A fully premixed fluorescent PCR kit and stabilizer
By using a hot-start Taq polymerase blocked with histidine and Taq enzyme aptamer-binding antibody in a fully premixed fluorescent PCR kit, and adding NaCl, Tween-20, and trehalose as stabilizers, the problem of decreased sensitivity during long-term storage of the kit was solved, and the sensitivity stability of the kit was achieved when stored at 37°C for 7 days and subjected to 3 freeze-thaw cycles or at -20°C for 12 months.
Patent Information
- Application Number
- CN202510117901.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-24
- Publication Date
- 2026-01-27
- Estimated Expiration
- 2045-01-24
AI Technical Summary
In the prior art, existing fluorescent PCR kits suffer from a decrease in sensitivity during long-term storage.
A fully premixed fluorescent PCR kit was prepared by using a hot-start Taq polymerase blocked by histidine and Taq enzyme aptamer binding antibodies. NaCl, Tween-20 and trehalose were added as stabilizers to ensure that the sensitivity of the kit did not decrease when stored at 37°C for 7 days and freeze-thawed 3 times or at -20°C for 12 months.
It achieves sensitivity stability of fully premixed fluorescent PCR kits during long-term storage, is compatible with hot-start Taq enzymes from multiple suppliers, and requires no lyophilization equipment or complex processes.
Smart Images

Figure CN119876354B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of PCR technology, and more specifically, to a fully premixed fluorescent PCR kit and stabilizer. Background Technology
[0002] Fluorescent PCR technology, due to its high sensitivity, high specificity, and rapid result output, has been widely used in various fields such as biological research, medical diagnostics, and food safety. To facilitate use, many commercial companies manufacture fluorescent PCR kits, which fall into three categories: The first type separates the PCR reaction solution and enzyme mix into two components, requiring precise calculation and mixing, which is cumbersome and prone to error. The second type aliquots and lyophilizes the fluorescent PCR reaction solution, requiring only reconstitution with water before use. However, this requires specialized lyophilization equipment, involves complex processes, and has a higher overall cost; it is also not suitable for long-term storage after reconstitution, thus it is mostly used in microfluidic chips or cartridges for single-use. The third type combines all components of the fluorescent PCR reaction solution into a single tube, i.e., a fully premixed kit, which is more convenient and lower in cost. However, fully premixed fluorescent PCR kits suffer from stability issues during long-term storage, with sensitivity decreasing, limiting their application to some extent. This invention primarily addresses the stability problem of decreased sensitivity during storage in fully premixed fluorescent PCR kits.
[0003] Patent application CN114934107A discloses a cryopreservable premixed reaction solution for multiplex reverse transcription fluorescent PCR, which uses a metal ion chelating agent as a stabilizer. This method has low innovation and mainly evaluates whether the Ct value changes during long-term cryopreservation, without evaluating the detection performance for samples at the detection limit concentration. Summary of the Invention
[0004] The purpose of this invention is to provide a fully premixed fluorescent PCR kit and a stabilizer to solve the stability problem of decreased sensitivity during long-term storage of fully premixed fluorescent PCR kits. The stabilizer of this invention for fully premixed fluorescent PCR kits is simple to prepare, requires no lyophilization, and can maintain the sensitivity of the fully premixed fluorescent PCR kits after storage at 37°C for 7 days and three freeze-thaw cycles, or at -20°C for 12 months. It is also compatible with hot-start Taq enzymes from multiple suppliers. The reason why the stability of fully premixed fluorescent PCR kits decreases during long-term storage is still inconclusive. Some believe that the 5' exonuclease activity of Taq polymerase cleaves the 5' fluorescent probe group during storage, while others believe that the fluorescent group becomes unstable and degrades during long-term storage. This invention argues that the main factor is not either of these, but rather that when primers and probes are stored together with hot-start Taq polymerase, the high concentration of primers competes with anti-Taq polymerase antibodies for binding to Taq polymerase. This results in a small portion of the antibody being displaced. This displaced antibody becomes easily denatured after losing its binding state to Taq polymerase. This process is repeated repeatedly during long-term storage and freeze-thaw cycles, leading to a significant proportion of anti-Taq polymerase antibodies denaturing. Ultimately, more primers can bind to Taq polymerase and initiate non-specific amplification, thus reducing reaction sensitivity. The core of this invention lies in using components such as histidine to protect antibodies in conjunction with Taq polymerase aptamers, ensuring that the kit's sensitivity does not decrease when stored at 37°C for 7 days and subjected to 3 freeze-thaw cycles, or at -20°C for 12 months.
