can express canine SLAM receptors.

9. A recombinant canine distemper virus strain expressing mink parvovirus VP2 protein, characterized in that: The recombinant canine distemper virus strain is mainly prepared by the construction method of the recombinant canine distemper virus strain expressing mink parvovirus VP2 protein according to any one of claims 1 to 8.

10. Use of the recombinant canine distemper virus strain obtained by the construction method according to any one of claims 1 to 8 in the preparation of a vaccine.

Images