Monoclonal Antibody Recognizing the H Protein of Canine Distemper Virus, Test Strip and Application

Abstract

The present invention discloses a monoclonal antibody for identifying the H protein of canine distemper virus, a test strip and an application thereof. The monoclonal antibody includes monoclonal antibody 5-8H or monoclonal antibody 9-7B, which has high specificity and sensitivity. The two antibodies can recognize different antigenic epitopes and can be used to prepare a test strip by the double antibody sandwich method. Experiments prove that the monoclonal antibody provided by the present invention has no obvious cross-reaction with canine parvovirus, canine adenovirus, canine coronavirus and canine parainfluenza virus in the preparation of a colloidal gold test strip for detecting canine distemper virus, and has good specificity and higher sensitivity.

Description

Technical Field

[0001] The invention relates to the technical field of immunology and molecular virology, and in particular to a monoclonal antibody for identifying canine distemper virus H protein, a detection test strip and an application thereof. Background Art

[0002] Canine distemper is a highly contagious disease caused by canine distemper virus (CDV) that affects multiple animals and is multi-systemic. With the expansion of wildlife habitats and the increase in interspecies connections, the host range of CDV has continued to expand from the traditional Canidae to Primates, Monkeys, and Carnivora. At the same time, there is evidence that CDV can be transmitted across host species, and its infection spectrum is expanding, causing huge losses to the breeding industry and wildlife protection. Therefore, it is of great significance to develop specific, rapid, and sensitive detection technologies for early detection of CDV.

[0003] CDV belongs to the genus Morbillivirus of the family Paramyxoviridae. It is an enveloped, single-stranded, non-segmented negative-strand RNA virus with a total length of 15 to 16 kb. Its genome mainly encodes nucleocapsid protein (N protein), hemagglutinin (H protein), fusion protein (F protein), phosphoprotein (P protein), large protein (L protein) and matrix protein (M protein); H protein is a type II glycoprotein located in the outer layer of the canine distemper virus envelope, which is closely related to the proliferation and pathogenicity of the virus. H protein recognizes host cell-related receptors to initiate the cell fusion process, thereby leading to cell infection. It can be used as a target antigen in CDV immunological detection.

[0004] At present, the colloidal gold immunochromatography made of N protein is commonly used in the market to detect canine distemper. The diseased materials are mostly nasal mucosal swabs, which have a low cell content and result in a limited amount of N protein after virus infection. In addition, the antibodies used in the existing technology have low specificity or low sensitivity, which will lead to false positive or false negative test results. Summary of the invention

[0005] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a monoclonal antibody, a test strip and an application thereof for identifying the H protein of canine distemper virus. The monoclonal antibodies of the present invention include monoclonal antibody 5-8H and monoclonal antibody 9-7B, which are mouse monoclonal antibodies. The colloidal gold test strip for detecting canine distemper virus prepared by the double antibody sandwich method using the monoclonal antibodies can improve the result compliance rate of detecting canine distemper virus, which is of great significance for the early detection of CDV.

[0006] To achieve the above purpose, the technical solution designed by the present invention is as follows:

[0007] The present invention provides a monoclonal antibody for recognizing canine distemper virus H protein, wherein the monoclonal antibody comprises monoclonal antibody 9-7B or monoclonal antibody 5-8H;

[0008] The monoclonal antibody 9-7B comprises a heavy chain and a light chain, wherein the amino acid sequence of the variable region of the heavy chain of 9-7B is shown in SEQ ID NO: 2;

[0009] The amino acid sequence of the light chain variable region of 9-7B is shown in SEQ ID NO: 4;

[0010] The monoclonal antibody 5-8H comprises a heavy chain and a light chain, wherein the amino acid sequence of the variable region of the heavy chain of 5-8H is shown in SEQ ID NO: 6;

[0011] The amino acid sequence of the 5-8H light chain variable region is shown in SEQ ID NO:8.

[0012] Furthermore, the monoclonal antibody is a mouse monoclonal antibody; the heavy chains of monoclonal antibody 9-7B and monoclonal antibody 5-8H are both IgG1 type, and their light chains are both kappa chains;

[0013] The amino acid sequence of the CDR region of the heavy chain variable region of monoclonal antibody 9-7B is as follows:

[0014] (1) 9-7B-CDR-H1: GFSLTNYG;

[0015] (2) 9-7B-CDR-H2: IWRGGGT;

[0016] (3)9-7B-CDR-H3: AKSGPYYSGEGFAY;

[0017] The amino acid sequence of the CDR region of the light chain variable region of monoclonal antibody 9-7B is as follows:

[0018] (1)9-7B-CDR-L1: QSLLNSRTRKNN;

[0019] (2) 9-7B-CDR-L2:WAS;

[0020] (3) 9-7B-CDR-L3: KQSYNLFT;

[0021] The amino acid sequence of the CDR region of the heavy chain variable region of monoclonal antibody 5-8H is as follows:

[0022] (1) 5-8H-CDR-H1: GYSITSGFF;

[0023] (2) 5-8H-CDR-H2: ISYDGNN;

[0024] (2)5-8H-CDR-H3: TREIYDGFYPFAY;

[0025] The amino acid sequence of the CDR region of the light chain variable region of monoclonal antibody 5-8H is as follows:

[0026] (1) 5-8H-CDR-L1:RDVNTD;

[0027] (2) 5-8H-CDR-L2: SAS;

[0028] (3) 5-8H-CDR-L3: QQHYGTPWT.

[0029] The present invention also provides a gene encoding the monoclonal antibody that recognizes canine distemper virus H protein.