[0005] The objective of this invention is achieved through the following technical solution:
[0006] In a first aspect, the present invention provides a stabilizer for a fully premixed fluorescent PCR kit, comprising histidine and a Taq enzyme aptamer.
[0007] As some specific embodiments of the present invention, the concentration of histidine is 0.01M-0.05M.
[0008] As some specific embodiments of the present invention, the concentration of the Taq enzyme aptamer is 1nM-20nM.
[0009] As some specific embodiments of the present invention, the Taq enzyme aptamer has a nucleotide sequence as shown in SEQ ID NO.1 (CAAGACGGGCGGGTGTGGTAGGCGCCCGTG).
[0010] As some specific embodiments of the present invention, the stabilizer further includes at least one of NaCl, Tween-20, and trehalose.
[0011] As some specific embodiments of the present invention, the concentration of NaCl is 0.05M-0.15M;
[0012] And / or, the volume fraction of the Tween-20 is 0.5‰-10‰;
[0013] And / or, the concentration of the trehalose is 0.1M-0.5M.
[0014] Secondly, the present invention provides a PCR premix solution comprising the stabilizer described in any of the above claims, and further comprising antibody-blocked hot-start Taq polymerase, UNG enzyme, and Mg... 2+ and dNTPs.
[0015] As some specific embodiments of the present invention, the concentration of the antibody-blocked hot-start Taq polymerase is 0.05-0.15 U / μL;
[0016] And / or, the concentration of the UNG enzyme is 0.01-0.1 U / μL;
[0017] And / or, the Mg 2+ The concentration is 2-5 mM;
[0018] And / or, the concentration of the dNTPs is 200-400 μM.
[0019] As some specific embodiments of the present invention, the PCR premix is prepared by Tris-HCl buffer with pH 8.5-8.8 and a concentration of 5-50 mM.
[0020] Thirdly, the present invention provides a fully premixed fluorescent PCR kit, comprising a fully premixed PCR solution, wherein the fully premixed PCR solution comprises any of the PCR premixed solutions described above, and further comprises PCR primers and probes.
[0021] This invention does not limit the sequences of PCR primers and probes; any primers and probes used for PCR reactions can achieve the purpose of this invention.
[0022] As some specific embodiments of the present invention, the PCR primers and probes include at least one of primers and probes for detecting the African swine fever P72 gene, primers and probes for detecting the porcine actin gene, and primers and probes for detecting the porcine circovirus type 2 gene.
[0023] Compared with the prior art, the present invention has the following beneficial effects:
[0024] The stabilizer of this invention is simple to prepare, requires no lyophilization, and can maintain the sensitivity of fully premixed fluorescent PCR kits stored at 37°C for 7 days and 3 freeze-thaw cycles, or stored at -20°C for 12 months, without any decrease. It is also compatible with hot-start Taq enzymes from multiple suppliers. Attached Figure Description
[0025] Other features, objects, and advantages of the present invention will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings:
[0026] Figure 1 The PCR amplification curves of the mixed plasmid of African swine fever P72 gene and porcine actin gene in the reaction solutions of groups 1 and 5 in Example 1 are shown.
[0027] Figure 2 The PCR amplification curves of the mixed plasmid of African swine fever P72 gene and porcine actin gene in the reaction solutions of groups 2 and 5 in Example 1 are shown.
[0028] Figure 3 The PCR amplification curves of the reaction solutions of groups 3 and 5 in Example 1 for the mixed plasmid of African swine fever P72 gene and porcine actin gene are shown.
[0029] Figure 4 The reaction solutions of groups 4 and 5 in Example 1 are the PCR amplification curves of the mixed plasmid of African swine fever P72 gene and porcine actin gene.
[0030] Figure 5 The PCR amplification curves for detecting low-concentration mixed plasmids are shown for Example 2, stored at 37°C and -20°C.
[0031] Figure 6 Example 3 shows the PCR amplification curve of porcine circovirus type 2 genomic plasmid at the detection limit concentration after normal freezing at -20℃;
[0032] Figure 7 Example 3 shows the PCR amplification curve of porcine circovirus type 2 genomic plasmid at the detection limit concentration after storage at 37°C for 7 days and three freeze-thaw cycles.