[0030] The nucleotide sequence encoding the heavy chain variable region of the monoclonal antibody 9-7B is shown in SEQ ID NO: 1;

[0031] The nucleotide sequence encoding the light chain variable region of the monoclonal antibody 9-7B is shown in SEQ ID NO: 3;

[0032] The nucleotide sequence encoding the heavy chain variable region of the monoclonal antibody 5-8H is shown in SEQ ID NO: 5;

[0033] The nucleotide sequence encoding the light chain variable region of the monoclonal antibody 5-8H is shown in SEQ ID NO:7.

[0034] The present invention also provides an application of the monoclonal antibody in preparing a colloidal gold test strip for canine distemper virus.

[0035] The present invention also provides a canine distemper virus colloidal gold test strip, wherein the test strip is prepared from the monoclonal antibody 9-7B and the monoclonal antibody 5-8H.

[0036] The present invention also provides a method for preparing the canine distemper virus colloidal gold test strip, comprising the following steps:

[0037] (1) Labeling of gold-labeled conjugate: adjust the pH of colloidal gold solution to 9.0, slowly add monoclonal antibody for 5-8 hours while stirring, stir, add bovine serum albumin, stir, centrifuge to collect precipitate, add gold-labeled buffer to resuspend, centrifuge to collect precipitate, add gold-labeled buffer to resuspend, thus obtaining gold-labeled antibody for later use;

[0038] (2) preparing a gold-labeled pad treatment solution and a sample pad treatment solution, respectively, completely immersing the cut pad in the gold-labeled pad treatment solution and the sample pad treatment solution, and drying overnight to obtain a sample pad and a gold-labeled pad; coating the gold-labeled antibody on the treated gold-labeled pad, and drying;

[0039] (3) Test strip streaking: dilute monoclonal antibody 9-7B and anti-mouse antibody, coat on nitrocellulose membrane as test line and quality control line, assemble into test strip, streak with gold spray streaking instrument, and dry;

[0040] (4) Assembling the test strip: Cut the sample pad and gold label pad, nitrocellulose membrane, and absorbent paper processed in step (2) in sequence, and stick them to the PVC base plate in sequence, cut the test strip into strips, and install the cut test strips in the plastic card holder in the correct direction to obtain the canine distemper virus colloidal gold detection test strip.

[0041] Furthermore, in step (1), the pH is adjusted with 0.2 mol / L potassium carbonate solution;

[0042] The particle size of the colloidal gold solution is in the range of 20 to 40 nm, the mass volume ratio of the monoclonal antibody 5-8H to the colloidal gold solution is 0.01 to 0.02 mg / mL; the volume ratio of the colloidal gold solution to bovine serum albumin is 1:0.01 to 0.05;

[0043] The stirring time is 25 to 30 minutes, and the centrifugal conditions are 4°C, 8500 to 9000 r / min, 40 to 45 minutes;

[0044] The volume ratio of the colloidal gold solution to the gold-labeled buffer added for the first time is 1:1-1.3, and the volume ratio of the colloidal gold solution to the gold-labeled buffer added for the second time is 1:0.03-0.1.

[0045] Furthermore, in step (2), the mat is soaked for 30 to 35 minutes, and the drying condition is 35 to 40° C.; and dried for 3 to 7 hours.

[0046] Furthermore, in step (3), the anti-mouse antibody is a sheep anti-mouse polyclonal antibody; the parameters of the gold spray film analyzer are as follows: the detection line is set to y=19.5mm, the quality control line is set to y=14.5mm, and the interval between the two lines is 5mm; and the samples are dried at 37°C for 20 to 25 minutes.

[0047] Furthermore, in step (3), the monoclonal antibody 9-7B is diluted to 2 mg / mL, and the anti-mouse antibody is diluted to 1 mg / mL.

[0048] The present invention also provides an application of the test strip in detecting biological samples containing canine distemper virus, characterized in that the detection method is: dripping the biological sample containing canine distemper virus onto the sample pad of the test strip, leaving it to stand for 10 to 20 minutes, observing the test line and the quality control line, and if both the quality control line and the test line are displayed, it is positive, and if only the quality control line is displayed, it is negative.

[0049] Beneficial effects of the present invention:

[0050] The present invention uses genetic engineering technology and hybridoma cell technology to screen a monoclonal antibody with high affinity and detection sensitivity for canine distemper virus H protein, including monoclonal antibody 5-8H and monoclonal antibody 9-7B, which has the characteristics of strong specificity and high sensitivity. Experiments have shown that the monoclonal antibody provided by the present invention has no obvious cross-reaction to canine parvovirus, canine adenovirus, canine coronavirus, and canine parainfluenza virus in the preparation of colloidal gold test strips for detecting canine distemper virus, and has good specificity and higher sensitivity. The conformity rate with the canine distemper fluorescence quantitative detection result is 96%, while the colloidal gold test strip made of canine distemper monoclonal antibody N protein sold on the market has a conformity rate of 84%. The test strip invented in this experiment has higher sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 The SDS-PAGE electrophoresis analysis diagram of the purified canine distemper virus H protein provided in the embodiment of the present invention;

[0052] Figure 2 A specific identification diagram of a monoclonal antibody against canine distemper virus H protein provided in an embodiment of the present invention;

[0053] Figure 3 The SDS-PAGE electrophoresis analysis diagram of the purified monoclonal antibody of canine distemper virus H protein provided in the embodiment of the present invention;

[0054] Figure 4 A homology analysis diagram of the nucleotide sequence of the light chain variable region of the monoclonal antibody 9-7B against the canine distemper virus H protein provided in an embodiment of the present invention;

[0055] Figure 5 A homology analysis diagram of the amino acid sequence of the light chain variable region of the monoclonal antibody 9-7B against the canine distemper virus H protein provided in an embodiment of the present invention;

[0056] Figure 6 A homology analysis diagram of the nucleotide sequence of the heavy chain variable region of the monoclonal antibody 9-7B against the canine distemper virus H protein provided in an embodiment of the present invention;

[0057] Figure 7A homology analysis diagram of the amino acid sequence of the heavy chain variable region of the monoclonal antibody 9-7B against the canine distemper virus H protein provided in an embodiment of the present invention;

[0058] Figure 8 A homology analysis diagram of the nucleotide sequence of the light chain variable region of the monoclonal antibody 5-8H of the canine distemper virus H protein provided in an embodiment of the present invention;

[0059] Fig. 9 A homology analysis diagram of the amino acid sequence of the light chain variable region of the monoclonal antibody 5-8H of the canine distemper virus H protein provided in an embodiment of the present invention;

[0060] Fig.10 A homology analysis diagram of the nucleotide sequence of the heavy chain variable region of the monoclonal antibody 5-8H against the canine distemper virus H protein provided in an embodiment of the present invention;

[0061] Fig.11 A homology analysis diagram of the amino acid sequence of the heavy chain variable region of the monoclonal antibody 5-8H against the canine distemper virus H protein provided in an embodiment of the present invention;

[0062] Fig.12 A graph showing specific identification results of a colloidal gold test strip for canine distemper virus provided by an embodiment of the present invention;

[0063] Fig.13 A graph showing the sensitivity identification results of a colloidal gold test strip for canine distemper virus provided by an embodiment of the present invention;

[0064] Fig.14 This is a graph showing the results of clinical sample testing using the canine distemper virus colloidal gold test strip provided in an embodiment of the present invention. DETAILED DESCRIPTION

[0065] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

[0066] Example 1

[0067] Preparation of Canine Distemper Virus H Protein

[0068] This embodiment provides a method for preparing canine distemper virus H protein, and the specific steps are as follows:

[0069] Step 1: Construction of recombinant plasmid

[0070] Sequence alignment was performed according to the CDV sequence of canine distemper virus registered in GenBank, and the amino acid sequence with high conservation and belonging to the extracellular domain of H protein was selected for CHO codon optimization synthesis. The nucleotide sequence after CHO codon optimization is shown in SEQ ID NO: 9. The CDV-H fragment and the PXC17.4 vector of CHO were amplified, fused and transformed into DH5α engineering bacteria using the principle of homologous recombination. Single colonies were picked for PCR identification and sequencing on a culture medium plate containing ampicillin resistance. If the sequencing was correct, the plasmid was extracted by shaking the bacteria without endotoxin.

[0071] Step 2: Preparation of recombinant protein

[0072] The constructed plasmid was linearized with PVU1 and electroporated into CHO cells. After 48 hours, MSX drug screening was performed. After one round of electroporation and three rounds of screening with different drug concentrations, a high-expression CHO cell line was obtained. It was cultured at a high density. 5% Feed A and 1% Feed B were supplemented on the 1st, 3rd and 5th days. On the 7th day, when the cell viability dropped to 80%, samples were collected, centrifuged, the supernatant was collected and filtered, and affinity chromatography was performed for purification. The purified recombinant protein was subjected to SDS-PAGE electrophoresis to determine the purity of the protein. The results are as follows: Figure 1 As shown, H protein was successfully obtained.

[0073] Example 2

[0074] Preparation of monoclonal antibodies against canine distemper virus H protein

[0075] This embodiment provides a method for preparing a monoclonal antibody against canine distemper virus H protein, the specific steps of which are:

[0076] Step 1: Animal immunization

[0077] The canine distemper virus H protein prepared and purified by the CHO expression system in Example 1 was used as an immunogen. For the first immunization, 100 μg of canine distemper virus H protein was mixed with Freund's complete adjuvant in a ratio of 1:1 for each BALB / C mouse and emulsified, and injected subcutaneously at multiple points. For the second immunization after an interval of two weeks, Freund's incomplete adjuvant was used to emulsify the protein, and the protein was injected intraperitoneally and subcutaneously at multiple points. The third and fourth immunizations were the same as the second. At the same time, the mice were tail-cut and blood was collected on the 7th day of the third immunization. The serum titer and neutralization titer of the mice were measured. When the serum titer reached 1:5000-10000 and the neutralization titer reached 1:1000-10000, cell fusion was performed. Before fusion, 50 μg of the immunogen was injected intraperitoneally for three times of booster immunization.

[0078] Step 2: Cell fusion

[0079] (1) Take the spleen of BALB / C mice and prepare spleen cell suspension:

[0080] One immunized BALB / c mouse was sacrificed by orbital blood collection, and its serum was collected as positive serum, which was disinfected by soaking in 75% alcohol for 5 minutes. The disinfected mouse was fixed on the dissection board, with the forelimbs fixed and the hindlimbs crossed and fixed. The skin of the lower abdomen was clamped with forceps, the abdomen was cut open, and then the peritoneum was cut open with another instrument to expose the spleen. The spleen was clamped with forceps, and the adipose tissue adhering to the cells was removed with scissors. The immunized spleen was placed in a petri dish, 3 - 5 mL of 1640 basal medium was added, and the spleen cells were extruded using the white end of the inner core of a 10 mL syringe while fixing the spleen. The cell suspension was then passed through a 200 - mesh cell sieve, the cell suspension was collected, centrifuged at 1000 rpm / min for 10 minutes, the supernatant was discarded, washed twice, resuspended with 1640 basal medium, counted, and stored at 37°C for later use.

[0081] (2) Preparation of myeloma cell suspension:

[0082] Resuscitate myeloma cells two weeks in advance (to ensure that the myeloma cells are in the logarithmic growth phase when used), and expand them to 5 T75 cell culture flasks until the cell quantity reaches that for cell fusion.