[0033] Figure 8 The PCR amplification curves of porcine circovirus type 2 genomic plasmid at the detection limit concentration were obtained by storing reaction solution 1 at 37°C and -20°C in Example 4.
[0034] Figure 9 The PCR amplification curves of the porcine circovirus type 2 genomic plasmid at the detection limit concentration were obtained by storing reaction solution 2 at 37°C and -20°C in Example 4.
[0035] Figure 10 The PCR amplification curves of the porcine circovirus type 2 genomic plasmid at the detection limit concentration were obtained by storing reaction solution 3 at 37°C and -20°C in Example 4.
[0036] Figure 11 The PCR amplification curves of the porcine circovirus type 2 genomic plasmid at the detection limit concentration were obtained by storing reaction solution 4 in Example 4 at 37°C and -20°C.
[0037] Figure 12 The PCR amplification curves of porcine circovirus type 2 genomic plasmid at the detection limit concentration were obtained by storing reaction solution 5 in Example 4 at 37°C and -20°C.
[0038] Figure 13 This is the PCR amplification curve of the reaction solution prepared by Yisheng Biotechnology using hot-start Taq enzyme and stabilizer, etc., to detect different concentrations of mixed plasmids of African swine fever P72 gene and porcine actin gene.
[0039] Figure 14 The PCR amplification curves for detecting different concentrations of the African swine fever P72 gene and porcine actin gene mixed plasmids in the reaction solution prepared by using Takara hot-start Taq enzyme and stabilizer in Example 5 are shown.
[0040] Figure 15 This is the PCR amplification curve of the reaction solution prepared by Bailige Biotechnology using hot-start Taq enzyme and stabilizer, etc., to detect different concentrations of mixed plasmids of African swine fever P72 gene and porcine actin gene. Detailed Implementation
[0041] The present invention will now be described in detail with reference to specific embodiments. These embodiments will help those skilled in the art to further understand the present invention, but do not limit the invention in any way. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention. These all fall within the scope of protection of the present invention.
[0042] Example 1: Stabilizer Formulation Screening
[0043] 1. Prepare basic fluorescent PCR reaction solution:
[0044] It contains 10 mM Tris-HCl (pH 8.8), 50 mM KCl, 250 nM dNTPs, 4 mM MgCl2, 0.1 U / μL EXTaq hot-start PCR enzyme (Takara RR006, a mixture of anti-Taq monoclonal antibody and TaKaRa Ex Taq, i.e. antibody-blocked hot-start Taq polymerase), 0.02 U / μL UNG enzyme (Takara 2820), 1‰ (v / v) Tween 20, 400 nM African swine fever P72 gene primers, 200 nM African swine fever P72 gene probe, 400 nM porcine actin gene primers, and 200 nM porcine actin gene probe.
[0045] The primer and probe sequences for the African swine fever P72 gene and the porcine actin gene are shown below:
[0046] (1) Primer sequence of African swine fever P72 gene:
[0047] Forward primer: 5'-GATTGGCACAAGTTCGGACA-3' (SEQ ID NO.2),
[0048] Reverse primer: 5'-AGATATAGATGAACATGCGTCTGG-3' (SEQ ID NO.3);
[0049] Probe sequence of the African swine fever P72 gene:
[0050] 5'-CCTGAAAGCTTATCTCTGCGTGGT-3' (SEQ ID NO. 4).
[0051] The probe sequence of the African swine fever P72 gene carries a FAM fluorescent group at the 5' end and a BHQ1 quencher group at the 3' end.
[0052] (2) Primer sequence of the porcine actin gene:
[0053] Forward primer: 5'-GGAAGGACCTCTACGCCAAC-3' (SEQ ID NO.5),
[0054] Reverse primer: 5'-GTGATCTCCTTCTGCATCCTGT-3' (SEQ ID NO.6);
[0055] Probe sequence for the porcine actin gene:
[0056] 5'-ACCACCATGTACCCCGGCATC-3' (SEQ ID NO. 7).
[0057] The probe sequence of the porcine actin gene carries a VIC fluorescent group at the 5' end and a BHQ1 quencher group at the 3' end.