[0083] (3) Preparation of feeder cells:

[0084] One day before cell fusion, spleen cells from 6 - 8 - week - old blank BALB / c female mice were taken and added to a 96 - well plate for culture to obtain a cell plate containing feeder cells, thus preparing the feeder cells.

[0085] (4) Cell fusion process:

[0086] PEG (polyethylene glycol) - mediated cell fusion was used. Take the spleen cell suspension and the myeloma cell suspension, mix them in a 50 mL centrifuge tube at a cell number ratio of 5:1, and centrifuge at 1000 rpm / min for 10 minutes. Discard the supernatant, gently flick the bottom of the centrifuge tube with your finger to loosen and mix the two types of cells, place it in a 38°C water bath, slowly add 1 mL of 50% PEG to fuse the cells within 1 minute while mixing, let it stand for 45 s after adding, and continue to stir for 45 s. Slowly add 40 mL of 1640 basal medium pre - warmed at 38°C, place it at 37°C for 10 minutes, centrifuge at 1000 rpm / min for 10 minutes, discard the supernatant, resuspend the precipitate with HAT medium, aliquot it into the cell plate containing feeder cells, and place it in a cell culture incubator at 37°C and 5% CO 2 for culture.

[0087] Step 3: Screening of positive hybridoma cells and cloning of positive hybridoma cells

[0088] When the cell plate containing the fused cells and feeder layer cells is cultured for 8-10 days, 200 μL of the medium in the 96-well plate is discarded and replaced with 200 μL of HT medium. When the fused cell colonies grow to 1 / 4 of the culture well, antibody detection can be performed.

[0089] Take the hybridoma cell supernatant and screen the positive hybridoma cells by indirect ELISA. Select the positive hybridoma cell supernatant for indirect immunofluorescence experiment, select the hybridoma cell supernatant with specific reaction to the virus for further neutralization experiment, clone the hybridoma cell wells with neutralization effect, and dilute the cells in the cell plate wells to 1 cell per well with 1640 complete medium, and place at 37℃, 5% CO 2 After 7-10 days of culture, the monoclonal hybridoma cell clusters were detected according to the above steps, and the positive hybridoma cell clusters were cloned until all monoclonal hybridoma cell clusters were positive, which means that the monoclonal hybridoma cells were successfully subcloned. In this example, two monoclonal antibodies with neutralizing effects were successfully subcloned, named 5-8H and 9-7B.

[0090] Step 4. Preparation of monoclonal antibody ascites

[0091] The established hybridoma cells were expanded and cultured in BALB / c mice to induce ascites to produce monoclonal antibodies. 12-week-old BALB / c mice were intraperitoneally injected with 0.8 mL of ascites-specific adjuvant. 7-10 days later, 1×10 hybridoma cells were intraperitoneally injected. 6 cells / mouse, and the mouse ascites was collected with a syringe after 10 days. Centrifuged at 1200rpm for 5min, the supernatant was collected, and then treated with quartz sand to absorb oil for 24h, and then centrifuged at 12000rpm for 20min, the supernatant was collected, and then filtered with a 0.22μm filter membrane, firstly purified by octanoic acid-ammonium sulfate, and then purified by Protein G column affinity chromatography. The purified ascites was identified and used to prepare colloidal gold test strips.

[0092] Example 3

[0093] Characterization of monoclonal antibodies against canine distemper virus H protein

[0094] This example provides the characterization of monoclonal antibodies against canine distemper virus H protein, including subclass identification, specificity identification, purity identification, sensitivity identification, and concentration determination:

[0095] 1. Identification of monoclonal antibody subclasses against canine distemper virus H protein

[0096] The subclass of the monoclonal antibody of canine distemper virus H protein was detected using an ELISA kit for mouse monoclonal antibody IgG class / subclass identification. The results are shown in Table 1. The heavy chain of the monoclonal antibody of canine distemper virus H protein is IgG1 type, and the light chain is kappa chain.

[0097] Table 1 Monoclonal antibody subclass identification results

[0098]

[0099] 2. Monoclonal antibody specificity identification

[0100] The specificity of monoclonal antibodies against canine distemper virus H protein was detected by indirect immunofluorescence assay.

[0101] (1) Resuscitation of Vero-Slam cells suitable for isolating clinical canine distemper virus, MDCK cells suitable for isolating canine adenovirus and canine parainfluenza virus, and CRFK cells suitable for isolating canine parvovirus constructed in this experiment, and 48-well plates were plated with 10% abw medium. After the monolayer was fully grown, the medium was discarded.

[0102] (2) The isolated American canine distemper virus type 1, canine adenovirus, canine parainfluenza virus, and canine parvovirus were added to a 48-well plate after appropriate dilution. When the typical lesions reached 30%, the supernatant was discarded, and the plate was fixed with 94% paraformaldehyde at room temperature for 30 minutes and washed three times with PBS; 0.02% TritonX-100 was added to permeabilize the cells at room temperature for 20 minutes and washed three times with PBS; the plate was blocked with 10% goat serum at room temperature for 1 hour and washed three times with PBS.

[0103] (3) Add the two monoclonal antibodies to the blocked plates with several different viruses, incubate at 37°C for 1 h, wash three times with PBS, add Alexa Fluor 488-labeled goat anti-mouse IgG (H+L), incubate at 37°C for 1 h, wash three times with PBS, and observe whether there is green fluorescence under a fluorescence microscope.

[0104] The results are as follows Figure 2 The results showed that the two monoclonal antibodies only reacted specifically with canine distemper virus and had no cross-reaction with canine parvovirus, canine adenovirus and canine parainfluenza virus, indicating good specificity.

[0105] 3. Purity identification of monoclonal antibodies against canine distemper virus H protein

[0106] The purified monoclonal antibody was analyzed by SDS-PAGE electrophoresis. Figure 3 As shown, two clear bands appeared near 25 kDa and 50 kDa, 25 kDa was the antibody light chain, 50 kDa was the antibody heavy chain, and there were no other mixed bands, and the purity met the expected requirements.

[0107] 4. Sensitivity identification of monoclonal antibodies against canine distemper virus H protein

[0108] The sensitivity of the two monoclonal antibodies was determined by indirect ELISA. The results are shown in Table 2. The ELISA titer of the two monoclonal antibodies can reach 1:10. 6 .

[0109] Table 2 Monoclonal antibody sensitivity identification

[0110]

[0111] 5. Determination of the concentration of monoclonal antibodies against canine distemper virus H protein

[0112] The concentration of monoclonal antibodies was measured using a nucleic acid protein concentration meter. The results are shown in Table 3.

[0113] Table 3 Monoclonal antibody concentration determination

[0114] Monoclonal antibody name Monoclonal antibody concentration (mg / mL) 9-7B 4.35 5-8H 4.57

[0115] Example 4

[0116] PCR Amplification and Sequence Identification of the Variable Region Gene of Monoclonal Antibody Against Canine Distemper Virus H Protein

[0117] Step 1:

[0118] (1) CDV H protein expressed by the CHO eukaryotic expression system was used to immunize mice. Mouse hybridoma monoclonal cells 9-7B and 5-8H with neutralizing effects were obtained through screening. Hybridoma cells secreting CDV H protein monoclonal antibodies were cultured in 1640 complete medium at 37°C and 5% carbon dioxide until the cell number reached 1×10 7 Total RNA was extracted from cells using a total RNA extraction kit (purchased from Tiangen).

[0119] (2) Reverse transcription was performed according to the following reaction system and conditions: 5 μg RNA, 2 μL Oligo(dT), DEPC H 2 0 to 14μL, put it in 65℃ for 5min, and immediately put it in an ice bath. Take out the sample, add 2μL 10×RT buffer, 1μL RNaseInhibitor, 2μL dNTP (10mM), 1μL MLV. Set the program to 42℃ for 60min, 75℃ for 10min amplification. The reaction product is cDNA.

[0120] Step 2:

[0121] (1) Design specific upstream and downstream universal primers for mouse heavy chain antibody genes and light chain antibody genes, and perform PCR amplification using cDNA as a template. The PCR system is 50 μL: cDNA 3 μL, Phanta Max Super-Fidelity DNA Polymerase 1 μL, 2× Phanta Max Buffer 25 μL, dNTP Mix (10 mM each) 1 μL, upstream primer (10 μM) 2 μL, downstream primer (10 μM) 2 μL, ddH 2 O 16μL. PCR conditions are: 95℃ pre-denaturation for 3 minutes, 95℃ denaturation for 15 seconds, 56℃ annealing for 15 seconds, 72℃ extension for 30 seconds, a total of 35 cycles; the final extension is 72℃ for 5 minutes. The primers for monoclonal antibodies 9-7B and 5-8H are the same, and the nucleotide sequences of the heavy chain upstream primer and downstream primer are:

[0122] Upstream primer: CCAAGCTGTGTCCTGTC;

[0123] Downstream primer: AGAAGGTGTGCACACCGCTGGA;

[0124] The nucleotide sequences of the light chain upstream primer and downstream primer are:

[0125] Upstream primer: CTSTGGTTGTCTGGTGTTGAYGGA;

[0126] Downstream primer: ACTGAGGCACCTCCAGATGTT.

[0127] (2) The PCR products were subjected to 1% gel electrophoresis, and the bands that matched the expected results were cut out and sent to the company for sequencing to obtain the heavy chain and light chain variable region gene sequences.

[0128] Step 3:

[0129] The nucleotide sequence encoding the heavy chain variable region of 9-7B is shown in SEQ ID No: 1;

[0130] The amino acid sequence of the heavy chain variable region encoded by 9-7B is shown in SEQ ID No: 2;

[0131] The nucleotide sequence encoding the light chain variable region of 9-7B is shown in SEQ ID No: 3;

[0132] The amino acid sequence of the light chain variable region encoded by 9-7B is shown in SEQ ID No:4.

[0133] Step 4: 9-7B variable region amino acid sequence and homology analysis:

[0134] The 9-7B heavy chain and light chain gene sequences were compared and analyzed in the NCBI database, such as Figure 4 The analysis results showed that the nucleotide sequence of the light chain variable region of monoclonal antibody 9-7B had the highest homology with the mouse immunoglobulin kappa chain variable region (Sequence ID: U60464.1), with a homology of 332 / 337 and a homology percentage of 99%.

[0135] like Figure 5 The analysis results showed that the amino acid sequence of the light chain variable region of monoclonal antibody 9-7B had the highest homology with the amino acid sequence of the mouse immunoglobulin kappa chain variable region (Sequence ID: AAB03599.18), with a homology of 109 / 112 and a homology percentage of 97%.

[0136] like Figure 6 The results showed that the nucleotide sequence of the heavy chain variable region of monoclonal antibody 9-7B had the highest homology with the mouse immunoglobulin heavy chain variable region (Sequence ID: AB734740.1), with a homology of 334 / 362 and a homology percentage of 92%.

[0137] like Figure 7 The results showed that the amino acid sequence of the heavy chain variable region of monoclonal antibody 9-7B had the highest homology with the amino acid sequence of the heavy chain variable region of mouse immunoglobulin (Sequence ID: BAM75797.1), with a homology of 106 / 119 and a homology percentage of 89%.