[0058] 2. Prepare 5 sets of fluorescent PCR reaction solutions according to the methods shown in Table 1 below:
[0059] Table 1 Preparation of Fluorescent PCR Reaction Solution
[0060]
[0061] 3. Quantitative real-time PCR detection
[0062] The final concentrations tested were 100 copies / μL and 10 copies / μL of mixed plasmids containing the African swine fever P72 gene (sequence of GenBank: FR682468.1(103590..105530), which was ligated to the PUC57 vector via blunt ends and synthesized by Sangon Biotech) and the porcine actin gene (sequence of GenBank: AY550069.1, which was ligated to the PUC57 vector via blunt ends and synthesized by Sangon Biotech).
[0063] Take 15 μL of the reaction solution from groups 1-5, add 5 μL of template (containing the above mixed plasmid) to prepare a PCR reaction system, and perform real-time PCR in an ABI 7500 fast real-time PCR instrument, repeating twice. PCR amplification conditions are: 95℃ pre-denaturation for 30 seconds; 95℃ denaturation for 5 seconds; 60℃ annealing for 30 seconds, for a total of 40 cycles. Collect fluorescence from the FAM and VIC channels.
[0064] 4. Amplification results:
[0065] Five groups of experiments were performed using PCR, and the amplification curves are shown below. Figure 1-4 As shown. Compared with the control group (group 5) with freshly prepared basal reaction solution, group 1, which was stored at 37℃ for 3 days, showed a worse amplification curve. Figure 1 Group 2, after the addition of histidine, showed a significant improvement in amplification curves compared to Group 1. Figure 2 Group 3, with the addition of working concentrations of Taq enzyme aptamer, did not exhibit a synergistic effect between the Taq enzyme aptamer and anti-Taq enzyme antibody, and the amplification curve remained poor. Figure 3 Group 4 consisted of Group 1 stored at 37℃ with additional anti-Taq enzyme antibody, resulting in a significantly improved amplification curve. Figure 4 ).
[0066] Based on the above results, it can be inferred that the decrease in sensitivity caused by storage at 37℃ is related to the denaturation of the anti-Taq enzyme antibody. Therefore, supplementing with anti-Taq enzyme antibody and adding histidine to the protective antibody can improve the amplification curve. However, when the Taq enzyme aptamer and antibody-blocked hot-start Taq enzyme are used together to prepare the fully premixed fluorescent PCR reaction solution, the stability is significantly reduced. This is because the Taq enzyme aptamer competitively binds to Taq enzyme with the anti-Taq enzyme antibody, and some antibodies aggregate and denature after detaching from Taq enzyme, resulting in insufficient blocking of Taq enzyme activity. Finally, the sensitivity of the fluorescent PCR reaction is significantly reduced, and the hot-start effect mainly comes from the Taq enzyme aptamer rather than the Taq enzyme antibody. Primers and probes added to ordinary fully premixed fluorescent PCR reaction solutions also have a similar effect to Taq enzyme aptamers. Although their affinity for Taq enzyme is not as strong as that of the Taq enzyme aptamer, they can still replace the antibody and lead to stability issues such as decreased sensitivity during long-term storage.
[0067] Example 2 Stabilizer Performance Test
[0068] In this experiment, histidine was added to the fluorescent PCR reaction solution. Histidine is used as an antibody stability protectant in various antibody drugs. NaCl was added to increase the ionic strength, and higher ionic strength also helps to increase antibody stability. Tween20 detergent and trehalose were also added as enzyme and protein stabilizers. The combination of these ingredients was found to significantly enhance the stability of the fluorescent PCR reaction solution.
[0069] Reaction solution preparation: 20 mM histidine, 12% (w / w) trehalose, and 0.1 M NaCl were added to the basic reaction solution formulation of Example 1. The solutions were stored at -20°C for 7 days and at 37°C for 7 days before testing, with the tests repeated twice. The test template and PCR amplification reaction conditions were the same as in Example 1.
[0070] The results are as follows Figure 5 As shown in Table 2, the amplification results for the two low-concentration mixed plasmid samples (African swine fever P72 gene and porcine actin gene, both at a concentration of 10 copies / μL) were still good when stored at 37℃ for 7 days, and the amplification Ct value did not increase compared with that stored at -20℃ for 7 days.