[0138] The results of homology analysis of the gene sequence and amino acid sequence encoding the heavy chain and light chain variable regions of monoclonal antibody 9-7B showed that no sequence identical to monoclonal antibody 9-7B was found.

[0139] The sequences of the heavy chain variable region and light chain variable region of monoclonal antibody 9-7B were analyzed to obtain its CDR region.

[0140] Among them, the amino acid sequences of CDR1, CDR2, and CDR3 of the heavy chain variable region of monoclonal antibody 9-7B are shown in Table 4.

[0141] Table 4 CDR amino acid sequences of 9-7B heavy chain variable region

[0142] name sequence 9-7B-CDR-H1 GFSLTNYG 9-7B-CDR-H2 IWRGGGT 9-7B-CDR-H3 AKSGPYYSGEGFAY

[0143] The amino acid sequences of CDR1, CDR2, and CDR3 of the light chain variable region of monoclonal antibody 9-7B are shown in Table 5.

[0144] Table 5 CDR amino acid sequences of 9-7B light chain variable region

[0145] name sequence 9-7B-CDR-L1 QSLLNSRTRKNN 9-7B-CDR-L2 WAS 9-7B-CDR-L3 KQS

[0146] Step 5:

[0147] 5-8H The nucleotide sequence encoding the heavy chain variable region is shown in SEQ ID No: 5;

[0148] 5-8H encodes the amino acid sequence of the heavy chain variable region as shown in SEQ ID No: 6;

[0149] 5-8H The nucleotide sequence encoding the light chain variable region is shown in SEQ ID No: 7;

[0150] The nucleotide sequence encoding the light chain variable region of 5-8H is shown in SEQ ID No:8.

[0151] Step 6:

[0152] 5-8H variable region amino acid sequence and homology analysis

[0153] The heavy chain and light chain gene sequences of monoclonal antibody 5-8H were compared and analyzed in the NCBI database, such as Figure 8 The analysis results showed that the nucleotide sequence of the light chain variable region of the monoclonal antibody 5-8H had the highest homology with the mouse immunoglobulin kappa chain variable region (Sequence ID: PP321974.1), with a homology of 311 / 321 and a homology percentage of 97%.

[0154] like Fig. 9 The analysis results showed that the amino acid sequence of the light chain variable region of the monoclonal antibody 5-8H had the highest homology with the amino acid sequence of the mouse immunoglobulin kappa chain variable region (Sequence ID: WVW32392.1), with a homology of 100 / 107 and a homology percentage of 93%.

[0155] like Fig.10 The results showed that the nucleotide sequence of the heavy chain variable region of monoclonal antibody 5-8H had the highest homology with the mouse immunoglobulin heavy chain variable region (Sequence ID: OM733670.1), with a homology of 341 / 363 and a homology percentage of 94%.

[0156] like Fig.11 The results showed that the amino acid sequence of the heavy chain variable region of monoclonal antibody 5-8H had the highest homology with the amino acid sequence of the heavy chain variable region of mouse immunoglobulin (Sequence ID: AML31351.1), with a homology of 108 / 120 and a homology percentage of 90%.

[0157] The results of homology analysis of the gene sequence and amino acid sequence encoding the heavy chain and light chain variable regions of monoclonal antibody 5-8H showed that no sequence identical to monoclonal antibody 5-8H was found.

[0158] The sequences of the heavy chain variable region and light chain variable region of monoclonal antibody 5-8H were analyzed to obtain their CDR regions.

[0159] Among them, the amino acid sequences of CDR1, CDR2, and CDR3 of the heavy chain variable region of monoclonal antibody 5-8H are shown in Table 6.

[0160] Table 6 CDR amino acid sequences of 5-8H heavy chain variable region

[0161] name sequence 5-8H-CDR-H1 GYSITSGFF 5-8H-CDR-H2 ISYDGNN 5-8H-CDR-H3 TREIYDGFYPFAY

[0162] The amino acid sequences of CDR1, CDR2, and CDR3 of the light chain variable region of monoclonal antibody 5-8H are shown in Table 7.

[0163] Table 7 CDR amino acid sequences of 5-8H light chain variable region

[0164] name sequence 5-8H-CDR-L1 RDVNTD 5-8H-CDR-L2 SAS 5-8H-CDR-L3 QQQHYGTPWT

[0165] Example 5

[0166] Preparation of colloidal gold test strips for canine distemper virus

[0167] The embodiment of the present invention adopts the conventional double antibody sandwich method to prepare the canine distemper virus colloidal gold detection test strip.

[0168] Step 1: Labeling of gold conjugate

[0169] Take 100mL of colloidal gold solution and add 0.2mol / LK 2 CO 3 , adjust to pH 9.0, slowly add 2mg monoclonal antibody for 5-8h under magnetic stirrer, stir at room temperature for 30min, then add 1mL BSA to a final concentration of 1%, and continue stirring for 30min. Centrifuge at 4℃8500r / min for 40min, collect the precipitate. Add gold labeling buffer to reconstitute to the original volume (100mL), centrifuge at 4℃9000r / min for 40min, collect the precipitate. Resuspend the precipitate with 1 / 10 volume of the initial colloidal gold solution (10mL) of gold labeling buffer to obtain the gold-labeled antibody. Store at 4℃ for future use.

[0170] Step 2:

[0171] Prepare gold-labeled pad treatment solution and sample pad treatment solution, completely immerse the cut pad in the gold-labeled pad treatment solution and sample pad treatment solution for 30 minutes respectively, dry in a 37°C oven overnight to obtain the sample pad and gold-labeled pad; apply the gold-labeled antibody on the treated gold-labeled pad and dry for 3 to 7 hours.

[0172] Step 3: Mark the test strip

[0173] Monoclonal antibody 9-7B and goat anti-mouse polyclonal antibody were diluted to the optimal working concentration with PBS solution (monoclonal antibody 9-7B was diluted to 2 mg / mL, and goat anti-mouse IgG was diluted to 1 mg / mL), coated on nitrocellulose membrane as the test line (T line) and quality control line (C line), assembled into test strips, and marked with a gold spray film marker. The machine parameters were modified, the test line was set to y=19.5mm, the quality control line was set to y=14.5mm, and the two lines were separated by 5mm. After marking, the strips were dried in an oven at 37°C for 20min.

[0174] Step 4: Assemble the test strips. Cut the sample pad and gold label pad, NC membrane, and absorbent paper processed in step 2 into appropriate widths and paste them to the PVC base plate in sequence. Each original overlaps about 1mm to ensure the flow of sample liquid. Cut the test strips. Use a strip cutter and set the test strip width in the system parameters to 4mm. Install the cut test strips in the plastic card holder in the correct direction for the next experiment.

[0175] Example 6

[0176] Specific identification of colloidal gold test strips for canine distemper virus

[0177] The prepared canine distemper virus colloidal gold test strips were used to detect canine parvovirus (CPV), canine coronavirus (CCOV), canine adenovirus (CAV-2), canine parainfluenza virus (CPIV) and canine distemper virus (CDV) to analyze the specificity.

[0178] Add biological samples containing various viruses and antibody dilutions onto the sample pad of the colloidal gold test paper, let it stand for 10 to 20 minutes, and observe the test line and quality control line.

[0179] Test results such as Fig.12 It was shown that among the five samples, only one reacted with canine distemper virus, and had no cross reaction with the other four viruses. It also reacted with antibody diluent, indicating that the method had good specificity.

[0180] Example 7

[0181] Sensitivity evaluation of colloidal gold test strips for canine distemper virus

[0182] The prepared canine distemper virus colloidal gold test strips were used to detect the canine distemper virus isolated from the clinic, and the virus was diluted with the sample treatment solution at a ratio of 1:10, 1:20, 1:40, 1:80, 1:160, and 1:320 for detection. The detection method was the same as in Example 6.

[0183] The results are as follows Fig.13As shown, it shows that the sensitivity of the test strip of the embodiment of the present invention can reach 1: 160. Therefore, the colloidal gold test strip prepared by the present invention using the monoclonal antibody of the canine distemper virus H protein has good specificity and sensitivity, and can be distinguished from other common canine viruses.

[0184] Example 8

[0185] Identification of the compliance rate of colloidal gold test strips for canine distemper virus

[0186] 25 clinical samples with background confirmed by canine distemper fluorescence quantitative detection method, fluorescence quantitative detection result standard:

[0187] 1. When the amplification result of the sample to be tested shows a typical S-shaped amplification curve and Ct<40, the viral nucleic acid detection corresponding to the fluorescent channel is positive (when Ct<30, the corresponding viral nucleic acid detection is strongly positive);

[0188] 2. When there is no obvious amplification curve in the amplification result of the sample to be tested, the viral nucleic acid detection corresponding to the fluorescent channel is negative;

[0189] 3. When the amplification result of the sample to be tested shows a typical S-shaped amplification curve and Ct≥40, the viral nucleic acid test result corresponding to the fluorescent channel is questionable and retesting is recommended; if the re-amplification result still shows a typical S-shaped amplification curve, the viral nucleic acid test result corresponding to the fluorescent channel is weakly positive; if the re-amplification result has no obvious amplification curve, the viral nucleic acid test result corresponding to the fluorescent channel is negative.

[0190] The fluorescence quantitative results are shown in Table 8. Among the 25 samples, 6 were positive and 19 were negative.

[0191] At the same time, the colloidal gold test strips prepared with the prepared canine distemper virus H protein monoclonal antibody and the colloidal gold test strips made with the canine distemper virus N protein monoclonal antibody on the market were used for testing, and the coincidence rates of the two methods were compared. The results are as follows Fig.14 As shown, the test strip of the embodiment of the present invention detected 5 positive samples and 20 negative samples, and the detection CT value was 28, which was 96% consistent with the fluorescence quantitative detection result. The colloidal gold test strip made of canine distemper virus N protein monoclonal antibody on the market detected 2 positive samples and 23 negative samples, and the detection CT value was 20, which was 84% ​​consistent with the fluorescence quantitative detection result.

[0192] The results show that the results of both test strips are not as sensitive as the fluorescence quantitative test strips, but the test strips of the embodiment of the present invention have a higher compliance rate and are more sensitive than the test strips of the N protein monoclonal antibody on the market.

[0193] Table 8 Fluorescence quantitative detection results of clinical samples

[0194] Disease material 1 2 3 4 5 6 7 8 9 10 11 12 13 CT value - - - - - 34 - 43 - - 42 - - Disease material 14 15 16 17 18 19 85 50 1-1 2-1 88 4-1 / CT value - - - 40 - - 28 24 20 15 27 40 /

[0195] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all belong to the protection scope of the present invention.

Claims

1. A monoclonal antibody that recognizes canine distemper virus H protein, characterized in that: The monoclonal antibody is monoclonal antibody 9-7B or monoclonal antibody 5-8H; The monoclonal antibody 9-7B comprises a heavy chain and a light chain, wherein the amino acid sequence of the variable region of the heavy chain of 9-7B is shown in SEQ ID NO: 2; The amino acid sequence of the light chain variable region of 9-7B is shown in SEQ ID NO: 4; The monoclonal antibody 5-8H comprises a heavy chain and a light chain, wherein the amino acid sequence of the variable region of the heavy chain of 5-8H is shown in SEQ ID NO: 6; The amino acid sequence of the 5-8H light chain variable region is shown in SEQ ID NO:

8.