[0071] Table 2. Amplification Ct values under two preservation conditions
[0072] aisle Store at -20℃ for 7 days Store at 37℃ for 7 days FAM 32.87 32.30 FAM 36.13 35.10 VIC 31.99 31.37 VIC 34.14 34.89
[0073] Example 3: Stability Test Based on Detection Limit Level
[0074] 1. Prepare PCR reaction solution for porcine circovirus type 2 detection:
[0075] The formulation contains 10 mM Tris-HCl (pH 8.8), 50 mM KCl, 250 nM dNTPs, 4 mM MgCl2, 0.1 U / μL EX Taq hot-start PCR enzyme (Takara RR006), 0.02 U / μL UNG enzyme (Takara 2820), 1‰ (v / v) Tween20, 20 mM histidine, 12% trehalose, and 0.1 M NaCl. The primers and probes consist of 300 nM porcine circovirus type 2 primers and 150 nM probe.
[0076] Porcine circovirus type 2 primer sequences:
[0077] Forward primer: 5'-GGAGTCTGGTGACCGTTGC-3' (SEQ ID NO.8)
[0078] Reverse primer: 5'-CCAATCACGCTTCTGCATTTT-3' (SEQ ID NO.9)
[0079] Porcine circovirus type 2 probe sequence:
[0080] 5'-CCGCTCACTTTCAAAAGTTCAGCCA-3'(SEQ ID NO.10)
[0081] The porcine circovirus type 2 probe sequence carries a FAM fluorescent group at the 5' end and a BHQ1 quenching group at the 3' end.
[0082] 2. Quantitative Real-Time PCR Detection
[0083] The kit (PCR reaction solution prepared in step 1) was stored at 37°C for 7 days. At 1 day, 3 days, and 5 days, the kit was frozen for 4 hours each time and then placed at 37°C. 15 μL of the reaction solution was added to 5 μL of template for testing. This means that 10 replicates were performed to detect the porcine circovirus type 2 genome (sequence NC_006232.1, ligated to the PUC57 vector via blunt ends, synthesized by Sangon Biotech) plasmid at the detection limit concentration (1 copy / μL). The results were compared with the kit that had been stored at -20°C for 7 days.
[0084] PCR reaction: The reaction was performed using an ABI 7500 fast real-time PCR instrument. The PCR amplification conditions were: 95℃ pre-denaturation for 30 seconds; 95℃ denaturation for 5 seconds; 60℃ annealing for 30 seconds, for a total of 40 cycles. FAM channel fluorescence was collected.
[0085] 3. Test Results
[0086] Test results for kits stored at -20℃ under normal freezing conditions are as follows: Figure 6 As shown, when performing 10 replicate tests on porcine circovirus type 2 genomic plasmid samples at the detection limit concentration (1 copy / μL), the kit stored at -20℃ under normal conditions was detected in all 10 tests; the kit stored at 37℃ for 7 days and subjected to 3 freeze-thaw cycles yielded the following results: Figure 7 As shown, it was detected in only 3 out of 10 tests. Therefore, the stability of the current formulation is still slightly insufficient, and the sensitivity decreased slightly during the pressure test, possibly because the blocking effect of the antibody was reduced under these conditions.
[0087] Example 4: Stability tested again based on detection limit level
[0088] Five reaction solutions were prepared according to the reagent formulations shown in Table 3 and stored at 37°C for 7 days. The solutions were frozen for 4 hours at 1, 3, and 5 days before being placed back at 37°C. Following the detection method in Example 3, 15 μL of each reaction solution was added to 5 μL of template for testing. Ten replicates were performed on the porcine circovirus type 2 genomic plasmid at the detection limit concentration (1 copy / μL). One copy of each reaction solution was stored at -20°C for 7 days for comparison testing.
[0089] Table 3 Reagent Formulation
[0090] Reaction solution 1 The formula is the same as in Example 3. Reaction solution 2 Add 5 nM of Taq enzyme aptamer to reaction solution 1 Reaction solution 3 Prepare using a commercially available PCR mix (Premix Ex Taq (Probe qPCR), Takara R390). Reaction solution 4 Prepared using a commercially available PCRmix that supports full premixing (Yisheng 11827). Reaction solution 5 Replace the 20mM histidine in reaction solution 2 with 20mM arginine.