2. The monoclonal antibody according to claim 1, characterized in that: The monoclonal antibodies are mouse monoclonal antibodies; the heavy chains of monoclonal antibodies 9-7B and 5-8H are both IgG1 type, and their light chains are both kappa chains; The amino acid sequence of the CDR region of the heavy chain variable region of monoclonal antibody 9-7B is as follows: (1) 9-7B-CDR-H1: GFSLTNYG; (2) 9-7B-CDR-H2: IWRGGGT; (3)9-7B-CDR-H3: AKSGPYYSGEGFAY; The amino acid sequence of the CDR region of the light chain variable region of monoclonal antibody 9-7B is as follows: (1)9-7B-CDR-L1: QSLLNSRTRKNN; (2) 9-7B-CDR-L2:WAS; (3) 9-7B-CDR-L3: KQSYNLFT; The amino acid sequence of the CDR region of the heavy chain variable region of monoclonal antibody 5-8H is as follows: (1) 5-8H-CDR-H1: GYSITSGFF; (2) 5-8H-CDR-H2: ISYDGNN; (2)5-8H-CDR-H3: TREIYDGFYPFAY; The amino acid sequence of the CDR region of the light chain variable region of monoclonal antibody 5-8H is as follows: (1) 5-8H-CDR-L1:RDVNTD; (2) 5-8H-CDR-L2: SAS; (3) 5-8H-CDR-L3: QQHYGTPWT.

3. A gene encoding a monoclonal antibody that recognizes canine distemper virus H protein as claimed in claim 1, characterized in that: The nucleotide sequence encoding the heavy chain variable region of the monoclonal antibody 9-7B is shown in SEQ ID NO: 1; The nucleotide sequence encoding the light chain variable region of the monoclonal antibody 9-7B is shown in SEQ ID NO: 3; The nucleotide sequence encoding the heavy chain variable region of the monoclonal antibody 5-8H is shown in SEQ ID NO: 5; The nucleotide sequence encoding the light chain variable region of the monoclonal antibody 5-8H is shown in SEQ ID NO:

7.

4. Use of the monoclonal antibody as claimed in claim 1 in preparing a colloidal gold test strip for canine distemper virus.

5. A colloidal gold test strip for canine distemper virus, characterized in that: The test strip is prepared from the monoclonal antibody 9-7B and the monoclonal antibody 5-8H as claimed in claim 1.

6. A method for preparing a colloidal gold test strip for canine distemper virus as claimed in claim 5, characterized in that: The following steps are involved: (1) Labeling of gold-labeled conjugate: adjust the pH of colloidal gold solution to 9.0, slowly add monoclonal antibody for 5-8 hours while stirring, stir, add bovine serum albumin, stir, centrifuge to collect precipitate, add gold-labeled buffer to resuspend, centrifuge to collect precipitate, add gold-labeled buffer to resuspend, thus obtaining gold-labeled antibody for later use; (2) preparing a gold-labeled pad treatment solution and a sample pad treatment solution, respectively, completely immersing the cut pad in the gold-labeled pad treatment solution and the sample pad treatment solution, and drying overnight to obtain a sample pad and a gold-labeled pad; coating the gold-labeled antibody on the treated gold-labeled pad, and drying; (3) Test strip streaking: dilute monoclonal antibody 9-7B and anti-mouse antibody, coat on nitrocellulose membrane as test line and quality control line, assemble into test strip, streak with gold spray streaking instrument, and dry; (4) Assembling the test strip: Cut the sample pad and gold label pad, nitrocellulose membrane, and absorbent paper processed in step (2) in sequence, and stick them to the PVC base plate in sequence, cut the test strip into strips, and install the cut test strips in the plastic card holder in the correct direction to obtain the canine distemper virus colloidal gold detection test strip.

7. The preparation method according to claim 6, characterized in that: In the step (1), the pH is adjusted with a 0.2 mol / L potassium carbonate solution; The particle size of the colloidal gold solution is in the range of 20 to 40 nm, the mass volume ratio of the monoclonal antibody 5-8H to the colloidal gold solution is 0.01 to 0.02 mg / mL; the volume ratio of the colloidal gold solution to bovine serum albumin is 1:0.01 to 0.05; The stirring time is 25 to 30 minutes, and the centrifugal conditions are 4°C, 8500 to 9000 r / min, 40 to 45 minutes; The volume ratio of the colloidal gold solution to the gold-labeled buffer added for the first time is 1:1-1.3, and the volume ratio of the colloidal gold solution to the gold-labeled buffer added for the second time is 1:0.03-0.

1.

8. The preparation method according to claim 6, characterized in that: In the step (2), the mat is soaked for 30 to 35 minutes, and the drying condition is 35 to 40° C.; and the drying is performed for 3 to 7 hours.

9. The preparation method according to claim 6, characterized in that: In the step (3), the anti-mouse antibody is a sheep anti-mouse polyclonal antibody; the parameters of the gold spray film streaking instrument are as follows: the detection line is set to y=19.5mm, the quality control line is set to y=14.5mm, and the interval between the two lines is 5mm; and the mixture is dried at 37°C for 20-25min.

10. Use of the test strip as claimed in claim 5 in preparing a product for detecting a biological sample containing canine distemper virus, characterized in that: The detection method is: drop a biological sample containing canine distemper virus onto the sample pad of the test strip, let it stand for 10 to 20 minutes, observe the detection line and the quality control line, and if both the quality control line and the detection line are displayed, it is positive, and if only the quality control line is displayed, it is negative.

Images