[0091] The test results for reaction solution 1 are shown below. Figure 8 The reaction solution stored at -20℃ was detected in all 10 tests, while the reaction solution stored at 37℃ and subjected to 3 freeze-thaw cycles was detected in only 4 out of 10 tests; the test results for reaction solution 2 are shown below. Figure 9 The reaction solution stored at -20℃ was detected in all 10 tests, and the reaction solution stored at 37℃ and subjected to 3 freeze-thaw cycles was also detected in all 10 tests; the test results for reaction solution 3 are shown in [see attached table]. Figure 10 The reaction solution stored at -20℃ was detectable in all 10 tests, while the reaction solution stored at 37℃ and subjected to 3 freeze-thaw cycles was not detectable in all 10 tests; the test results for reaction solution 4 are shown in [see attached]. Figure 11 The reaction solution stored at -20℃ was detected in all 10 tests, while the reaction solution stored at 37℃ and subjected to 3 freeze-thaw cycles was detected in only 2 tests; the test results for reaction solution 5 are shown in [see attached]. Figure 12 The reaction solution stored at -20℃ was detected in all 10 tests, while the reaction solution stored at 37℃ and subjected to 3 freeze-thaw cycles was detected in only 3 tests.
[0092] Therefore, although adding Taq enzyme aptamer in Example 1 had a poor effect and did not increase stability, in this example, due to the effects of various antibodies and protein protectants such as histidine, adding a lower concentration of Taq enzyme aptamer achieved a better effect. After storage at 37°C and three freeze-thaw cycles, samples at the detection limit concentration could still be detected with 100% accuracy. The results showed better stability than reaction solution 1, and compared with commercially available fluorescent PCR mixes, it not only had better stability than ordinary fluorescent PCR mixes but also better stability than fluorescent PCR mixes that support full premixing. In reaction solution 5, histidine was replaced with arginine. Although arginine is generally considered to have a protective effect on proteins and antibodies, the final effect was not ideal and was inferior to that of histidine.
[0093] Example 5: Stability test of kits prepared with different Taq enzymes
[0094] 1. Preparation of fluorescent PCR reaction solution: containing 10mM Tris-HCl (pH 8.8), 50mM KCl, 250nM dNTPs, 4mM MgCl2, 400nM African swine fever P72 gene primers, 200nM African swine fever P72 gene probe, 400nM porcine actin gene primers, 200nM porcine actin gene probe, 1‰ (v / v) Tween 20, 10% trehalose, 0.1M NaCl, 5nM Taq polymerase aptamer, and 10mM histidine. Then, add 0.1U / μL hot-start Taq polymerase from three different suppliers (in this example, all are antibody-modified hot-start Taq polymerases, i.e., antibody-blocked Taq polymerases), namely Hieff from Yisheng Biotechnology. HotStart Taq DNA Polymerase(10729), Takara's Ex Hot StartVersion (RR006), purchased from Bailige Biotechnology HS Taq DNA Polymerase (SE0201) should be stored at -20°C or below for 12 months.
[0095] 2. Next, test the mixed plasmids of African swine fever P72 gene and porcine actin gene at final concentrations of 1000 copies / μL, 100 copies / μL, and 10 copies / μL, respectively. Take 15 μL of reaction solution and add 5 μL of template for testing, and repeat the test twice for each. The reaction conditions are the same as in Example 1.
[0096] 3. Results are as follows Figure 13-15 As shown, the results of the next sacred organism are as follows: Figure 13 See Takara enzyme Figure 14 Bailige Biotechnology's View Figure 15 All three concentrations showed good amplification. This example demonstrates that the stabilizer of the present invention exhibits good stability when used with hot-start Taq enzymes from three different suppliers, indicating its high applicability.
[0097] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.
Claims
1. A PCR premix, characterized in that, The mixture comprises 10 mM Tris-HCl, 50 mM KCl, 250 nM dNTPs, 4 mM MgCl2, 1‰ Tween 20, 10% trehalose, 0.1 M NaCl, 5 nM Taq enzyme aptamer, 10 mM histidine, 0.02 U / μL UNG enzyme, and 0.1 U / μL antibody-blocked hot-start Taq polymerase, wherein the Taq enzyme aptamer has the nucleotide sequence shown in SEQ ID NO.
1.
2. A fully premixed fluorescent PCR kit, comprising a fully premixed PCR solution, characterized in that, The PCR premix includes the PCR premix as described in claim 1, and further includes primers and probes.
Citation Information
Patent Citations
Extreme reverse transcription PCR
CN108367287A
One-tube RT-qpcr fully premixed reaction reagent, use, and RT-qpcr method
WO2024045461A1